miRTarBase - #MIRT196275 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PAFAH1B1   
Synonyms LIS1, LIS2, MDCR, MDS, NudF, PAFAH
Description platelet activating factor acetylhydrolase 1b regulatory subunit 1
Transcript NM_000430   
Expression
Putative miRNA Targets on PAFAH1B1
3'UTR of PAFAH1B1
(miRNA target sites are highlighted)
>PAFAH1B1|NM_000430|3'UTR
   1 TTGTGTCTCCTTCGGCCCCTCCTCCCTCTTTTCCTCTGGATGCACTCTGATGATACCATGGTTACCCCATTGAGCTCTGT
  81 TTAAATAAATATTGTCCTTTCATGTAAATTATTCTGGATGTAGATTGAGCTTATTAAATGTTACACACAAAGTATTCATG
 161 CATGGTGAATCCAAATTGTATACTGTAAATTTACATACGTTGTCTAGAAGTACCATAGGGTTTAAAAACCTGGGCTGGCA
 241 TTGGTCACACCAGGCCTAAGAAGGCAGAAGTTGAATCAATTGAACTAGGGCACTAAACTGAATAGTTGACAGTGTCATTT
 321 TATGTTGGATTATTAATTCCTGTTTTTCTTTCTGCTATCTGTTGGTGCCTGACTTGATGGCCTCATTTGGGGAAAAGTGG
 401 TGGTTATTAGGGCTTTTTCTGAAATGTGTATCTATGTAACATCACTTAAGTGTGCTTAATAAATCTTCTGTAAGGATTTT
 481 AGATGATAAGGCTACAATTCAGAATCTTCTGAACCATCTATGTAATGAATGGGGATTATACATTGGAATTTTTGTCATGA
 561 CACATTTGCCAAATCAGTAGGATATATTTGTTTTGGCAGCCTATCACGCAGAGGCTAGTGGTATATTTATGTAAGAAAAT
 641 GACTGTAAATCTCAAGAAAAATCTCAGCAGCTAATAGCAACTCATTTATTTCATTTTGGTCTTAATGCTTTGTAAACAGG
 721 TCAAAAAATACTGTCATACTCTAAGCTTCTATTTTCCACACTGGACATACTTCTAGTTGTATTCTCCATACTATTAGACT
 801 GTGTAGTGATGTGACTTCCAAGTAGAATTTAATCTCCCCATTGAGTGTGTCATGGTACAAATCACTATTCGTTTTTGGTG
 881 TTTTTTAGGGATGTGCAATGTGCATTACATAATGACAGAAATACTGAGAAGGTTCTGTGTGCCCATTTGAAAGGAGTGGG
 961 AGGAATACAGCAGTTTGTTTTTCAACATGAATCTGATATTGATTTAAACTGTGTTTCACTTACAAGTTTTAAAAAAATGA
1041 CAGGGTTTAATGGAGCGTGCATAAAAATGTACTGTTTTCACCTTTTGTTTATATGTAAATGTTTGTAAGTATATGGGCCT
1121 ATCTGTAAGTGGATAAGTCTGTATGTGTGTATCATACACATCAACCTCCATGTCCTTAGTCCTGGGTTTTTGAAAAAGTG
1201 CTAAAACGGACAAGTAGAATAAATGTTGCTGTGGAATGCCATGCTTTAGAACAAACCCTTTTTGATCTTAATGCTTCTGA
1281 AAACTAGGTCTGACTCTGGGGATTTTTTTCCAGCCGAAGGAAAATCACTTCCGTTATGTCCCCCTCTAATTTAGCCGCTC
1361 GACATTTTACACAACCCGGATATGTTGTATATTTTGACCCAAAGTTACAGGTAGGTTTAAGAGAATTTTTAGCCATGACT
1441 TTTGGAGCACTATTCCATTGTCAGTTATTAATAAAGAATTCCATTGCTTAGCTAACCAACAGGTTTTTTTTGTTTCCAAG
1521 AGAGTTATTTGAAAAGTTAACAGAACAATGAGATAACAGTGACAGTTTAACAAAGATAAAATTCTGAACTGCGTTTTATT
1601 CATTTGTGTACTATGTGATTTTTTAAATGTCCCCTTTAGTATTTAATGGAAAATTGGTTCCTGCAAAAGACAAAGGGTGA
1681 GAGTTAGCGTCCTGTAGATACACACAGAGACTAGGCCGTATATTAACTAGAAGCAGCTTTATGTCTAGCTTGTGTCTTTT
1761 TGTTTGTTTGCTTGTTTGTTTTTAGATTCCTGAGAGATGTCTCTGGAAGGGAAAGTTTTGAGAACTAATGGCTATTTTTG
1841 AGGACAAAAATTACATCTTAAGCTAATTCCTTAAATACATACAGTAGGTGAATTTTCAGGACAATATTGCCTCACAACCC
1921 TGCTTACATTGAAAAGTCTTTTTCCCTTAGCTCTTCTGACTGGATTTTTCTACAAAAACTATGGAAAATATCTTTGTTCT
2001 TGTTTGCTGCTATTTTCTGTCCTATTTTGAGAAATATAAATACATAGAAATGGTGCATCTTAACATTTGTTTGTACATGT
2081 ATAAATGTCTTGTATTTTAATTCATTTTTAGCATGAATTGTTTAAGGGTAAGCCACAACATCTAGAAATCACTCATAGAT
2161 ATTGAACAATAAAGGAGAATGGTACCGATGCAGGAGGAAGCAAGCGTGTCTTCCCCTGCAGCACACAGCGACTTGCGTTG
2241 ACAAAGGAGGAGGAAACGATTACTCTGTAAACAAAGTTATCCTTACTTGGGAGATTGCCACAGCCTGCTGCTGAGTTGAG
2321 TTACCAGACATCCTCCATGTGAGAAGCAGCGAACATTGAATCTCAGGGATGGCCCACAACTGGGTCCACATGTAATGAGC
2401 CCTGTTTAATAACGAAGGGGTGGGGGAGAGCAGTCCGTCTACAACCTGGAATCAGATTTGCAAAATTTCCTGCACTGCTG
2481 TCTGACACTGTCCTGTTGATGCCCTTTCTGACTGTGTTCTCTGTTTTCTCTGTCTGCTGTCTAACCCTGTGCCTTGCCTG
2561 GGATAAGGACAATGATGAGGTTACTGGTTTGGATTGTAAGTAGAGGACTTTTATTAATTGGTTTAGAGGTTCACTGCTGC
2641 TTTGTCACTTTCTCAATCAAATTGGCCACTTAAGAAATAAAGAGCTGGTAGAATTGCATCCTCAGATGATTATTGACTGT
2721 GTGTGTGTGTGAAAACAGACATTCCAGTGCCACCCAAATATATATCTGTAACGTGCCCAAGAAATCCTAGCTGCGCTCTT
2801 GAGAGTGCATGCCATGGAGACTGGTTTAGACACCGCGTGGAGCCTAGTTGCCTGTTGTCACGGCATCTTGCACTTTAGGA
2881 GACTAAGACCGTCCTGGTTCGTCTGTGTGTGGTGTGACCAATGGTGTGCCCAGAGCACTACTCTCAAAATCACTAGTGTT
2961 AGCAAGTCGTCCCGGGCTGGGGAGCGTTCGCCGTAGTCTTTGGAAGCTTTGGCTTTAGATTTACCAAGCCCCGCCTCCCC
3041 GCTGCCAGTGCCCTGCTCTCCCGTTCGCCTCTTTCTGTTTCTGTGTGAACTTTCCCGGTAATATCACTCGTTAAATAGGT
3121 TTTCTTTAAACTTAATTAAAGAAAAACTATTTAAAGGTAAAGGATATTTTGTTGACATCGGTGGCTCGATCATCCTTAAG
3201 CAACTGAAGTTAAAATTGTTGAAGGAAAAGGCACTTAAATTGGTTACTTTCATGTCCAGCTGTATATAAGTCCAGTGTGT
3281 TCATCTAGATGACGCAAAGAATCTCCTGGTAGAGAAGCGACATGTAAAAAACTGGTGGAAAAAGGTTTTGGATTTTTTTT
3361 CCAGTGGGGTGGGGGGAGGGCAAGCTGGATTTACAGGTCACGGCTGGACTGAATGGGCCTTTTTATCTTCCCACTGTATC
3441 ATGGAAGTAGCTGCTTGCTTGTACTGTCCATCCTTCAGGCATCCCTAAAGCTCACTCTGAAGATGTTAGAGACAAACACA
