miRTarBase - #MIRT191625 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC39A9   
Synonyms ZIP-9, ZIP9
Description solute carrier family 39 member 9
Transcript NM_018375   
Expression
Putative miRNA Targets on SLC39A9
3'UTR of SLC39A9
(miRNA target sites are highlighted)
>SLC39A9|NM_018375|3'UTR
   1 ATGTTCAAGGTCCAGCCTTGGTCCAGGGCCGTTTGCCATCCAGTGAGAACAGCCGGCACGTGACAGCTACTCACTTCCTC
  81 AGTCTCTTGTCTCACCTTGCGCATCTCTACATGTATTCCTAGAGTCCAGAGGGGAGGTGAGGTTAAAACCTGAGTAATGG
 161 AAAAGCTTTTAGAGTAGAAACACATTTACGTTGCAGTTAGCTATAGACATCCCATTGTGTTATCTTTTAAAAGGCCCTTG
 241 ACATTTTGCGTTTTAATATTTCTCTTAACCCTATTCTCAGGGAAGATGGAATTTAGTTTTAAGGAAAAGAGGAGAACTTC
 321 ATACTCACAATGAAATAGTGATTATGAAAATACAGTGTTCTGTAATTAAGCTATGTCTCTTTCTTCTTAGTTTAGAGGCT
 401 CTGCTACTTTATCCATTGATTTTTAACATGGTTCCCACCATGTAAGACTGGTGCTTTAGCATCTATGCCACATGCGTTGA
 481 TGGAAGGTCATAGCACCCACTCACTTAGATGCTAAAGGTGATTCTAGTTAATCTGGGATTAGGGTCAGGAAAATGATAGC
 561 AAGACACATTGAAAGCTCTCTTTATACTCAAAAGAGATATCCATTGAAAAGGGATGTCTAGAGGGATTTAAACAGCTCCT
 641 TTGGCACGTGCCTCTCTGAATCCAGCCTGCCATTCCATCAAATGGAGCAGGAGAGGTGGGAGGAGCTTCTAAAGAGGTGA
 721 CTGGTATTTTGTAGCATTCCTTGTCAAGTTCTCCTTTGCAGAATACCTGTCTCCACATTCCTAGAGAGGAGCCAAGTTCT
 801 AGTAGTTTCAGTTCTAGGCTTTCCTTCAAGAACAGTCAGATCACAAAGTGTCTTTGGAAATTAAGGGATATTAAATTTTA
 881 AGTGATTTTTGGATGGTTATTGATATCTTTGTAGTAGCTTTTTTTAAAAGACTACCAAAATGTATGGTTGTCCTTTTTTT
 961 TTGTTTTTTTTTTTTTTAATTATTTCTCTTAGCAGATCAGCAATCCCTCTAGGGACCTAAATACTAGGTCAGCTTTGGCG
1041 ACACTGTGTCTTCTCACATAACCACCTGTAGCAAGATGGATCATAAATGAGAAGTGTTTGCCTATTGATTTAAAGCTTAT
1121 TGGAATCATGTCTCTTGTCTCTTCGTCTTTTCTTTGCTTTTCTTCTAACTTTTCCCTCTAGCCTCTCCTCGCCACAATTT
1201 GCTGCTTACTGCTGGTGTTAATATTTGTGTGGGATGAATTCTTATCAGGACAACCACTTCTCGAACTGTAATAATGAAGA
1281 TAATAATATCTTTATTCTTTATCCCCCTTCAAAGAAATTACCTTTGTGTCAAATGCCGCTTTGTTGAGCCCTTAAAATAC
1361 CACCTCCTCATGTGTAAATTGACACAATCACTAATCTGGTAATTTAAACAATTGAGATAGCAAAAGTGTTTAACAGACTA
1441 GGATAATTTTTTTTTCATATTTGCCAAAATTTTTGTAAACCCTGTCTTGTCAAATAAGTGTATAATATTGTATTATTAAT
1521 TTATTTTTACTTTCTATACCATTTCAAAACACATTACACTAAGGGGGAACCAAGACTAGTTTCTTCAGGGCAGTGGACGT
1601 AGTAGTTTGTAAAAACGTTTTCTATGACGCATAAGCTAGCATGCCTATGATTTATTTCCTTCATGAATTTGTCACTGGAT
1681 CAGCAGCTGTGGAAATAAAGCTTGTGAGCCCTCTGCTGGCCACAGTGAGGAAAGTAGCACAAATAGGATACAGTTGTATG
1761 TAGTCATTGGCAACAATTGCATACAATTTTACTACCAAGAGAAGGTATAGTATGGAAAGTCCAAATGACTTCCTTGATTG
1841 GATGTTAACAGCTGACTGGTGTGAGACTTGAGGTTTCATCTAGTCCTTCAAAACTATATGGTTGCCTAGATTCTCTCTGG
1921 AAACTGACTTTGTCAAATAAATAGCAGATTGTAGTGTCTGGTTTGGTTTGGACAGTAGTGCTTTCTATCATATTGTTGTG
2001 TGCAATGGTAATTTGTTCTACTGGCCAAAGCCTCTTTCAGCAGTGCCTTGCCATCATGCTTAAAAGTTTGGCTAGTATAT
2081 CTTGCTGGATGGAGCCTTGAACTCCGGCAAGGATTGAACCATCTGACTTCCAAATTTGCCTTCCCCTCTGGACCTCACTA
2161 TTAACAAGCAAACCTTTCAGGGCCCTCTTAGCTCTCAGAAGCTATGTATGGGCTTTCCCAGATTTTAAAGCTGCTGCCTC
2241 GAGAACTACTCATTTCTCTCCTGGTCAGCAGACAGAAATAGCCATACTAATCTCATAGGGCTCAAATGCATCTTCAGGCA
2321 GCAGGGAACCAAGCAGCGTGGCACAGGCCTTCTTGACTGGAGGAAGAGCTTGCTGGCATGGTGGGCAGTATTCCAGGAGA
2401 GGCCATGTCCGTGTTCACTTCTTGGCACATTTCAGTTCCGTTTTCCTCTTGTTTAAAACTGCCTCTTTAGATGTGGATGC
2481 CTTAATGCTGTAACACATTTGAAAACATTGGCAATACTTAAGTTGCTGCCATGATTACAGATGGAATTATTGGCTACCAA
2561 AGAGACGCAATTGATGATGAGAAGCATGATTCTTGCTTCCATATAACCAAAGTTAATCTTAATTGCAATTTGACTCCGTT
2641 TCCTTGGTAGGGATAGACTTTCTTCAGATTCCAAGTGCTCTCTTAAATGGCAAATTAAGTTAAAGAATACTACTGCTCCA
2721 TTCCCCTCACTTATTCTCCAGTTAATTGCTTGTCAGTTCCATTTCAAGAAAGCAGTGATGTTCCAGGTTTGATTCAGTTT
2801 TCCTGTGCACACTATTGCCAAATTTTTTTTTAGCAAAGATTCTGCACTGGAACGTAGACAGTTGGAAACAGTACTACCTA
