miRTarBase - #MIRT190184 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GPR180   
Synonyms ITR
Description G protein-coupled receptor 180
Transcript NM_180989   
Expression
Putative miRNA Targets on GPR180
3'UTR of GPR180
(miRNA target sites are highlighted)
>GPR180|NM_180989|3'UTR
   1 TACTTGATTTTTGTTGAGAGGAAAAGTGAATTGGTTAAAAGAGTGCAATAAGGATCCAAATACAGTGACTTTTTTTTCAT
  81 ACATTTAGTATGAAAACTTGAACAGCGAAAGCAGAGCATGTTATTTATATAACTGCATTTAAGCAGTACCAAGACTGAAA
 161 AAAAAGGTAATAAATGAAATGTTTTGAAATATACTTAAACAACAAACTTTGAAGAAAGTGTTGTTATAAAATTATTGAAG
 241 CGATTTCTATGTGGAAATAAATGTGAAAAATAACTATGATATTTTGGTAAAATATTCACCACTTATAATGCCTCATCTTA
 321 ATAGCTAACTCAGGTTTAATAGTCTTATAAAAAGTAATCAGTTAAATGATTACTTGCTTATAAATATCTAAACTAGTCCA
 401 GTTATGAAATCAGTGTAATACATTGATTTTTAAAACTGCTGCTTTTTATGCTTTAAGGAAAATGTATTTCATATTTGAGT
 481 TTAAAGGAATTGAAATTACTTCAGGAAATGAATATAAAATAGGTTCACAGTTAAATGAATAAGCTTTTGTTTATTTGTGG
 561 GTGGAGTTATTCTCCAATTTTTTCTGCCATTTTTGGCTCTAGTTCAGGTTTTAGCTTGATTAGCAAAGGTTTTTGACAAA
 641 CAGTTTATGAAAAAATAAAACTTAAATACATTACACGGGTTGTAAGGACAAAGGATTTTAAAATCTGAGCACTTAGGTGA
 721 AGGGACAAGCAGGTTTATGTGTTTAAACAGAAAGAAGGGAAAAGGTACTATGTGATATGGTACTGAAATTTTGATCCCAA
 801 TAGAATTCATTTCTCTTACGTTGAATCCCCAATCATAATTAAGCCGTATACACAGATTAAATTAACAGAAGCATTTCACA
 881 TAAATGTTGGTTTCAGTCATCAACTACCCATGAATTCCTGCCCAAGGATACTTAATCAGGATTAAATTTTCTATGAATAA
 961 TTGAAAAACAAAACACTCACTGGATTTGTTATAATCCGTGTTGGCACTGGATTCTAAGTAGTTGCCATCTTGAATCCTTT
1041 GTAATAAAGCCATACTTTTGTGTGTGTGTGTGATGCCCCAGTATTGAGTATGCTAGCTAAAAAATATCAAGTGCCTGATT
1121 AAAGAATTGCTAAATGGTTGTCAATACTCGCTGTATAAAATGAGTATTCCCATTAATAGTCACTGATTGGAAATTATTCT
1201 GTTGCTGTTTGTCAAGCTGTTCAGGCCTTTTCCTTTTTACTTCTGGCTTATTTTAAAAATATTTTTTATCTATTTACTGT
1281 GTGTTTAAGCAAGCAACAGTGCACTGATCTGGTAGTTAAATTTTTTAATTAAATAGTTAAAATAATGTAGTGCAACTTAA
1361 AAATATCTATGGCTTTGTTTTTGTTTTTCTTTTGTACCTAGTCTCATTGGAAATGACTAGTATTCTGCCTCATTTTCAGG
1441 GCAGAATATGTGTTTGTGACCCAAAATGACAAAGTTACCAAGTTCAACCTGCTCATTAAATCATCTCTCTATTAGTTCTT
1521 TGTAAATCACTTAGTACATTAGAGCTACAGGTTAAGACTAGAAAGTCTGAGTTATGTTTTAGGTATACATGATCGTCTGA