3521 AACTCTTCGAGTTAAAGTTGATCCTGACACTGACATGAAGGCAAGCCTTGATTTCGTATGAACGTTGCTGAAGTGGTAAT
3601 TGAGGAAAACAGTTCCCCAGATTGTTAAGAGTTCACTGAAGATATTGACACAATTTTAAAAAATCAGTAAAGGAATGTAT
3681 ATAATATTGCTCTCGTGTTTTACAGTAAGATTTGTTGCTCTCAGACTGTGTAAAACAAAATTTATTCATGTTTTCTGCAT
3761 ATTAAAAAATCTTATTGTACCAACTGGTAAACTATTAAATGCCTATAAAACTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   ||:| ||||||| 
Target 5' tctttgttcTTGTTTGCTGCTa 3'
1991 - 2012 153.00 -12.00
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               :|||  :  ||||||| 
Target 5' agattGCCACAGCCTGCTGCTg 3'
2292 - 2313 145.00 -14.40
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|:|  :||   ||||||| 
Target 5' ttTAGA-GGTTCACTGCTGCTt 3'
2622 - 2642 143.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
159504 1 ClinVar
42176 4 ClinVar
42175 18 ClinVar
322269 533 ClinVar
322277 1042 ClinVar
322279 1057 ClinVar
322287 1519 ClinVar
322296 1932 ClinVar
322324 3326 ClinVar
322332 3627 ClinVar
COSM7483163 1 COSMIC
COSN30526497 8 COSMIC
COSN30458468 11 COSMIC
COSN30477377 34 COSMIC
COSN31527073 38 COSMIC
COSN26669794 63 COSMIC
COSN26668391 71 COSMIC
COSN31533401 78 COSMIC
COSN30145071 79 COSMIC
COSN31550125 95 COSMIC
COSN30127148 199 COSMIC
COSN31581377 227 COSMIC
COSN28314464 349 COSMIC
COSN31479868 360 COSMIC
COSN26636501 398 COSMIC
COSN9657444 495 COSMIC
COSN31572568 510 COSMIC
COSN31542878 602 COSMIC
COSN31585074 609 COSMIC
COSN31482698 764 COSMIC
COSN26561487 814 COSMIC
COSN31608499 826 COSMIC
COSN31595668 887 COSMIC
COSN26583973 903 COSMIC
COSN19142907 980 COSMIC
COSN26553760 1046 COSMIC
COSN8602786 1081 COSMIC
COSN17076197 1399 COSMIC
COSN1715774 1684 COSMIC
COSN28678547 1915 COSMIC
COSN9657446 1979 COSMIC
COSN31583070 1985 COSMIC
COSN31484255 2176 COSMIC
COSN31539207 2262 COSMIC
COSN31523337 2354 COSMIC
COSN31591549 2469 COSMIC
COSN30176884 2470 COSMIC
COSN31588081 2487 COSMIC
COSN25627237 2534 COSMIC
COSN31485092 2704 COSMIC
COSN31562610 2732 COSMIC
COSN31532931 2773 COSMIC
COSN31564725 2856 COSMIC
COSN26509586 2873 COSMIC
COSN29461048 2891 COSMIC
COSN8241222 2955 COSMIC
COSN31540348 2960 COSMIC
COSN31524527 3047 COSMIC
COSN24016100 3262 COSMIC
COSN6100974 3294 COSMIC
COSN23328162 3549 COSMIC
COSN20113258 3628 COSMIC
COSN19036452 3648 COSMIC
COSN31529124 3710 COSMIC
COSN8241224 3750 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs587784251 1 dbSNP
rs113994197 4 dbSNP
rs373032885 14 dbSNP
rs556636713 15 dbSNP
rs771129697 17 dbSNP
rs1230263461 18 dbSNP
rs6628 18 dbSNP
rs1374112708 19 dbSNP
rs746409915 22 dbSNP
rs772420131 23 dbSNP
rs775929844 25 dbSNP
rs1486679001 26 dbSNP
rs1255302335 27 dbSNP
rs1481993547 30 dbSNP
rs1274390431 34 dbSNP
rs959285514 35 dbSNP
rs1256494028 38 dbSNP
rs760974726 39 dbSNP
rs1326255082 41 dbSNP
rs1184396274 42 dbSNP
rs1456517484 45 dbSNP
rs1180522597 53 dbSNP
rs759974572 59 dbSNP
rs139819736 65 dbSNP
rs886052714 65 dbSNP
rs1472736874 70 dbSNP
rs752432989 75 dbSNP
rs935367038 77 dbSNP
rs1391841555 89 dbSNP
rs536120721 90 dbSNP
rs1248981384 95 dbSNP
rs1388952731 102 dbSNP
rs1464754171 103 dbSNP
rs1210802288 105 dbSNP
rs1047961744 107 dbSNP
rs1317811326 112 dbSNP
rs553151340 115 dbSNP
rs1300676876 123 dbSNP
rs1217549581 143 dbSNP
rs1369565384 153 dbSNP
rs1304090986 154 dbSNP
rs1434037536 156 dbSNP
rs908952120 163 dbSNP
rs193287712 167 dbSNP
rs1321809986 168 dbSNP
rs1052532143 171 dbSNP
rs544790451 177 dbSNP
rs1330789044 184 dbSNP
rs1453982993 185 dbSNP
rs1358224345 187 dbSNP
rs1173271352 195 dbSNP
rs893787499 196 dbSNP
rs1397384356 199 dbSNP
rs565081078 200 dbSNP
rs1194775098 216 dbSNP
rs1449446149 220 dbSNP
rs1240924568 223 dbSNP
rs1190982802 230 dbSNP
rs1255638971 231 dbSNP
rs575334141 231 dbSNP
rs1023664461 239 dbSNP
rs905434164 262 dbSNP
rs1003840089 263 dbSNP
rs1227545420 264 dbSNP
rs185431884 269 dbSNP
rs755908657 280 dbSNP
rs1382587404 292 dbSNP
rs1211479774 295 dbSNP
rs1377931374 303 dbSNP
rs559673071 309 dbSNP
rs552081052 328 dbSNP
rs1449829976 329 dbSNP
rs1375501870 339 dbSNP
rs768153429 353 dbSNP
rs997798025 356 dbSNP
rs1052004526 361 dbSNP
rs891999915 362 dbSNP
rs1010396858 365 dbSNP
rs1388867825 369 dbSNP