2881 CCTAGAGGTTATGTGTTTTCTCTTTCTCCCCGCTTTCACCTCTTTCTTTCCCAATTCAAAACAGCCAAGTGAGCCCTGTT
2961 CTGGTATTTTGAATCATTAGAGAAAAGAAAGGGAGTGGCTGTTTTGAGTTGTCCTTTCTTTGCAGAAAGGAGAAAATGTG
3041 ATTGTGTTTTTTTTTTACCAGCCTACTTCTAAGTGTCACTGCCTGGTTTTTCTCTTTTTCAAGGATTAGAACTAAGAGGA
3121 CACACCAGCATCGGAGTGTATTAAGCCCCTGAAACACATGGTAGCTAGGGACTGAACACAGGAACCGTATGACAGCAGCA
3201 CAAACCCCCAAAGGATGTTCCTGCCTTGTGGGCCCCTGAGCCCCTTGGGAGACTGAGAATCATGACCAGATTCATCCAGA
3281 ACTGCTGCAGTGTTAAGTGAAAATCCTCTGTAGTTGTTCTGCAGAGGAACCTTCCTTCCATTAGAAAATTTCTGCTCAAT
3361 ACAGAATGGTCCACATCACCCAAAGTGCACTGTTGGAGATGCTGTGAAATTAAAACCTCTTTGTACCTGAGACATCTAGA
3441 TTCACCTCAGGAGGCCTGAAGGAAATGTGTAACTTGTGGGAAAGAACTAGACAACCATTTAGGAATTCTCTAGATATACT
3521 CAGCCTAACCCAGTGGCTTAACACAAGGAGATTGGCTTTGATCTTTTTTTCTTGTGGCATCTTCCAGCAAGTTAGAAGTC
3601 TCATGGGATAAGACTGCAGTTCCCCTGGTTCAATAGCTGGAACAGTGATTTTAAATGTCCCTTTTTCTGGATCCCTTGTA
3681 AACATGAAATCATTCCATGGATGGCTGCCTTATAATTTTGTCTCTTTCCACTTTAATTGTGAATGGTTAAAAAAATGCTG
3761 TTTTCTGATATTAAATTTTTATTAGTGCATACCTTAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               :|||  || ||||||| 
Target 5' tcctcGCCACAATTTGCTGCTt 3'
1186 - 1207 157.00 -12.70
2
miRNA  3' guGUUUGGUAAUAC-ACGACGau 5'
            ||:|:: | | | ||||||  
Target 5' ccCAGATTTTAAAGCTGCTGCct 3'
2217 - 2239 136.00 -11.40
3
miRNA  3' guGUU-UGGUAAUAC-ACGACGau 5'
            ||| ||  ||| | ||||||  
Target 5' ggCAATAC--TTAAGTTGCTGCca 3'
2510 - 2531 136.00 -9.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31526317 55 COSMIC
COSN31537942 102 COSMIC
COSN1170520 103 COSMIC
COSN30140601 139 COSMIC
COSN31553676 190 COSMIC
COSN31571426 330 COSMIC
COSN31607894 532 COSMIC
COSN31532359 590 COSMIC
COSN27319662 655 COSMIC
COSN7025123 963 COSMIC
COSN20111426 978 COSMIC
COSN6257457 1146 COSMIC
COSN20092853 1244 COSMIC
COSN6638369 1245 COSMIC
COSN29614129 1456 COSMIC
COSN31562889 1456 COSMIC
COSN27330334 1625 COSMIC
COSN19656940 1650 COSMIC
COSN31535940 1736 COSMIC
COSN17182157 1757 COSMIC
COSN19596037 2529 COSMIC
COSN28881289 2832 COSMIC
COSN31484706 3057 COSMIC
COSN30666723 3151 COSMIC
COSN31555508 3233 COSMIC
COSN8848751 3458 COSMIC
rs8007933 749 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1203536386 9 dbSNP
rs1035430823 11 dbSNP
rs752519831 22 dbSNP
rs111365600 24 dbSNP
rs1384332544 25 dbSNP
rs1421853343 28 dbSNP
rs1217445915 29 dbSNP
rs763937757 31 dbSNP
rs371562341 32 dbSNP
rs1452416736 37 dbSNP
rs1317890740 51 dbSNP
rs1390212427 52 dbSNP
rs770250963 55 dbSNP
rs938515280 56 dbSNP
rs2232062 60 dbSNP
rs896593027 61 dbSNP
rs112304069 67 dbSNP
rs1375528439 68 dbSNP
rs1350416645 72 dbSNP
rs1398946786 79 dbSNP
rs1275939669 84 dbSNP
rs1408071222 87 dbSNP
rs549247581 90 dbSNP
rs985688162 101 dbSNP
rs879651432 102 dbSNP
rs1426723495 106 dbSNP
rs965562442 110 dbSNP
rs1200986391 111 dbSNP
rs567479245 112 dbSNP
rs1001556455 113 dbSNP
rs182499903 119 dbSNP
rs1219585892 121 dbSNP
rs768295191 123 dbSNP
rs1281544980 126 dbSNP
rs997656490 128 dbSNP
rs1281051453 129 dbSNP
rs1053722183 139 dbSNP
rs1368396084 155 dbSNP
rs1030427312 160 dbSNP
rs1439908214 174 dbSNP
rs1402246111 177 dbSNP
rs915213517 181 dbSNP
rs188400979 187 dbSNP
rs1004549741 190 dbSNP
rs571278836 191 dbSNP
rs1265666270 199 dbSNP
rs1044298994 201 dbSNP
rs116745315 204 dbSNP
rs1191038720 208 dbSNP
rs1406578482 209 dbSNP
rs1423679595 223 dbSNP
rs1177174811 228 dbSNP
rs140550640 229 dbSNP
rs1240513931 230 dbSNP