1601 GTGGTCATAACCTTTTCTTTTATCATGTCTCGCTAATAACCCCAGCTATTGTCTGTTGTGTTCAGCTGAGATGCAAAAAA
1681 GAAATTAAGCAAAAAAGAAAAAGATGAAGACTTTTCATGAATTTTGTGAACTTGCCAAAAGGGGAAGGGAAAAATCTTTG
1761 TGTTACTTCACTCAAAGAACATAAGTAACTGCAATTAACATATATGAAATTTATTACTCTGCTTGCATTTATGAAACTAA
1841 CCAGTTTTTTAAACTTTAATTCTTAAATTTATGGTTGGAAATGCTGATAATTTATTTTGTTATTTAAGAGCTGTTGTTAA
1921 GTGGAGGAAAGTAGTTGTTAATAAATGTATAAAACTGTTCTTGACTAGTAATCAGGGACAAAATTTATAGTTCATAAGTC
2001 ATGACACAGTATTCGCTCTTTTTCTGAATGTTTACATAGAGATTCATCACTGCAGATTACAGAAAGTTAAGTGTATACTA
2081 CAAACTCTAATTAAAGATAAAAATCTTTTCTACTTTTCTTTGTCAGATAATGCTTTTTTATGTGTTTTTACATTTTTTGA
2161 AAGAAGATAAATGGTTCATCCAGAGCTTTATTAAGAAGCATTTCTTTTCTTCCCTTAAAAAATAGATGCTTATTTTTATT
2241 GACATGTGTATAATAAGATGGGTGCCTACTGTGATGCATTTTACCAGGCATTTTACCTTCATTATTACTCATCTCTATTG
2321 TGATAACCAGGCTCCCATTTAACTGAGTATAAGAGAGAATAAATGATTTCTCTAAGGTCATCAAACTATTTAGTTTTTCC
2401 ACTTTACCTTCATGATTTAAGGAACATGTATTAGCTGTGTTTTAGTGAGAATGAATTGCTATCCATCATAATTTTTGCTG
2481 TTGATTTGAACATTAAAACTGGAATTGTGCTAAAATCAGAACATGCGCTTGAATATCTGTAAGACCTCAGCACACTTCAG
2561 TATTTGAACCTGGCTTTTAACCAGACAGTATTACTAGCAGGAGAGTTAATCTAGGCAGAAGAGCTTGCTTTAGGGTAATT
2641 ATTTATTATCTCCAGTAAAGTCACATCTGATGAACATAGGAGATACACAAATCTGAGATCATCTCTAAAATAATGAGACT
2721 AGAACCTATCTATCAACATGAACATGGGCTCCTTCAGCATGTTTCTTCTAGGAGACTGCACGTTCTTTGGAATTTGGAAA
2801 TTTGGAATTATCTGTGAAACATTTTCTTAAATAGCTTCTGTGGTATCAAATCATTGAGGTTGTTTTTTGTTTGTTTTGAG
2881 AATTGATATGATTGTTAGAAGTAGCCAGATACGAAGAGGTAATACTGTTTTTTATTCCAACATGTATTTGTGAATTGAGA
2961 CTAAAATAATGAGATTGGTTTTCCTCTGTGATCTGAAAGTAGTGTGGTAGAAGCACCGTAGCTTGATTTCTTGCAATAGC
3041 TCTCTAAGTAATATTACCATGTCCACACTTGGGCAGCCTTCTGCACAGCTCCAGGGGCATCATATGTGTTGTGCTGTAGG
3121 AGTGCCATGAAGCCTGGAGGTGAGGAAAGAAGTGATCCTGCCCACTAGGGCCATTCTCCACAGTGTAGCCAAAACAATCT
3201 CTTAAAAATGGAAATCATCTGGATGATGAGCATACAGAAATTCTTTGTGCTAATCTTGTAATTTTTTTGTAAGTTTGAAA
3281 TTATTTCAAAAAGTTTAAAAATCATATAAATCAGATCAAACTACTACTTCCCTGACAAAAACCCTCCATGTGCCTCTCAT
3361 TGCACTTAGGAAAAGAAGTCCTCACTCATTACTATGTTCTGCAAGGCCCATATGATCTGGTTATCTCTTAATTTGTACCA
3441 CTCTCTCACACACATATCCCAGCCTCATTGTCCTTCATCAAAAAAAGATCTAGCTTATATCACACCCTCAGATACTTGGC