rs1172911600 370 dbSNP
rs1429502286 374 dbSNP
rs777613383 375 dbSNP
rs368015678 376 dbSNP
rs1178902982 377 dbSNP
rs886052715 388 dbSNP
rs1258296972 394 dbSNP
rs984180918 397 dbSNP
rs1437296648 406 dbSNP
rs910927626 409 dbSNP
rs1158565859 414 dbSNP
rs1050060 419 dbSNP
rs942570584 431 dbSNP
rs1320858816 442 dbSNP
rs968776582 446 dbSNP
rs1310379896 458 dbSNP
rs750894106 459 dbSNP
rs1229666303 466 dbSNP
rs1050061 468 dbSNP
rs141878652 469 dbSNP
rs1306804139 477 dbSNP
rs1407467269 481 dbSNP
rs1390504492 485 dbSNP
rs922398815 491 dbSNP
rs373025491 494 dbSNP
rs1300448481 502 dbSNP
rs1034325824 509 dbSNP
rs1052291068 516 dbSNP
rs1163189951 521 dbSNP
rs1333632770 522 dbSNP
rs1181489872 530 dbSNP
rs886052716 533 dbSNP
rs1482133462 535 dbSNP
rs1374672284 544 dbSNP
rs757270537 547 dbSNP
rs992507270 553 dbSNP
rs893882115 557 dbSNP
rs917836587 558 dbSNP
rs950640393 562 dbSNP
rs1263457949 570 dbSNP
rs188380881 578 dbSNP
rs1335015793 579 dbSNP
rs1341044591 582 dbSNP
rs1225995338 583 dbSNP
rs886052717 589 dbSNP
rs1351761907 597 dbSNP
rs1246678608 602 dbSNP
rs1045470797 604 dbSNP
rs372042235 608 dbSNP
rs755101929 609 dbSNP
rs1463367643 611 dbSNP
rs1395445310 626 dbSNP
rs1158667405 628 dbSNP
rs1263417753 634 dbSNP
rs1471761796 644 dbSNP
rs1365596026 650 dbSNP
rs377148520 652 dbSNP
rs1333920365 662 dbSNP
rs4790090 687 dbSNP
rs748453699 695 dbSNP
rs1004169925 697 dbSNP
rs770277167 699 dbSNP
rs1456056088 700 dbSNP
rs112662089 702 dbSNP
rs1206410658 707 dbSNP
rs1052480290 712 dbSNP
rs892055391 725 dbSNP
rs532794628 729 dbSNP
rs1186076168 731 dbSNP
rs552801278 747 dbSNP
rs1010865940 752 dbSNP
rs1043248233 759 dbSNP
rs952457659 760 dbSNP
rs1443808492 768 dbSNP
rs1372154395 771 dbSNP
rs1320374072 780 dbSNP
rs1455842840 784 dbSNP
rs571366966 785 dbSNP
rs1387426215 787 dbSNP
rs59721618 794 dbSNP
rs1018322023 795 dbSNP
rs773768241 802 dbSNP
rs1034378094 804 dbSNP
rs886052718 807 dbSNP
rs749735684 809 dbSNP
rs1186513320 810 dbSNP
rs1303541745 828 dbSNP
rs977048721 829 dbSNP
rs760466899 831 dbSNP
rs773686561 838 dbSNP
rs1310506724 841 dbSNP
rs922495269 845 dbSNP
rs1354517416 847 dbSNP
rs1026029990 850 dbSNP
rs144602512 853 dbSNP
rs1237124865 859 dbSNP
rs767091688 864 dbSNP
rs915115615 868 dbSNP
rs946753132 870 dbSNP
rs1328374917 871 dbSNP
rs1045163659 872 dbSNP
rs1395708528 875 dbSNP
rs1400125080 899 dbSNP
rs1175662623 900 dbSNP
rs1435254920 902 dbSNP
rs1203413898 910 dbSNP
rs1166418100 913 dbSNP
rs926589397 917 dbSNP
rs1016135964 938 dbSNP
rs963190339 939 dbSNP
rs974530794 950 dbSNP
rs1483953711 958 dbSNP
rs921672611 959 dbSNP
rs1199176687 962 dbSNP
rs1186374989 967 dbSNP
rs1440397557 975 dbSNP
rs567121955 977 dbSNP
rs1210988639 986 dbSNP
rs536220187 988 dbSNP
rs552881841 991 dbSNP
rs1341866087 1005 dbSNP
rs946331754 1010 dbSNP
rs566422973 1014 dbSNP
rs1177085584 1015 dbSNP
rs1314749770 1018 dbSNP
rs1415487680 1020 dbSNP
rs1049178554 1026 dbSNP
rs887953663 1031 dbSNP
rs904722054 1031 dbSNP
rs1419950977 1040 dbSNP
rs55976318 1042 dbSNP
rs937506865 1042 dbSNP
rs1419593851 1048 dbSNP
rs115542660 1054 dbSNP
rs760380019 1057 dbSNP
rs765816438 1058 dbSNP
rs1440111926 1060 dbSNP
rs558285468 1072 dbSNP
rs778579847 1072 dbSNP
rs1014712811 1075 dbSNP
rs1332874738 1078 dbSNP
rs1025659883 1080 dbSNP
rs1233931288 1091 dbSNP
rs1349924587 1092 dbSNP
rs1277915362 1100 dbSNP
rs1444290885 1104 dbSNP
rs1299763689 1108 dbSNP
rs1338170416 1110 dbSNP
rs148413152 1122 dbSNP
rs1301546260 1124 dbSNP
rs1313436758 1126 dbSNP
rs554822163 1133 dbSNP
rs4790356 1134 dbSNP
rs1488927379 1136 dbSNP
rs1178494724 1137 dbSNP
rs1219476955 1142 dbSNP
rs1016188676 1145 dbSNP
rs879489062 1148 dbSNP
rs1467440779 1149 dbSNP
rs554970437 1154 dbSNP
rs1214540816 1169 dbSNP
rs1328827347 1176 dbSNP
rs967921347 1180 dbSNP
rs981241707 1181 dbSNP
rs926711864 1184 dbSNP
rs1274221307 1192 dbSNP
rs974581752 1199 dbSNP
rs1372875871 1203 dbSNP
rs1438678577 1203 dbSNP
rs1326393218 1204 dbSNP
rs939463249 1208 dbSNP
rs564420150 1209 dbSNP
rs1028791927 1213 dbSNP
rs1160577561 1218 dbSNP
rs954503778 1232 dbSNP
rs1409305004 1242 dbSNP
rs1172473558 1243 dbSNP
rs1453179515 1254 dbSNP
rs1255281277 1256 dbSNP
rs987597132 1259 dbSNP
rs757107142 1265 dbSNP