rs1199673443 235 dbSNP
rs1461101201 237 dbSNP
rs980456839 246 dbSNP
rs1057322014 250 dbSNP
rs867864184 251 dbSNP
rs1283614617 257 dbSNP
rs960207285 259 dbSNP
rs1379053613 265 dbSNP
rs993891162 266 dbSNP
rs1309817300 271 dbSNP
rs1395113675 281 dbSNP
rs1451732527 287 dbSNP
rs1380290015 288 dbSNP
rs1304276018 297 dbSNP
rs1466202730 304 dbSNP
rs1344195815 305 dbSNP
rs992675035 313 dbSNP
rs913037915 317 dbSNP
rs114314463 322 dbSNP
rs1444474985 323 dbSNP
rs952341191 324 dbSNP
rs1241664501 329 dbSNP
rs1007582280 330 dbSNP
rs1183860781 331 dbSNP
rs147099348 339 dbSNP
rs1018520928 350 dbSNP
rs1042485876 357 dbSNP
rs759854052 358 dbSNP
rs965969828 363 dbSNP
rs773876743 374 dbSNP
rs555221754 376 dbSNP
rs1365238531 387 dbSNP
rs900766362 395 dbSNP
rs1314646307 400 dbSNP
rs1396343078 401 dbSNP
rs997689092 405 dbSNP
rs976950618 407 dbSNP
rs1401385132 413 dbSNP
rs1031552746 415 dbSNP
rs1004623610 439 dbSNP
rs1424552625 440 dbSNP
rs1167380704 441 dbSNP
rs956800567 441 dbSNP
rs989499829 444 dbSNP
rs915262897 455 dbSNP
rs963400252 456 dbSNP
rs1001227835 466 dbSNP
rs1034403794 470 dbSNP
rs1221789494 473 dbSNP
rs1317818820 474 dbSNP
rs529824321 476 dbSNP
rs573479750 477 dbSNP
rs112024835 481 dbSNP
rs1306697591 492 dbSNP
rs1293075224 500 dbSNP
rs879381678 503 dbSNP
rs1220068008 505 dbSNP
rs1245290616 511 dbSNP
rs1302023754 515 dbSNP
rs992707505 532 dbSNP
rs192861238 544 dbSNP
rs913111302 556 dbSNP
rs967189566 558 dbSNP
rs746845755 562 dbSNP
rs927228481 562 dbSNP
rs938564846 563 dbSNP
rs1056980175 564 dbSNP
rs565341429 565 dbSNP
rs1168850629 581 dbSNP
rs770743648 581 dbSNP
rs1478942421 586 dbSNP
rs896968436 588 dbSNP
rs1156371755 590 dbSNP
rs138532035 601 dbSNP
rs1198803787 607 dbSNP
rs936720254 612 dbSNP
rs1048161948 621 dbSNP
rs1210343695 622 dbSNP
rs375158766 629 dbSNP
rs1039041344 632 dbSNP
rs1200263295 633 dbSNP
rs1318184280 637 dbSNP
rs1282183718 638 dbSNP
rs921887654 639 dbSNP
rs60626412 644 dbSNP
rs1304113230 645 dbSNP
rs766989250 647 dbSNP
rs1396354082 648 dbSNP
rs879168491 649 dbSNP
rs1018320281 651 dbSNP
rs1467455185 653 dbSNP
rs562680398 655 dbSNP
rs1175966346 656 dbSNP
rs1477112768 666 dbSNP
rs1379427044 667 dbSNP
rs1199547161 669 dbSNP
rs1418466237 672 dbSNP
rs1236239610 673 dbSNP
rs530018193 682 dbSNP
rs1288034790 688 dbSNP
rs1457995066 688 dbSNP
rs1262192315 699 dbSNP
rs548317095 700 dbSNP
rs760569759 708 dbSNP
rs1031145828 712 dbSNP
rs1356698305 715 dbSNP
rs1038253726 716 dbSNP
rs1256108058 727 dbSNP
rs898930309 727 dbSNP
rs1335699614 735 dbSNP
rs1307622332 744 dbSNP
rs548383645 746 dbSNP
rs8007933 749 dbSNP
rs989553343 752 dbSNP
rs1022327650 769 dbSNP
rs969832412 770 dbSNP
rs980798280 772 dbSNP
rs528383263 780 dbSNP
rs1227719421 783 dbSNP
rs927927592 785 dbSNP
rs1404571220 806 dbSNP
rs1257969849 829 dbSNP
rs895483765 833 dbSNP
rs938631356 843 dbSNP
rs1173259808 845 dbSNP
rs1184616259 846 dbSNP
rs993135630 847 dbSNP
rs918452409 849 dbSNP
rs1180428708 857 dbSNP
rs1440146458 861 dbSNP
rs377635633 868 dbSNP
rs753574977 873 dbSNP
rs1185093212 879 dbSNP
rs1443807305 885 dbSNP
rs1256350441 894 dbSNP
rs1204037445 902 dbSNP
rs1234062473 904 dbSNP
rs1048214032 912 dbSNP
rs888201959 913 dbSNP
rs1180889468 919 dbSNP
rs1284571326 921 dbSNP
rs1411244610 926 dbSNP
rs942411374 927 dbSNP
rs1039382542 930 dbSNP
rs1354923144 933 dbSNP
rs1446215610 941 dbSNP
rs900809437 943 dbSNP
rs998469135 947 dbSNP
rs1031199874 948 dbSNP