3521 ACTAGCCATCTTCTCTGCCTGGGACATTCTCTTCCAAATCTTAGCATGGTTGGAAGGCTGAATCCTCATCCTTCAGGTTC
3601 TCAGCTGAGATGTCTTTTAGAGAACTCACCATCTGTGGTGGATTTATATGGTGCAGTTTAGTCAACCTGGAGATAGGTTC
3681 TGCAGAATTCTCTTCCATGCATAATTTCAGGACAATGTAGGCCATAAGAAATGTTTGATACAAGATATAGAAGGCAGAAG
3761 TAAAGTAGCAGCCAGATCTGCATTCTTTTTGTAAGAGGAAGGGCCAGACAAGGCACAAGGCACAAGGCACTGTTGCAGCT
3841 TATCCACATTATTGCTTATCTGTTGGCTTCTCTTGGCCTGTGGGACAACAGCCAGGCCCACAGGAACACCAGTTCCTGCC
3921 GGAATGGCTCCTTCAGCTTCTCTGGCTCCTGGGCCAGGTGTGCGTTTTACTCTGACAAAGGGTGCCAGCTTCTGCTGGAC
4001 AACTCCATCATTCACACTGGAGGATTAGAGGCAGGGAGAGACCTGTATGGCTTCCAGTCCATCCTCACAAGTTCCACTCA
4081 GTTCCCACAGGTTCTACTCATCCTAGCAAGTTCCTTGCTTCCCCCATTTCCCATGTCTTCCCTTTCCAACTGCCAGACAC
4161 AAAAGAAACCGCCTCCTATAATCCCTATAATAAGCCCCTTATTTTGAATATTAAGATATGTGTATGTGTATTAGATCCTA
4241 GTGGTTCTTTTCTGATCAGACCCTGATTAACCATACCATCCTACCTAATGCTATTCCCCCATCCTAGTTCTATCATATTA
4321 TCCCTTTTTTTGTTTGTTGTACTTAGCTGGTTTATCTTTGTCATCTCTCAAATTAGAATATAAATTTTAAGTGAGTTTGT
4401 CTCTATTGTTCATTGCTGTATGCCTAATACTAGGACACTCCCTGGTGCATACTAGATGCTCAAAAATATTTTTGAGTGAA
4481 TGAAGGCAATGCTGAAAAAGTTCCAAATCTGTACTTAACAGTGTAGTATTAATTATGTAATAGAAGTACCCGTAGTGACT
4561 TCAATAATACCTTGCCTATTCTTTGTTCAATTGCATGGAACTTGGTAGTGTGTAAAAATCTTGACTAGTCAAGTAGTTGT
4641 CATAAAACATCAGTTACGAGAGGATTTCTCAAATTCTCACAGAGGCAGTTTCTCTTTATTTTATGTAGTCCTGTAATAGG
4721 ACCATGTGTCTGGTTTCTGGCCTGCCACAACCAGAAGCACCAATTTAAAAGAGAAGTTTCTAGTCAGCTAGAGGAGGGAA
4801 TGTTGACAGTAGTCAGAAGCAGCTGGGAAAAGATGGGAAAACTAGAAATGACAATAACACTCAAATTGCAGCAGCCTGGG
4881 GTCATTTAGTGTAGGTGAAAGCAGCCCTGTGTTGTGTATCTCAGTAGACTCTTAAGAGATTTGTTGTTCAATGTATTCAT
4961 GACAGTGACTGATGGTAATCAAGAAAATATTAAGTTATAAGTTATGTTCAGTAGCCTCAAAGAAGTATGCGAAAACCTTC
5041 TAATGTTTTCTTCTTGTTAAACAGGTAATATATGCACATTGTACAAAAATCAGAAAGTTGAAAAAGGTGGGGAAAAGAAG
5121 TCCTTCTCTCACTCATTTCCCTTCCCTGAATCCAAACTCTGTTACCAGTTATCTTTCTAGAAATGGCCCCATGCACATAT
5201 AAACATATATGAAACACAAATTATAGCATAACATACAGACTTTTGCACATTCAGCAATTTATTCTGTAGCCTTACCTAGA
5281 ATTGTCCCATTTTTTTCACCAATTGCATAGAACTCCATTATATGGATGTATTTTGATTTTTTCAAAGAATCAGTTCTGTT
5361 ACTGCACGTTGTTGGTTTTCAGTCTTGCTAATACAGACAAGGCTGAAATTAAGACAGTAATCAAGAATTTGCCAAGACTT