rs945684042 1268 dbSNP
rs765238739 1272 dbSNP
rs574769094 1273 dbSNP
rs1420176208 1276 dbSNP
rs1317566185 1279 dbSNP
rs926197863 1288 dbSNP
rs751531897 1295 dbSNP
rs1343146264 1297 dbSNP
rs886052719 1298 dbSNP
rs1350041781 1302 dbSNP
rs1303786322 1303 dbSNP
rs1293739205 1305 dbSNP
rs1434107361 1309 dbSNP
rs1359368468 1315 dbSNP
rs1369345810 1316 dbSNP
rs1358047763 1319 dbSNP
rs540611470 1321 dbSNP
rs1433333094 1324 dbSNP
rs1384537011 1330 dbSNP
rs755110290 1332 dbSNP
rs560812874 1333 dbSNP
rs1039639042 1334 dbSNP
rs1353829340 1340 dbSNP
rs950193639 1341 dbSNP
rs1047573455 1343 dbSNP
rs1236968013 1347 dbSNP
rs887155933 1353 dbSNP
rs1208821276 1354 dbSNP
rs528384739 1357 dbSNP
rs372853134 1358 dbSNP
rs899084782 1361 dbSNP
rs546427714 1362 dbSNP
rs1377996204 1363 dbSNP
rs1028844258 1364 dbSNP
rs1310483953 1374 dbSNP
rs1222850716 1375 dbSNP
rs563035436 1378 dbSNP
rs1803914 1379 dbSNP
rs756452734 1387 dbSNP
rs1008670412 1388 dbSNP
rs1173066642 1400 dbSNP
rs1020449445 1416 dbSNP
rs980619981 1417 dbSNP
rs550428661 1424 dbSNP
rs180689818 1434 dbSNP
rs542753644 1435 dbSNP
rs978403742 1436 dbSNP
rs992208830 1443 dbSNP
rs1252780504 1447 dbSNP
rs1160377134 1449 dbSNP
rs929324549 1451 dbSNP
rs1291094002 1453 dbSNP
rs1405774980 1455 dbSNP
rs1399873834 1456 dbSNP
rs925581210 1461 dbSNP
rs567336301 1463 dbSNP
rs958963581 1465 dbSNP
rs183742421 1469 dbSNP
rs991690623 1483 dbSNP
rs1371814248 1489 dbSNP
rs943652883 1495 dbSNP
rs1459504738 1496 dbSNP
rs1462832455 1497 dbSNP
rs886052720 1497 dbSNP
rs1393967538 1498 dbSNP
rs1163014928 1500 dbSNP
rs917449806 1501 dbSNP
rs1418648220 1503 dbSNP
rs546188767 1504 dbSNP
rs796267907 1504 dbSNP
rs902010027 1504 dbSNP
rs933695341 1505 dbSNP
rs1376912435 1506 dbSNP
rs1467845312 1508 dbSNP
rs950263381 1512 dbSNP
rs1049972 1513 dbSNP
rs1050846426 1519 dbSNP
rs886052721 1519 dbSNP
rs1194818624 1520 dbSNP
rs1335155892 1532 dbSNP
rs1373296714 1539 dbSNP
rs777967977 1547 dbSNP
rs1236266881 1549 dbSNP
rs1229421714 1554 dbSNP
rs1254603065 1555 dbSNP
rs1047179367 1557 dbSNP
rs1292403239 1559 dbSNP
rs908629589 1570 dbSNP
rs1309819714 1573 dbSNP
rs892113597 1577 dbSNP
rs1213223551 1578 dbSNP
rs867491342 1584 dbSNP
rs1324365304 1585 dbSNP
rs1443372695 1586 dbSNP
rs1395509666 1587 dbSNP
rs1259020612 1592 dbSNP
rs1459133870 1593 dbSNP
rs1451763793 1594 dbSNP
rs886052722 1602 dbSNP
rs1038398155 1603 dbSNP
rs771285856 1614 dbSNP
rs150102551 1619 dbSNP
rs1009219636 1621 dbSNP
rs373899962 1625 dbSNP
rs1250907627 1631 dbSNP
rs1195267612 1632 dbSNP
rs1468595323 1642 dbSNP
rs1260633137 1649 dbSNP
rs1202810361 1655 dbSNP
rs1231073477 1663 dbSNP
rs1241488754 1664 dbSNP
rs188851173 1664 dbSNP
rs746431304 1666 dbSNP
rs1301630929 1670 dbSNP
rs1363614179 1671 dbSNP
rs763051632 1676 dbSNP
rs1380796358 1682 dbSNP
rs886052723 1682 dbSNP
rs1009137509 1684 dbSNP
rs1327678307 1688 dbSNP
rs1033480968 1689 dbSNP
rs1433956436 1690 dbSNP
rs771559476 1691 dbSNP
rs1163739428 1693 dbSNP
rs1400657635 1699 dbSNP
rs1466700510 1700 dbSNP
rs1454571092 1705 dbSNP
rs1372327075 1706 dbSNP
rs538507903 1714 dbSNP
rs1353449357 1716 dbSNP
rs142487524 1718 dbSNP
rs999876252 1719 dbSNP
rs1286484055 1728 dbSNP
rs1032670622 1741 dbSNP
rs958349891 1743 dbSNP
rs1233131042 1744 dbSNP
rs1278853943 1751 dbSNP
rs1213693519 1754 dbSNP
rs1279041993 1755 dbSNP
rs1270043121 1757 dbSNP
rs1320334453 1757 dbSNP
rs950829848 1759 dbSNP
rs1328435275 1760 dbSNP
rs775033502 1761 dbSNP
rs1373505283 1768 dbSNP
rs909244155 1772 dbSNP
rs991742736 1776 dbSNP
rs886052724 1796 dbSNP
rs150958040 1800 dbSNP
rs1166009293 1802 dbSNP
rs1476152156 1815 dbSNP
rs971639434 1816 dbSNP
rs1186552650 1826 dbSNP
rs1473920831 1835 dbSNP
rs1259062542 1836 dbSNP
rs1213626655 1839 dbSNP
rs1210655029 1841 dbSNP
rs1443562614 1842 dbSNP
rs528153116 1846 dbSNP
rs568932476 1849 dbSNP
rs140369024 1858 dbSNP
rs768786456 1859 dbSNP
rs1295263655 1867 dbSNP
rs1187002903 1868 dbSNP
rs1038449778 1874 dbSNP
rs921288695 1876 dbSNP
rs1424104428 1880 dbSNP
rs1335102605 1882 dbSNP
rs1326542555 1903 dbSNP
rs1411481832 1905 dbSNP
rs886052725 1907 dbSNP
rs1163730870 1912 dbSNP
rs16952324 1915 dbSNP
rs1419380409 1918 dbSNP