rs1160437027 952 dbSNP
rs1420263319 953 dbSNP
rs1161255922 954 dbSNP
rs35993638 954 dbSNP
rs1399280249 960 dbSNP
rs892669121 961 dbSNP
rs1368747701 962 dbSNP
rs1463948160 963 dbSNP
rs1289723461 964 dbSNP
rs61361699 964 dbSNP
rs71446391 964 dbSNP
rs74862400 964 dbSNP
rs796585601 964 dbSNP
rs879090127 964 dbSNP
rs78777045 965 dbSNP
rs1022379723 966 dbSNP
rs1447446124 967 dbSNP
rs879026780 968 dbSNP
rs1338656550 969 dbSNP
rs1002676962 970 dbSNP
rs1035052110 971 dbSNP
rs1364890512 972 dbSNP
rs1033225077 973 dbSNP
rs1391151447 978 dbSNP
rs558716919 978 dbSNP
rs1234131285 979 dbSNP
rs200849329 980 dbSNP
rs1277895457 983 dbSNP
rs183564839 987 dbSNP
rs1198028123 989 dbSNP
rs571461082 990 dbSNP
rs958149659 991 dbSNP
rs1437882224 992 dbSNP
rs1193774196 995 dbSNP
rs1208887038 999 dbSNP
rs751787692 1004 dbSNP
rs1475946363 1012 dbSNP
rs1246706721 1018 dbSNP
rs1188234582 1027 dbSNP
rs921988887 1029 dbSNP
rs1453737494 1036 dbSNP
rs1290997489 1043 dbSNP
rs1422595758 1044 dbSNP
rs1476737499 1045 dbSNP
rs1198352300 1054 dbSNP
rs1316311647 1055 dbSNP
rs933311043 1065 dbSNP
rs188448815 1078 dbSNP
rs908153603 1080 dbSNP
rs992781187 1081 dbSNP
rs1413969537 1084 dbSNP
rs1350354429 1094 dbSNP
rs550680945 1097 dbSNP
rs1037882737 1102 dbSNP
rs899291389 1110 dbSNP
rs796143915 1121 dbSNP
rs78786480 1125 dbSNP
rs1422421577 1127 dbSNP
rs1190023136 1133 dbSNP
rs1479302241 1142 dbSNP
rs1247741154 1145 dbSNP
rs983964190 1146 dbSNP
rs909687055 1151 dbSNP
rs1055622 1152 dbSNP
rs942482006 1161 dbSNP
rs1297851342 1162 dbSNP
rs1338857710 1166 dbSNP
rs556341364 1171 dbSNP
rs1311716339 1178 dbSNP
rs1055623 1188 dbSNP
rs1039840157 1191 dbSNP
rs922318467 1192 dbSNP
rs569098976 1194 dbSNP
rs1368235979 1210 dbSNP
rs1345008525 1222 dbSNP
rs1308363740 1228 dbSNP
rs1217982720 1241 dbSNP
rs1052674600 1244 dbSNP
rs554279444 1261 dbSNP
rs757338069 1263 dbSNP
rs534347061 1264 dbSNP
rs1357033187 1265 dbSNP
rs192390993 1273 dbSNP
rs534223125 1279 dbSNP
rs1195140027 1291 dbSNP
rs1043891742 1293 dbSNP
rs1477621329 1304 dbSNP
rs905342241 1323 dbSNP
rs184935434 1329 dbSNP
rs1240376499 1334 dbSNP
rs188265020 1338 dbSNP
rs1435457647 1342 dbSNP
rs1235891005 1364 dbSNP
rs960781111 1368 dbSNP
rs1158248472 1370 dbSNP
rs144063699 1384 dbSNP
rs1026286641 1386 dbSNP
rs1237841779 1395 dbSNP
rs562616929 1403 dbSNP
rs1355640096 1404 dbSNP
rs1309754594 1419 dbSNP
rs1384270012 1424 dbSNP
rs987447318 1443 dbSNP
rs951291136 1444 dbSNP
rs1304220586 1447 dbSNP
rs1359322554 1447 dbSNP
rs202198972 1447 dbSNP
rs940956843 1448 dbSNP
rs1330898931 1471 dbSNP
rs1434880921 1485 dbSNP
rs1306313002 1494 dbSNP
rs574611140 1495 dbSNP
rs745975900 1498 dbSNP
rs984012871 1499 dbSNP
rs1411985082 1505 dbSNP
rs1183806331 1506 dbSNP
rs1348187026 1506 dbSNP
rs909739058 1509 dbSNP
rs1206536662 1540 dbSNP
rs1483648429 1552 dbSNP
rs538572062 1562 dbSNP
rs1262102961 1565 dbSNP
rs1262527324 1568 dbSNP
rs1214493966 1577 dbSNP
rs1489244090 1584 dbSNP
rs191578937 1592 dbSNP
rs975223689 1599 dbSNP
rs922341024 1600 dbSNP
rs1055941606 1605 dbSNP
rs933701425 1609 dbSNP
rs1191633706 1610 dbSNP
rs749097670 1617 dbSNP
rs1339396467 1618 dbSNP
rs1052057546 1621 dbSNP
rs552141208 1623 dbSNP
rs1363015128 1625 dbSNP
rs913548075 1630 dbSNP
rs78833625 1632 dbSNP
rs1457772808 1636 dbSNP
rs1362140791 1639 dbSNP
rs780718715 1648 dbSNP
rs11537776 1650 dbSNP
rs1167224407 1651 dbSNP
rs1002783873 1652 dbSNP
rs1056599181 1666 dbSNP