5441 CCTTCCCTCCTCCCAAAATGCCTCCACTCCAGGTTCCAGGTCTAGATCCTTGGGATTTTCTAGGTGATGGAAGTATCTTT
5521 GTTATTCATAGTGAGCTCTGATAGTTACGCTAACCAGATGACTCAAATAGGGGCTAGCCACACCAGAAGACCAACCATTG
5601 GATTAGAGGGTTGGAGTTTTGAGTCATATGATATTAGCCCAACCTCTGAGGTGGAGAGAGGGGTTAGAGATGGAGTTCAG
5681 CTTTATATAGAGATTGAGTCAATTAATCATGCCTGTCATGAAACCCCGAGAGAAACTCTGGTCAGTGATGCTCAAGTGAA
5761 CTTCCCTGGTTGGCAATACTCTGGTGTGTTCTAGGAGGGTGACATGTCCCTGAGGGCACAGAAACTTTGTGTTTGGGATC
5841 CTCTTACACCTTGCTCTATGTATGTCTTCTTTTGGCTGTTCTGATTTGTATCCTTTTGCTATAATAAACTGTAATAGTAC
5921 GCATAGCACTTTGCTGAGTTCTGTGAGTTGTTCTATTTAATTATAGAACCTGAAGGTATTGTGGGGACCCCTGAACTTGC
6001 AGCCAGTTGGTCAGAAGTAAGGATGGTCCTGGGAATGCCCAAAGTTGCTAGTTTCTGAAGTGAGGGCAGTCATATGGAGG
6081 ACTGGGCCCTTAATCTGTGAAGTTTGGCTTAACTTCAGGCAGTTGGTGTCAGAAGCCATTGCAAATATCCTGATGATCCG
6161 TGCAAAACAAAAACACTTAACAGAAAATTACGTTGTACTCTCTGTACGGATAATTTTCGGTTAAGTGTTTTTGTTTTCCA
6241 TGGATTGTACTAGATATCAATCTGATAAATAACTTTTATTCATTATAGTTTTAATTTGCATTTCTCTTATTAATTTTTGT
6321 TTTAAAACCATTTTCTTTCCAGTTCTACGATCTGTTAACATATTTTTCCCACTTTTCTATTGGGTTGGTTGTCTTTTTCT
6401 TATTGATTTGTTAAAACTCTTTATAACAGAAATTGGTCATTTGTGATATGAGTCTGAACTGTGTTTCTCAATTTGTGATT
6481 TTTCTCTTTACTTTTTTAATGGTGTCTTTTTCTTGTAGTTTTTTTAATGCAGGTGGAATTATCAGTCTTTCATTTTTTTC
6561 TTCTGTGTTCTACCTGTTTCACAGGTAGAAAAGCCTTAGCTCTTTGAGATTATGTTTAAATGCCCTGTATTTTCATCTAG
6641 TGGTTTTATGGTTTTATTTTGTATGTTTTTTTCATCCACCTGGAATTTATTTTGCTGTTAAAATATGAATTAGAGATCCA
6721 ACTTAATTTTTTTCAGATGGTTGTTGACTTATTGCAATATCATGTGTTATATAATCCATCTTTACTGATTCGTTGCTAAT
6801 TGGTTTCTGGACTTTTAAGGCTATCTGATGAACTGTTGATCTGGTACCACACTGTTTCAATTATTGTAGTCTTAAAATTG
6881 CTGTACGCTTTGGTAGGGATAATTTTCTGTTAAGTGTTTTTGTTTTTTATAATTTTCCAATTAGTCTTGCTCATTTTTTA
6961 TATAAACTTTGAAATCAATTTTTCTGATTTTCAAAAGAAAAAAAATCCTGTTTAGTATTCTTAGTGGAATGAATTAAATT
7041 TCCATAGCAATTTAGGGAAATTTGACTTTCTTAACGTGTTGAGTGTTAAACCCACAGGTGGTAGCATGACATTGACTCCT
7121 CAGCCAAGCATATTATCAACTGTCGGAAACTAGGTTTTCCCATAGTGATCCAAGAAACTAGTACGAAATGCCTTTCTGAT
7201 TTTTTAAAACTTGTATACATATATAGTACATATTATATATACTTATATATTAAGTAATCAGAAGTATGTGTTTCTCAATC
7281 ACCTTTTAAAGACTTCTTTATATAGCTCTTGTACATTTCTTGATATGAATATGTTAATGTTTTCTTTCATTATGTTGCAT