rs945144269 1919 dbSNP
rs1188048597 1924 dbSNP
rs890375326 1929 dbSNP
rs149797541 1932 dbSNP
rs886052726 1932 dbSNP
rs574872873 1939 dbSNP
rs1041957439 1940 dbSNP
rs540633363 1944 dbSNP
rs1414528669 1948 dbSNP
rs902993187 1950 dbSNP
rs1333054399 1952 dbSNP
rs1342808139 1954 dbSNP
rs1275058505 1959 dbSNP
rs1228977123 1972 dbSNP
rs554168515 1976 dbSNP
rs1277668215 1980 dbSNP
rs999927123 1983 dbSNP
rs886052727 1991 dbSNP
rs57089174 1992 dbSNP
rs1269839889 1993 dbSNP
rs896427553 1996 dbSNP
rs1396234198 1997 dbSNP
rs1164941546 2005 dbSNP
rs1399651855 2007 dbSNP
rs1013357185 2010 dbSNP
rs181192011 2013 dbSNP
rs894181082 2017 dbSNP
rs1471476459 2018 dbSNP
rs1193410102 2020 dbSNP
rs1345788622 2020 dbSNP
rs1026138758 2022 dbSNP
rs1255151639 2025 dbSNP
rs1222639360 2029 dbSNP
rs563150609 2037 dbSNP
rs1012545592 2038 dbSNP
rs1282316580 2040 dbSNP
rs1166868516 2048 dbSNP
rs950799862 2050 dbSNP
rs1006263272 2054 dbSNP
rs571344272 2056 dbSNP
rs1221077429 2065 dbSNP
rs1372677284 2066 dbSNP
rs1293725283 2069 dbSNP
rs1429655165 2071 dbSNP
rs1023935873 2076 dbSNP
rs1016232010 2077 dbSNP
rs532483230 2078 dbSNP
rs1421987490 2085 dbSNP
rs1381490412 2086 dbSNP
rs983026593 2088 dbSNP
rs1484676017 2093 dbSNP
rs1016204867 2109 dbSNP
rs778017881 2114 dbSNP
rs1210120928 2125 dbSNP
rs1263553527 2137 dbSNP
rs1489158024 2139 dbSNP
rs9897737 2141 dbSNP
rs923499889 2143 dbSNP
rs954970975 2146 dbSNP
rs974192386 2149 dbSNP
rs921340918 2150 dbSNP
rs1186078487 2151 dbSNP
rs1173871661 2155 dbSNP
rs187098832 2157 dbSNP
rs913444621 2163 dbSNP
rs1208694071 2170 dbSNP
rs529748734 2187 dbSNP
rs1301795208 2188 dbSNP
rs546201065 2192 dbSNP
rs750367298 2206 dbSNP
rs1317898850 2207 dbSNP
rs191443503 2214 dbSNP
rs532295806 2215 dbSNP
rs1438669849 2216 dbSNP
rs912538084 2224 dbSNP
rs796108225 2230 dbSNP
rs117435480 2231 dbSNP
rs1347254871 2236 dbSNP
rs374947307 2237 dbSNP
rs1041619895 2238 dbSNP
rs546825552 2245 dbSNP
rs903066671 2248 dbSNP
rs935829877 2249 dbSNP
rs896397829 2250 dbSNP
rs1203577871 2257 dbSNP
rs1013495815 2258 dbSNP
rs1054185814 2259 dbSNP
rs1218917437 2260 dbSNP
rs537696018 2263 dbSNP
rs1012646671 2264 dbSNP
rs1413402494 2268 dbSNP
rs35567602 2273 dbSNP
rs145571785 2275 dbSNP
rs1303738051 2279 dbSNP
rs1461821141 2280 dbSNP
rs1006275626 2282 dbSNP
rs1395048532 2287 dbSNP
rs147728180 2290 dbSNP
rs1195144698 2295 dbSNP
rs568471494 2298 dbSNP
rs1015851348 2299 dbSNP
rs1453279704 2304 dbSNP
rs962904546 2312 dbSNP
rs1425427252 2318 dbSNP
rs1176372185 2321 dbSNP
rs1256809262 2321 dbSNP
rs1479518666 2322 dbSNP
rs1234451404 2324 dbSNP
rs964848182 2330 dbSNP
rs974244780 2334 dbSNP
rs1333710109 2336 dbSNP
rs1270666061 2338 dbSNP
rs1234613568 2339 dbSNP
rs996567986 2343 dbSNP
rs1314019693 2351 dbSNP
rs534251453 2352 dbSNP
rs554227895 2355 dbSNP
rs767681103 2356 dbSNP
rs752863133 2357 dbSNP
rs1391926938 2358 dbSNP
rs912580200 2359 dbSNP
rs945396329 2373 dbSNP
rs977778348 2374 dbSNP
rs1407232544 2375 dbSNP
rs1158270129 2376 dbSNP
rs913371423 2379 dbSNP
rs1381862298 2380 dbSNP
rs369799653 2384 dbSNP
rs142534933 2388 dbSNP
rs1467711381 2391 dbSNP
rs1447701331 2392 dbSNP
rs1250783229 2396 dbSNP
rs978973920 2408 dbSNP
rs1488507097 2414 dbSNP
rs935883584 2415 dbSNP
rs1309852413 2423 dbSNP
rs1054236625 2426 dbSNP
rs561684643 2434 dbSNP
rs1311847116 2435 dbSNP
rs1259889584 2437 dbSNP
rs530232702 2438 dbSNP
rs778069318 2441 dbSNP
rs1356792257 2446 dbSNP
rs1388796807 2447 dbSNP
rs1391539994 2448 dbSNP
rs373104676 2450 dbSNP
rs374784256 2452 dbSNP
rs1288367124 2459 dbSNP
rs1393101542 2470 dbSNP
rs1055196540 2471 dbSNP
rs1158980742 2471 dbSNP
rs915717805 2472 dbSNP
rs1393088812 2478 dbSNP
rs1200529736 2480 dbSNP
rs1270944102 2483 dbSNP
rs948504260 2483 dbSNP
rs1260355547 2485 dbSNP
rs917584266 2488 dbSNP
rs1467634780 2489 dbSNP
rs1045466181 2490 dbSNP
rs906902381 2491 dbSNP
rs1218038128 2492 dbSNP
rs1047651019 2494 dbSNP
rs1253255480 2496 dbSNP
rs1235606239 2498 dbSNP
rs1331912666 2504 dbSNP
rs1294884815 2505 dbSNP
rs1417796116 2508 dbSNP
rs1380633340 2513 dbSNP
rs886250536 2513 dbSNP
rs987556277 2514 dbSNP
rs1298703330 2515 dbSNP
rs1434085773 2517 dbSNP
rs754084809 2519 dbSNP
rs1036664496 2520 dbSNP