rs1475677069 1675 dbSNP
rs546566936 1676 dbSNP
rs184673612 1680 dbSNP
rs896089287 1682 dbSNP
rs1478839913 1686 dbSNP
rs1026335543 1696 dbSNP
rs887757733 1704 dbSNP
rs1005499371 1708 dbSNP
rs774036755 1723 dbSNP
rs1267021020 1737 dbSNP
rs1221963831 1740 dbSNP
rs1316932526 1754 dbSNP
rs963950518 1757 dbSNP
rs1275843902 1766 dbSNP
rs747800651 1785 dbSNP
rs975654115 1796 dbSNP
rs954801223 1797 dbSNP
rs1386674456 1798 dbSNP
rs1366061131 1808 dbSNP
rs571745677 1809 dbSNP
rs538125936 1811 dbSNP
rs1014919246 1812 dbSNP
rs1399925899 1813 dbSNP
rs550815567 1817 dbSNP
rs955137285 1825 dbSNP
rs1373686732 1832 dbSNP
rs1198197246 1840 dbSNP
rs1431386767 1860 dbSNP
rs973711541 1862 dbSNP
rs1194030548 1868 dbSNP
rs1457153514 1871 dbSNP
rs771791541 1880 dbSNP
rs1200119670 1892 dbSNP
rs1240689116 1897 dbSNP
rs1254935613 1899 dbSNP
rs1230373420 1905 dbSNP
rs1310972222 1906 dbSNP
rs913600365 1910 dbSNP
rs958955611 1911 dbSNP
rs1376599691 1912 dbSNP
rs1329608793 1921 dbSNP
rs946378550 1925 dbSNP
rs1260983021 1933 dbSNP
rs1397414581 1943 dbSNP
rs991662245 1947 dbSNP
rs979748732 1948 dbSNP
rs149697819 1949 dbSNP
rs1041478953 1952 dbSNP
rs772664310 1953 dbSNP
rs760193888 1954 dbSNP
rs926874046 1957 dbSNP
rs1177948627 1961 dbSNP
rs1180234748 1962 dbSNP
rs1438070629 1964 dbSNP
rs1254979639 1965 dbSNP
rs1198238321 1966 dbSNP
rs1472441436 1967 dbSNP
rs1248448854 1972 dbSNP
rs1235625494 1983 dbSNP
rs1353564683 1991 dbSNP
rs1420990603 1993 dbSNP
rs1242690629 1999 dbSNP
rs1336580744 2000 dbSNP
rs757410308 2001 dbSNP
rs1333747159 2023 dbSNP
rs766240869 2024 dbSNP
rs568938028 2027 dbSNP
rs1404419129 2031 dbSNP
rs1313455324 2038 dbSNP
rs924329020 2040 dbSNP
rs1378352787 2046 dbSNP
rs1182764046 2054 dbSNP
rs189947368 2062 dbSNP
rs1470352653 2064 dbSNP
rs935647267 2070 dbSNP
rs1474424835 2073 dbSNP
rs1167638032 2075 dbSNP
rs548314509 2078 dbSNP
rs796067921 2080 dbSNP
rs1257640635 2083 dbSNP
rs1215195358 2092 dbSNP
rs1054103986 2106 dbSNP
rs181349604 2107 dbSNP
rs1207330058 2112 dbSNP
rs1465513536 2114 dbSNP
rs533819595 2114 dbSNP
rs1242846194 2116 dbSNP
rs887810497 2117 dbSNP
rs996742600 2117 dbSNP
rs1399420235 2121 dbSNP
rs1296987152 2126 dbSNP
rs1050889194 2131 dbSNP
rs186835934 2143 dbSNP
rs1161199872 2146 dbSNP
rs1006222764 2151 dbSNP
rs1017565052 2152 dbSNP
rs759363162 2159 dbSNP
rs764990856 2164 dbSNP
rs1008973396 2166 dbSNP
rs1261727179 2174 dbSNP
rs996745851 2178 dbSNP
rs1014951894 2190 dbSNP
rs1447981207 2196 dbSNP
rs1029935127 2202 dbSNP
rs1307243243 2205 dbSNP
rs577142821 2206 dbSNP
rs73275024 2209 dbSNP
rs1231078837 2212 dbSNP
rs1294835597 2216 dbSNP
rs556350550 2237 dbSNP
rs188969135 2241 dbSNP
rs967734169 2242 dbSNP
rs979518936 2250 dbSNP
rs1027619695 2252 dbSNP
rs1271897392 2253 dbSNP
rs1431431547 2259 dbSNP
rs1330399531 2261 dbSNP
rs959213922 2274 dbSNP
rs1406808058 2287 dbSNP
rs991736061 2288 dbSNP
rs554196322 2297 dbSNP
rs866470904 2299 dbSNP
rs767873763 2307 dbSNP
rs1186557389 2334 dbSNP
rs977192039 2336 dbSNP
rs541952827 2338 dbSNP
rs866675584 2339 dbSNP
rs992403008 2348 dbSNP
rs560673603 2360 dbSNP
rs143331970 2364 dbSNP
rs1198211561 2370 dbSNP
rs1316248497 2380 dbSNP
rs1275230208 2385 dbSNP
rs1215174014 2388 dbSNP
rs918117082 2389 dbSNP
rs1272997422 2393 dbSNP
rs929450005 2395 dbSNP
rs1474312701 2402 dbSNP
rs1330313421 2403 dbSNP
rs76655591 2406 dbSNP
rs1050964357 2407 dbSNP
rs887863536 2411 dbSNP
rs942093371 2412 dbSNP