7361 ATGGCTTTTGTTTTCTGCATGAAAACTATTGATTTCTGCATTCTAATTTTGTTCCCAGTCACCTAACTGAATTCTTCTAA
7441 CAGTTGTAATAAATTTCTGGTTGGCTCTCTTGTGAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUAC-ACGACGAu 5'
             |||::||| || |||||:| 
Target 5' tggAAATTATTCTGTTGCTGTTt 3'
1188 - 1210 155.00 -13.00
2
miRNA  3' guguUUGGUAA--UACACGACGAu 5'
              :|:: ||  |  ||||||| 
Target 5' cattGATTTTTAAAACTGCTGCTt 3'
421 - 444 144.00 -9.90
3
miRNA  3' guguuUGGUA--AUACACGACGAu 5'
               |:|||  | | |||||:| 
Target 5' tatccATCATAATTTTTGCTGTTg 3'
2460 - 2483 139.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31606054 63 COSMIC
COSN18747322 78 COSMIC
COSN20071554 78 COSMIC
COSN28687640 81 COSMIC
COSN30167083 85 COSMIC
COSN30465083 89 COSMIC
COSN31580439 107 COSMIC
COSN31492153 137 COSMIC
COSN31538560 137 COSMIC
COSN31554654 153 COSMIC
COSN20047527 166 COSMIC
COSN22517537 399 COSMIC
COSN26152008 536 COSMIC
COSN31578502 678 COSMIC
COSN1636345 800 COSMIC
COSN17857384 820 COSMIC
COSN30169902 847 COSMIC
COSN17076311 854 COSMIC
COSN26555365 897 COSMIC
COSN26553706 913 COSMIC
COSN31606951 948 COSMIC
COSN1163560 1105 COSMIC
COSN31960933 1151 COSMIC
COSN18912861 1310 COSMIC
COSN5728991 1322 COSMIC
COSN24831702 1498 COSMIC
COSN4707507 1598 COSMIC
COSN15798320 1646 COSMIC
COSN30388312 1846 COSMIC
COSN6634787 2526 COSMIC
COSN22891527 2645 COSMIC
COSN8426799 2996 COSMIC
COSN21678007 3060 COSMIC
COSN1636346 3322 COSMIC
COSN28124511 3399 COSMIC
COSN1636347 3526 COSMIC
COSN4707508 3693 COSMIC
COSN21463558 3864 COSMIC
COSN17656807 3926 COSMIC
COSN16851803 3955 COSMIC
COSN8426800 4100 COSMIC
COSN1636348 4210 COSMIC
COSN27974649 4616 COSMIC
COSN26394848 4643 COSMIC
COSN1636349 5032 COSMIC
COSN25121069 5066 COSMIC
COSN1636350 5210 COSMIC
COSN29768247 5297 COSMIC
COSN8426801 5298 COSMIC
COSN23365143 6875 COSMIC
COSN5349567 7263 COSMIC
rs9524568 81 GWAS
rs187295598 1409 GWAS
rs1341267 5556 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs377092985 2 dbSNP
rs1015291770 3 dbSNP
rs369542453 4 dbSNP
rs777210753 9 dbSNP