rs941840045 2524 dbSNP
rs1174115341 2527 dbSNP
rs1295514481 2528 dbSNP
rs898749813 2529 dbSNP
rs1372172636 2531 dbSNP
rs1369358771 2538 dbSNP
rs1190347915 2542 dbSNP
rs1478500312 2550 dbSNP
rs1263334186 2554 dbSNP
rs1037570511 2557 dbSNP
rs1485633322 2563 dbSNP
rs900577192 2566 dbSNP
rs886052728 2575 dbSNP
rs1163051829 2580 dbSNP
rs996316749 2583 dbSNP
rs150281693 2585 dbSNP
rs1333393086 2588 dbSNP
rs1028506326 2592 dbSNP
rs548356953 2593 dbSNP
rs1353501409 2599 dbSNP
rs182473004 2601 dbSNP
rs570116568 2604 dbSNP
rs1395559089 2605 dbSNP
rs746353611 2609 dbSNP
rs1019690221 2612 dbSNP
rs1340829227 2613 dbSNP
rs1234978675 2614 dbSNP
rs1291020683 2615 dbSNP
rs967164461 2617 dbSNP
rs1236264890 2618 dbSNP
rs1190266998 2620 dbSNP
rs1443327028 2624 dbSNP
rs562271293 2626 dbSNP
rs1196976400 2628 dbSNP
rs1320280047 2631 dbSNP
rs1258731729 2636 dbSNP
rs369373895 2637 dbSNP
rs925264649 2638 dbSNP
rs752337380 2643 dbSNP
rs1198903151 2649 dbSNP
rs957298831 2650 dbSNP
rs1285849714 2651 dbSNP
rs1245492877 2653 dbSNP
rs1334936211 2655 dbSNP
rs969024363 2657 dbSNP
rs574465886 2661 dbSNP
rs772610973 2666 dbSNP
rs979330025 2672 dbSNP
rs1400601773 2678 dbSNP
rs1324587845 2680 dbSNP
rs1459385203 2684 dbSNP
rs1415389210 2686 dbSNP
rs1479381971 2692 dbSNP
rs1165491230 2705 dbSNP
rs1063474 2706 dbSNP
rs1195724370 2708 dbSNP
rs915768718 2714 dbSNP
rs1034561734 2718 dbSNP
rs1459222719 2718 dbSNP
rs147133263 2718 dbSNP
rs377084429 2718 dbSNP
rs779502921 2720 dbSNP
rs1239054467 2724 dbSNP
rs372786823 2734 dbSNP
rs539912998 2743 dbSNP
rs1186315017 2745 dbSNP
rs1449916010 2748 dbSNP
rs1292191977 2755 dbSNP
rs1417624459 2756 dbSNP
rs1228816182 2757 dbSNP
rs559794308 2761 dbSNP
rs1478248295 2762 dbSNP
rs1306744328 2763 dbSNP
rs1242090089 2767 dbSNP
rs879334508 2769 dbSNP
rs867325036 2774 dbSNP
rs1433917129 2777 dbSNP
rs928411530 2780 dbSNP
rs532014925 2781 dbSNP
rs1406403826 2788 dbSNP
rs750252646 2793 dbSNP
rs866336026 2795 dbSNP
rs551747518 2796 dbSNP
rs939725527 2797 dbSNP
rs376277328 2800 dbSNP
rs562642180 2806 dbSNP
rs1477202468 2812 dbSNP
rs1248464235 2813 dbSNP
rs1340922081 2814 dbSNP
rs983103791 2815 dbSNP
rs1283758090 2818 dbSNP
rs1036714963 2832 dbSNP
rs555460880 2834 dbSNP
rs995785677 2835 dbSNP
rs186069162 2836 dbSNP
rs1429456729 2837 dbSNP
rs746992465 2838 dbSNP
rs1175805053 2842 dbSNP
rs770807787 2842 dbSNP
rs932026127 2843 dbSNP
rs1008405699 2845 dbSNP
rs1051864367 2851 dbSNP
rs1305255956 2853 dbSNP
rs1020162754 2855 dbSNP
rs776346735 2858 dbSNP
rs1195743080 2859 dbSNP
rs189743843 2861 dbSNP
rs1279264724 2862 dbSNP
rs145845266 2863 dbSNP
rs1313548933 2873 dbSNP
rs761688333 2877 dbSNP
rs769615647 2883 dbSNP
rs1213681737 2884 dbSNP
rs766458542 2884 dbSNP
rs904768345 2886 dbSNP
rs1402328809 2888 dbSNP
rs1341695503 2889 dbSNP
rs958014146 2891 dbSNP
rs182338521 2892 dbSNP
rs1488829162 2895 dbSNP
rs915821565 2898 dbSNP
rs958915302 2901 dbSNP
rs570946872 2902 dbSNP
rs1172921287 2906 dbSNP
rs990506275 2922 dbSNP
rs578108539 2923 dbSNP
rs981299538 2924 dbSNP
rs928432475 2925 dbSNP
rs1171684675 2927 dbSNP
rs1203370983 2933 dbSNP
rs1456175286 2939 dbSNP
rs1218741979 2941 dbSNP
rs1259368481 2941 dbSNP
rs1374615138 2942 dbSNP
rs766450313 2943 dbSNP
rs1312602884 2944 dbSNP
rs186646353 2946 dbSNP
rs1359496624 2952 dbSNP
rs1303791843 2958 dbSNP
rs907573626 2958 dbSNP
rs752775300 2961 dbSNP
rs1301311248 2966 dbSNP
rs1333405555 2969 dbSNP
rs930959799 2970 dbSNP
rs973353491 2974 dbSNP
rs148930389 2975 dbSNP
rs1425555610 2976 dbSNP
rs1414168690 2977 dbSNP
rs890049436 2980 dbSNP
rs944265434 2984 dbSNP
rs1232670055 2986 dbSNP
rs760840898 2987 dbSNP
rs545687734 2990 dbSNP
rs999590269 2991 dbSNP
rs1313815581 2992 dbSNP
rs1239912917 2993 dbSNP
rs555707011 2994 dbSNP
rs572333333 2995 dbSNP
rs1012209911 3002 dbSNP
rs1259160593 3004 dbSNP
rs1024017470 3007 dbSNP
rs1485636079 3008 dbSNP
rs377508006 3018 dbSNP
rs1254893127 3019 dbSNP
rs1390108965 3023 dbSNP
rs981735253 3026 dbSNP
rs1041699253 3027 dbSNP
rs1035555272 3033 dbSNP
rs1259156378 3034 dbSNP
rs961180378 3037 dbSNP
rs886052729 3039 dbSNP
rs754076158 3041 dbSNP
rs541212005 3042 dbSNP
rs537073332 3044 dbSNP
rs1264580840 3047 dbSNP
rs1192446836 3048 dbSNP