rs1039457642 2440 dbSNP
rs568430166 2441 dbSNP
rs1425172610 2451 dbSNP
rs750470893 2456 dbSNP
rs1455893538 2462 dbSNP
rs1396097774 2466 dbSNP
rs1178356890 2472 dbSNP
rs997196798 2474 dbSNP
rs1051014061 2480 dbSNP
rs890998320 2486 dbSNP
rs1234750079 2492 dbSNP
rs1375343136 2506 dbSNP
rs1463064906 2509 dbSNP
rs546206362 2532 dbSNP
rs1036794460 2533 dbSNP
rs897909798 2537 dbSNP
rs1236369985 2538 dbSNP
rs1348453384 2540 dbSNP
rs867432841 2556 dbSNP
rs1196911449 2558 dbSNP
rs1308290343 2559 dbSNP
rs1237620319 2564 dbSNP
rs368965515 2567 dbSNP
rs1028108109 2568 dbSNP
rs1446730426 2569 dbSNP
rs1020711995 2571 dbSNP
rs1314134230 2572 dbSNP
rs1356911048 2572 dbSNP
rs1414801136 2580 dbSNP
rs894467798 2582 dbSNP
rs967786572 2586 dbSNP
rs1158418798 2589 dbSNP
rs756264951 2593 dbSNP
rs1355822868 2597 dbSNP
rs1033788869 2604 dbSNP
rs1177974511 2608 dbSNP
rs1472531655 2614 dbSNP
rs1235838730 2615 dbSNP
rs971615630 2619 dbSNP
rs977600231 2626 dbSNP
rs1031805633 2629 dbSNP
rs957352741 2634 dbSNP
rs535634567 2637 dbSNP
rs1307329246 2638 dbSNP
rs1228074894 2639 dbSNP
rs989914367 2640 dbSNP
rs1484747144 2651 dbSNP
rs778757344 2653 dbSNP
rs780699974 2654 dbSNP
rs1376664961 2659 dbSNP
rs1213335030 2661 dbSNP
rs959054895 2663 dbSNP
rs1258435856 2666 dbSNP
rs532461692 2676 dbSNP
rs992852492 2680 dbSNP
rs1452146075 2682 dbSNP
rs1347286757 2694 dbSNP
rs1160240830 2706 dbSNP
rs375326640 2710 dbSNP
rs1185079228 2720 dbSNP
rs1415881888 2723 dbSNP
rs1190159167 2724 dbSNP
rs1458406776 2727 dbSNP
rs950904037 2734 dbSNP
rs983626839 2742 dbSNP
rs1262464585 2751 dbSNP
rs147329523 2765 dbSNP
rs1429688207 2767 dbSNP
rs754358585 2769 dbSNP
rs939904698 2770 dbSNP
rs1175949521 2772 dbSNP
rs942127144 2781 dbSNP
rs367884794 2784 dbSNP
rs755343830 2807 dbSNP
rs1432280309 2815 dbSNP
rs1175149805 2818 dbSNP
rs921961463 2822 dbSNP
rs1049131617 2823 dbSNP
rs930754923 2823 dbSNP
rs933333621 2823 dbSNP
rs1364642200 2828 dbSNP
rs529940662 2837 dbSNP
rs1375613598 2840 dbSNP
rs1429771651 2849 dbSNP
rs894503111 2854 dbSNP
rs779181253 2855 dbSNP
rs891052312 2862 dbSNP
rs1009413167 2865 dbSNP
rs1167360154 2868 dbSNP
rs1462081164 2871 dbSNP
rs1422976164 2874 dbSNP
rs1024282899 2877 dbSNP
rs907462470 2878 dbSNP
rs1042222713 2881 dbSNP
rs1262256283 2887 dbSNP
rs999069958 2888 dbSNP
rs1487375126 2889 dbSNP
rs369995904 2891 dbSNP
rs1001049728 2893 dbSNP
rs1213894788 2896 dbSNP
rs1316874898 2902 dbSNP
rs1255634026 2907 dbSNP
rs1228899423 2909 dbSNP
rs957555586 2911 dbSNP
rs566592585 2912 dbSNP
rs527268449 2913 dbSNP
rs1441961949 2927 dbSNP
rs953776419 2932 dbSNP
rs181727497 2935 dbSNP
rs1463582534 2942 dbSNP
rs1373628802 2949 dbSNP
rs1024613148 2958 dbSNP
rs1175243866 2962 dbSNP
rs1281315925 2970 dbSNP
rs1396693500 2977 dbSNP
rs1353346782 2988 dbSNP
rs1045301 2998 dbSNP
rs1247900702 3002 dbSNP
rs376608039 3003 dbSNP
rs369963478 3004 dbSNP
rs1197105303 3005 dbSNP
rs1480666447 3013 dbSNP
rs912188032 3017 dbSNP
rs1486380118 3025 dbSNP
rs1191155113 3033 dbSNP
rs1235390909 3047 dbSNP
rs1346295794 3047 dbSNP
rs878964440 3047 dbSNP
rs186428485 3048 dbSNP
rs1452044833 3049 dbSNP
rs1435314753 3057 dbSNP
rs1267750722 3062 dbSNP
rs1397264348 3063 dbSNP
rs972666033 3065 dbSNP
rs909402721 3066 dbSNP
rs1335699370 3067 dbSNP
rs1377402985 3070 dbSNP
rs1230427130 3075 dbSNP
rs963571965 3076 dbSNP
rs1314058936 3078 dbSNP
rs1176344124 3080 dbSNP
rs149457691 3083 dbSNP
rs1316900742 3084 dbSNP