rs759757258 14 dbSNP
rs765668705 15 dbSNP
rs1208908214 17 dbSNP
rs761780340 19 dbSNP
rs1489383853 22 dbSNP
rs1463299721 24 dbSNP
rs758597396 30 dbSNP
rs372721554 31 dbSNP
rs748889212 31 dbSNP
rs1222167652 32 dbSNP
rs1423168163 35 dbSNP
rs764341635 36 dbSNP
rs751635617 38 dbSNP
rs61965610 43 dbSNP
rs1317710425 48 dbSNP
rs1321347590 49 dbSNP
rs147648744 61 dbSNP
rs1359339957 67 dbSNP
rs545317160 68 dbSNP
rs766062437 70 dbSNP
rs925859828 70 dbSNP
rs1362032678 71 dbSNP
rs977507788 73 dbSNP
rs1423708934 78 dbSNP
rs1447447932 78 dbSNP
rs1190192925 79 dbSNP
rs1390743139 80 dbSNP
rs9524568 81 dbSNP
rs1172112089 82 dbSNP
rs1400114235 83 dbSNP
rs1416443698 84 dbSNP
rs1408134040 89 dbSNP
rs1418963984 91 dbSNP
rs1187157296 95 dbSNP
rs1478945911 96 dbSNP
rs755792702 107 dbSNP
rs1040888693 108 dbSNP
rs374280261 118 dbSNP
rs186014023 126 dbSNP
rs538454920 127 dbSNP
rs888091659 130 dbSNP
rs1271728040 138 dbSNP
rs1044486727 140 dbSNP
rs1366587252 156 dbSNP
rs1280907957 158 dbSNP
rs1342014798 158 dbSNP
rs555271396 163 dbSNP
rs1345982941 172 dbSNP
rs1036742830 177 dbSNP
rs906289672 184 dbSNP
rs930838528 190 dbSNP
rs1439989783 192 dbSNP
rs575161981 193 dbSNP
rs1003039307 195 dbSNP
rs544210075 196 dbSNP
rs540961546 203 dbSNP
rs959199281 212 dbSNP
rs1467200986 216 dbSNP
rs1013139955 223 dbSNP
rs1463237299 228 dbSNP
rs1176069371 234 dbSNP
rs1022311725 240 dbSNP
rs968706063 242 dbSNP
rs1015259186 248 dbSNP
rs1210377117 252 dbSNP
rs900840194 255 dbSNP
rs560181137 264 dbSNP
rs1198743133 266 dbSNP
rs1319302915 273 dbSNP
rs924689664 277 dbSNP
rs998321079 284 dbSNP
rs1432561957 288 dbSNP
rs1312385994 295 dbSNP
rs1303181474 296 dbSNP
rs965475511 303 dbSNP
rs976537871 307 dbSNP
rs1400731271 316 dbSNP
rs1448902573 318 dbSNP
rs921127767 322 dbSNP
rs932492376 323 dbSNP
rs1479057287 330 dbSNP
rs1414354580 339 dbSNP
rs1028086602 349 dbSNP
rs1048285251 357 dbSNP
rs1418803654 359 dbSNP
rs909792506 365 dbSNP
rs1388220319 378 dbSNP
rs939669526 381 dbSNP
rs1323031012 388 dbSNP
rs576817866 389 dbSNP
rs1483389066 394 dbSNP
rs545532713 397 dbSNP