rs1489729519 3049 dbSNP
rs1293103708 3053 dbSNP
rs919684866 3055 dbSNP
rs1351949309 3062 dbSNP
rs931012802 3063 dbSNP
rs143642047 3064 dbSNP
rs1024462462 3065 dbSNP
rs970449219 3067 dbSNP
rs910851820 3068 dbSNP
rs1438164593 3070 dbSNP
rs1014972357 3072 dbSNP
rs545489859 3073 dbSNP
rs1362148236 3075 dbSNP
rs557648415 3076 dbSNP
rs1465186806 3084 dbSNP
rs973707560 3093 dbSNP
rs750814783 3097 dbSNP
rs1041675340 3098 dbSNP
rs1433243451 3100 dbSNP
rs902720494 3106 dbSNP
rs935495368 3110 dbSNP
rs1305254954 3111 dbSNP
rs1316698296 3119 dbSNP
rs1265722632 3138 dbSNP
rs1206114899 3139 dbSNP
rs1344534591 3145 dbSNP
rs751107418 3148 dbSNP
rs1254459598 3151 dbSNP
rs1053847408 3152 dbSNP
rs1222505929 3152 dbSNP
rs1312841238 3153 dbSNP
rs893895527 3163 dbSNP
rs780766571 3169 dbSNP
rs758850653 3177 dbSNP
rs1467172680 3179 dbSNP
rs562470735 3180 dbSNP
rs370805314 3181 dbSNP
rs1023647948 3183 dbSNP
rs946078949 3184 dbSNP
rs544598735 3186 dbSNP
rs78230530 3188 dbSNP
rs1002814120 3189 dbSNP
rs1466296520 3191 dbSNP
rs1418344025 3192 dbSNP
rs925922501 3193 dbSNP
rs1167934828 3195 dbSNP
rs1165190072 3202 dbSNP
rs1036011918 3204 dbSNP
rs961251210 3207 dbSNP
rs1426449558 3212 dbSNP
rs972565301 3215 dbSNP
rs1442191560 3219 dbSNP
rs531799823 3219 dbSNP
rs1324576336 3225 dbSNP
rs1056227934 3235 dbSNP
rs1461950469 3243 dbSNP
rs1257446009 3244 dbSNP
rs894719737 3252 dbSNP
rs1026797970 3257 dbSNP
rs1278305004 3267 dbSNP
rs952455624 3267 dbSNP
rs561815911 3270 dbSNP
rs1338482338 3276 dbSNP
rs1335943524 3289 dbSNP
rs1396192962 3290 dbSNP
rs530042966 3294 dbSNP
rs75472729 3295 dbSNP
rs1295328852 3296 dbSNP
rs1168990921 3297 dbSNP
rs1332894905 3298 dbSNP
rs1232934062 3301 dbSNP
rs1190074620 3303 dbSNP
rs1258719927 3306 dbSNP
rs746768894 3307 dbSNP
rs1237766405 3319 dbSNP
rs527521914 3320 dbSNP
rs1273886969 3321 dbSNP
rs1231169902 3326 dbSNP
rs886052730 3326 dbSNP
rs1480168512 3332 dbSNP
rs1354182409 3333 dbSNP
rs1014697447 3334 dbSNP
rs1246485837 3335 dbSNP
rs1188451372 3344 dbSNP
rs1419787260 3353 dbSNP
rs963483764 3353 dbSNP
rs977066933 3353 dbSNP
rs1448617667 3355 dbSNP
rs1354546367 3358 dbSNP
rs994504257 3364 dbSNP
rs1405234972 3369 dbSNP
rs924202298 3370 dbSNP
rs1290164604 3371 dbSNP
rs1389244871 3371 dbSNP
rs148118466 3372 dbSNP
rs1380135302 3373 dbSNP
rs1419530698 3377 dbSNP
rs1441784250 3382 dbSNP
rs1233472155 3390 dbSNP
rs1411207995 3393 dbSNP
rs1449759826 3400 dbSNP
rs935544696 3402 dbSNP
rs373040640 3403 dbSNP
rs1803913 3415 dbSNP
rs1223202809 3416 dbSNP
rs915380947 3419 dbSNP
rs1352701899 3425 dbSNP
rs1283623051 3426 dbSNP
rs377513470 3431 dbSNP
rs1373630738 3434 dbSNP
rs987391516 3435 dbSNP
rs911698189 3437 dbSNP
rs1332366655 3438 dbSNP
rs886052731 3439 dbSNP
rs191536229 3443 dbSNP
rs1360217009 3444 dbSNP
rs1157245535 3447 dbSNP
rs560850770 3448 dbSNP
rs1003944153 3450 dbSNP
rs1409033590 3450 dbSNP
rs12452806 3451 dbSNP
rs936117783 3453 dbSNP
rs991503739 3455 dbSNP
rs1199973606 3460 dbSNP
rs1487928058 3461 dbSNP
rs915915878 3469 dbSNP
rs1036328255 3470 dbSNP
rs897094516 3477 dbSNP
rs12452821 3479 dbSNP
rs994059623 3482 dbSNP
rs1277451464 3483 dbSNP
rs1026851049 3496 dbSNP
rs533425824 3498 dbSNP
rs1212922481 3504 dbSNP
rs1406029306 3507 dbSNP
rs780627320 3508 dbSNP
rs1340474900 3510 dbSNP
rs1296695883 3513 dbSNP
rs1270769358 3514 dbSNP
rs1306798708 3520 dbSNP
rs886052732 3529 dbSNP
rs1211546356 3530 dbSNP
rs1413050821 3534 dbSNP
rs1431463923 3545 dbSNP
rs549925851 3547 dbSNP
rs1477429514 3549 dbSNP
rs1484574037 3550 dbSNP
rs952506005 3555 dbSNP
rs1006680355 3556 dbSNP
rs1186762144 3564 dbSNP
rs886052733 3571 dbSNP
rs1207507253 3572 dbSNP
rs1476097568 3573 dbSNP
rs142890796 3577 dbSNP
rs1263164219 3579 dbSNP
rs886052734 3585 dbSNP
rs1315575509 3593 dbSNP
rs1216891226 3596 dbSNP
rs1276836223 3596 dbSNP
rs773103119 3597 dbSNP
rs115139242 3603 dbSNP
rs552147371 3606 dbSNP
rs1446024712 3618 dbSNP
rs1408610024 3622 dbSNP
rs752225674 3622 dbSNP
rs1337680299 3623 dbSNP
rs1435812771 3624 dbSNP
rs200233090 3626 dbSNP
rs1028622989 3627 dbSNP
rs1491013162 3627 dbSNP
rs58458769 3627 dbSNP
rs79686064 3628 dbSNP
rs1374014962 3631 dbSNP
rs886052735 3632 dbSNP