rs975273155 3085 dbSNP
rs922042742 3086 dbSNP
rs762505377 3091 dbSNP
rs568548794 3095 dbSNP
rs1438846450 3098 dbSNP
rs1381792444 3099 dbSNP
rs781258128 3100 dbSNP
rs1051730163 3101 dbSNP
rs777409884 3103 dbSNP
rs111495442 3104 dbSNP
rs1412403161 3110 dbSNP
rs756347817 3115 dbSNP
rs1414278486 3117 dbSNP
rs1418364152 3118 dbSNP
rs945320562 3122 dbSNP
rs1042274347 3124 dbSNP
rs1156897470 3124 dbSNP
rs1413469318 3131 dbSNP
rs1353405410 3133 dbSNP
rs189660282 3134 dbSNP
rs1175225431 3137 dbSNP
rs903717033 3139 dbSNP
rs1450616096 3142 dbSNP
rs1303728993 3146 dbSNP
rs1456817682 3148 dbSNP
rs1412940854 3149 dbSNP
rs1373056272 3150 dbSNP
rs1408493643 3159 dbSNP
rs936513901 3181 dbSNP
rs1055324487 3182 dbSNP
rs1382477412 3183 dbSNP
rs1045765474 3187 dbSNP
rs537771501 3188 dbSNP
rs553952254 3190 dbSNP
rs1185245148 3199 dbSNP
rs770488323 3202 dbSNP
rs1304334853 3203 dbSNP
rs1260284812 3204 dbSNP
rs907200848 3211 dbSNP
rs886087739 3216 dbSNP
rs1282621084 3220 dbSNP
rs1372674409 3231 dbSNP
rs1222322214 3234 dbSNP
rs1005172766 3235 dbSNP
rs148648575 3236 dbSNP
rs963925542 3237 dbSNP
rs1357424741 3240 dbSNP
rs35662607 3241 dbSNP
rs1293878841 3243 dbSNP
rs1399364649 3247 dbSNP
rs1324567701 3255 dbSNP
rs1320063499 3259 dbSNP
rs974947523 3270 dbSNP
rs1213393805 3271 dbSNP
rs1271830452 3306 dbSNP
rs1011767197 3312 dbSNP
rs1028872840 3320 dbSNP
rs1470269888 3324 dbSNP
rs1169281488 3327 dbSNP
rs117254841 3328 dbSNP
rs1240795088 3332 dbSNP
rs1195862900 3339 dbSNP
rs954838071 3340 dbSNP
rs987499868 3346 dbSNP
rs558192662 3350 dbSNP
rs1253135856 3354 dbSNP
rs1252662538 3356 dbSNP
rs1212026059 3361 dbSNP
rs913266226 3362 dbSNP
rs1007928063 3367 dbSNP
rs1214003162 3374 dbSNP
rs946041502 3376 dbSNP
rs978016563 3381 dbSNP
rs925224563 3383 dbSNP
rs1369928392 3400 dbSNP
rs936549086 3404 dbSNP
rs866265989 3417 dbSNP
rs759432880 3419 dbSNP
rs973083795 3423 dbSNP
rs949137830 3429 dbSNP
rs919872075 3435 dbSNP
rs576553506 3437 dbSNP
rs769800627 3438 dbSNP
rs990676525 3439 dbSNP
rs1394890758 3456 dbSNP
rs1004555804 3468 dbSNP
rs1470007499 3470 dbSNP
rs1253793620 3477 dbSNP
rs1203982371 3481 dbSNP
rs1436126646 3492 dbSNP
rs544509869 3495 dbSNP
rs1275074927 3502 dbSNP
rs1016309563 3512 dbSNP
rs1392001772 3514 dbSNP
rs948822776 3515 dbSNP
rs1045842630 3522 dbSNP
rs899428206 3524 dbSNP
rs182292760 3525 dbSNP
rs1462996183 3526 dbSNP
rs529828475 3530 dbSNP
rs542031704 3532 dbSNP
rs762818678 3536 dbSNP
rs186043624 3541 dbSNP
rs1375316173 3544 dbSNP
rs142157402 3553 dbSNP
rs889951307 3556 dbSNP
rs1395967978 3564 dbSNP
rs1176798673 3567 dbSNP
rs1468758366 3585 dbSNP
rs1020321038 3588 dbSNP
rs1291883813 3604 dbSNP
rs1007957539 3606 dbSNP
rs967395048 3619 dbSNP
rs978737510 3626 dbSNP
rs1278094499 3629 dbSNP
rs7276 3634 dbSNP
rs1214902137 3643 dbSNP
rs1348298294 3647 dbSNP
rs961389434 3649 dbSNP
rs993867168 3655 dbSNP
rs1375008751 3671 dbSNP
rs936619458 3674 dbSNP
rs750738543 3675 dbSNP
rs1027026957 3679 dbSNP
rs1311566636 3685 dbSNP
rs1272868400 3698 dbSNP
rs952666766 3699 dbSNP
rs1360139931 3701 dbSNP
rs1158769147 3714 dbSNP
rs1399186852 3725 dbSNP
rs1410350673 3730 dbSNP
rs1045534 3731 dbSNP
rs780807826 3732 dbSNP
rs1474913687 3735 dbSNP
rs1255380712 3747 dbSNP
rs1189939332 3749 dbSNP
rs1485936071 3749 dbSNP
rs554756051 3753 dbSNP
rs1213319343 3756 dbSNP
rs760822171 3757 dbSNP
rs949197574 3769 dbSNP
rs1284518733 3771 dbSNP
rs1234114168 3772 dbSNP