rs1179923633 3635 dbSNP
rs976826827 3635 dbSNP
rs1243343220 3637 dbSNP
rs923584453 3645 dbSNP
rs556060748 3646 dbSNP
rs989676095 3652 dbSNP
rs1259507980 3658 dbSNP
rs915431613 3659 dbSNP
rs566024996 3672 dbSNP
rs1045185031 3674 dbSNP
rs928043759 3678 dbSNP
rs1308618392 3681 dbSNP
rs1312402641 3682 dbSNP
rs770925320 3683 dbSNP
rs1226930171 3684 dbSNP
rs1385498371 3685 dbSNP
rs773741546 3688 dbSNP
rs1269629677 3693 dbSNP
rs570821627 3695 dbSNP
rs1036379497 3696 dbSNP
rs1349258477 3702 dbSNP
rs1234854658 3712 dbSNP
rs774426007 3712 dbSNP
rs1162645453 3719 dbSNP
rs761048889 3724 dbSNP
rs759603660 3726 dbSNP
rs1426296499 3727 dbSNP
rs8797 3727 dbSNP
rs1282454336 3728 dbSNP
rs1345460848 3733 dbSNP
rs957438141 3734 dbSNP
rs539947611 3737 dbSNP
rs1437442755 3739 dbSNP
rs145041515 3740 dbSNP
rs915884949 3740 dbSNP
rs1487894134 3741 dbSNP
rs1265346775 3745 dbSNP
rs766808424 3745 dbSNP
rs1220079240 3753 dbSNP
rs1292963909 3764 dbSNP
rs1362034883 3764 dbSNP
rs1284723544 3771 dbSNP
rs576544802 3772 dbSNP
rs1190586771 3773 dbSNP
rs950075200 3775 dbSNP
rs981434299 3776 dbSNP
rs1392006912 3780 dbSNP
rs1240955626 3784 dbSNP
rs1367058982 3788 dbSNP
rs1365216463 3790 dbSNP
rs1406772482 3792 dbSNP
rs1365894516 3796 dbSNP
rs1157844220 3797 dbSNP
rs1454379787 3798 dbSNP
rs1048340096 3803 dbSNP
rs1365148612 3806 dbSNP
rs940303366 3807 dbSNP
rs1393849780 3812 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.39 1.3e-4 0.320 1.6e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.68 4.9e-4 0.783 2.2e-5 20 Click to see details
GSE38226 Liver fibrosis -0.516 8.3e-3 -0.414 3.1e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.594 1.6e-2 -0.544 2.7e-2 13 Click to see details
GSE14794 Lymphoblastoid cells 0.172 5.3e-2 0.179 4.6e-2 90 Click to see details
GSE17306 Multiple myeloma 0.145 1.6e-1 0.071 3.1e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.255 1.7e-1 0.276 1.5e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.268 2.0e-1 0.245 2.2e-1 12 Click to see details
GSE21849 B cell lymphoma 0.154 2.1e-1 0.378 2.2e-2 29 Click to see details
GSE17498 Multiple myeloma 0.128 2.2e-1 0.164 1.6e-1 40 Click to see details
GSE21687 Ependynoma primary tumors 0.078 2.7e-1 0.161 1.0e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.123 2.8e-1 -0.094 3.3e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.135 2.9e-1 -0.183 2.2e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.096 3.2e-1 0.228 1.4e-1 25 Click to see details
GSE28544 Breast cancer 0.08 3.6e-1 0.504 6.0e-3 24 Click to see details
GSE19783 ER- ER- breast cancer 0.04 3.6e-1 0.077 2.5e-1 79 Click to see details
GSE19536 Breast cancer -0.027 3.9e-1 0.005 4.8e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells 0.047 4.1e-1 -0.018 4.7e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.025 4.5e-1 0.102 2.9e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.025 4.5e-1 0.062 3.9e-1 23 Click to see details
GSE42095 Differentiated embryonic stem cells 0.025 4.5e-1 0.062 3.9e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.347 0 -0.414 0 59 Click to see details
KIRP -0.464 0 -0.526 0 32 Click to see details
BRCA 0.213 0.03 0.187 0.04 84 Click to see details
CESC -0.988 0.05 -1.000 0.5 3 Click to see details
STAD -0.285 0.06 -0.208 0.13 32 Click to see details
PRAD -0.199 0.08 -0.178 0.11 50 Click to see details
UCEC 0.258 0.14 0.314 0.1 19 Click to see details
LUSC -0.17 0.15 -0.099 0.28 38 Click to see details
HNSC 0.147 0.18 0.117 0.23 42 Click to see details
KICH -0.193 0.18 -0.041 0.42 25 Click to see details
BLCA -0.209 0.2 -0.038 0.44 18 Click to see details
PAAD -0.566 0.22 -0.800 0.1 4 Click to see details
COAD 0.197 0.32 -0.167 0.35 8 Click to see details
ESCA -0.14 0.34 -0.118 0.36 11 Click to see details
CHOL -0.113 0.39 -0.183 0.32 9 Click to see details
LIHC -0.027 0.43 0.006 0.48 49 Click to see details
KIRC 0.006 0.48 0.066 0.3 68 Click to see details
PCPG -0.019 0.49 0.500 0.33 3 Click to see details
LUAD -0.001 0.5 -0.098 0.38 12 Click to see details
LUAD -0.001 0.5 -0.098 0.38 12 Click to see details
LUAD -0.001 0.5 -0.098 0.38 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4