rs1023511262 3787 dbSNP
rs766610919 3788 dbSNP
rs981551233 3795 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               :|||  || ||||||| 
Target 5' uccucGCCACAAUUUGCUGCUu 3'
5 - 26
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||  || ||||||| 
Target 5' ------CCACAAUUUGCUGCUu 3'
1 - 16
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000031146.4 | 3UTR | CCUCUCCUCGCCACAAUUUGCUGCUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000031146.4 | 3UTR | CCACAAUUUGCUGCUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000031146.4 | 3UTR | UCUAGCCUCUCCUCGCCACAAUUUGCUGCUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.277 5.6e-3 0.239 1.5e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.53 8.1e-3 0.651 9.4e-4 20 Click to see details
GSE19350 CNS germ cell tumors 0.63 1.4e-2 0.455 6.9e-2 12 Click to see details
GSE42095 Differentiated embryonic stem cells 0.432 2.0e-2 0.453 1.5e-2 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.407 2.2e-2 0.376 3.2e-2 25 Click to see details
GSE32688 Pancreatic cancer -0.3 4.8e-2 -0.148 2.1e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.477 5.0e-2 -0.445 6.4e-2 13 Click to see details
GSE17306 Multiple myeloma -0.216 6.8e-2 -0.189 9.7e-2 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.263 1.0e-1 0.315 6.3e-2 25 Click to see details
GSE14794 Lymphoblastoid cells 0.133 1.1e-1 0.124 1.2e-1 90 Click to see details
GSE19536 Breast cancer 0.1 1.6e-1 0.090 1.9e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.087 2.2e-1 0.083 2.3e-1 79 Click to see details
GSE28544 Breast cancer -0.142 2.5e-1 -0.363 4.1e-2 24 Click to see details
GSE27834 Pluripotent stem cells 0.152 2.9e-1 0.165 2.7e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.064 3.1e-1 -0.076 2.8e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.105 3.1e-1 -0.085 3.5e-1 24 Click to see details
GSE21849 B cell lymphoma 0.094 3.1e-1 0.089 3.2e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer -0.1 3.4e-1 -0.066 3.9e-1 20 Click to see details
GSE17498 Multiple myeloma 0.026 4.4e-1 -0.094 2.8e-1 40 Click to see details
GSE38226 Liver fibrosis 0.009 4.8e-1 0.251 1.4e-1 21 Click to see details
GSE38226 Liver fibrosis 0.009 4.8e-1 0.251 1.4e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.689 0 0.707 0 32 Click to see details
THCA -0.246 0.03 -0.236 0.04 59 Click to see details
LIHC -0.266 0.03 -0.288 0.02 49 Click to see details
KIRP -0.326 0.03 -0.309 0.04 32 Click to see details
PRAD 0.247 0.04 0.121 0.2 50 Click to see details
LUAD -0.442 0.08 -0.524 0.04 12 Click to see details
COAD -0.536 0.09 -0.738 0.02 8 Click to see details
UCEC 0.315 0.09 0.247 0.15 19 Click to see details
KIRC -0.155 0.1 -0.106 0.19 68 Click to see details
BLCA 0.295 0.12 0.346 0.08 18 Click to see details
CHOL -0.349 0.18 -0.200 0.3 9 Click to see details
KICH -0.188 0.18 -0.346 0.05 25 Click to see details
HNSC -0.14 0.19 -0.147 0.18 42 Click to see details
LUSC 0.147 0.19 0.077 0.32 38 Click to see details
CESC -0.762 0.22 -0.500 0.33 3 Click to see details
PCPG -0.556 0.31 -0.500 0.33 3 Click to see details
ESCA -0.144 0.34 -0.264 0.22 11 Click to see details
PAAD -0.185 0.41 -0.800 0.1 4 Click to see details
BRCA 0.002 0.49 -0.015 0.45 84 Click to see details
BRCA 0.002 0.49 -0.015 0.45 84 Click to see details
BRCA 0.002 0.49 -0.015 0.45 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1