rs988699294 399 dbSNP
rs906263714 402 dbSNP
rs1003322335 406 dbSNP
rs1333264785 411 dbSNP
rs778452070 412 dbSNP
rs1054895096 414 dbSNP
rs781130349 420 dbSNP
rs1380451737 430 dbSNP
rs1287102463 436 dbSNP
rs1314497382 437 dbSNP
rs1453406683 438 dbSNP
rs748044283 443 dbSNP
rs894619862 460 dbSNP
rs747506828 467 dbSNP
rs1287262750 487 dbSNP
rs1453317834 488 dbSNP
rs1346219555 495 dbSNP
rs1229816524 500 dbSNP
rs1198793542 512 dbSNP
rs1443365491 520 dbSNP
rs562620435 524 dbSNP
rs1013502665 525 dbSNP
rs771443733 527 dbSNP
rs1207787249 531 dbSNP
rs1203074899 543 dbSNP
rs1485330063 547 dbSNP
rs1286525541 554 dbSNP
rs1218470737 556 dbSNP
rs1269384015 576 dbSNP
rs756708825 578 dbSNP
rs904805693 584 dbSNP
rs1452069734 587 dbSNP
rs998807674 589 dbSNP
rs1342410928 594 dbSNP
rs1293506040 600 dbSNP
rs1381910666 602 dbSNP
rs1341322893 608 dbSNP
rs1300463401 633 dbSNP
rs1423073573 636 dbSNP
rs1411309106 638 dbSNP
rs1365515818 639 dbSNP
rs1031658736 641 dbSNP
rs1164855945 650 dbSNP
rs781468105 664 dbSNP
rs1471758505 675 dbSNP
rs1369750134 676 dbSNP
rs746238505 677 dbSNP
rs560794244 678 dbSNP
rs886640766 679 dbSNP
rs531378954 685 dbSNP
rs1457722008 689 dbSNP
rs1290751109 692 dbSNP
rs1161782598 695 dbSNP
rs940887844 704 dbSNP
rs953864814 725 dbSNP
rs547961507 731 dbSNP
rs900807623 732 dbSNP
rs1306914520 740 dbSNP
rs984370468 759 dbSNP
rs1280271020 772 dbSNP
rs1403334564 772 dbSNP
rs909794582 774 dbSNP
rs554293290 784 dbSNP
rs997849295 796 dbSNP
rs1411338575 799 dbSNP
rs1394919547 801 dbSNP
rs1028430601 802 dbSNP
rs527574341 809 dbSNP
rs547336361 811 dbSNP
rs769911523 817 dbSNP
rs778553402 818 dbSNP
rs927586085 820 dbSNP
rs1267976808 821 dbSNP
rs1199263694 826 dbSNP
rs775630891 830 dbSNP
rs1195311479 834 dbSNP
rs1357026607 838 dbSNP
rs1260064086 840 dbSNP
rs1221971996 842 dbSNP
rs1054839294 843 dbSNP
rs763053432 846 dbSNP
rs369450721 847 dbSNP
rs1235820838 849 dbSNP
rs1024237332 854 dbSNP
rs948905590 856 dbSNP
rs1328696367 864 dbSNP
rs1448161608 868 dbSNP
rs1043655437 873 dbSNP
rs373364799 874 dbSNP
rs368488872 885 dbSNP
rs1251549458 890 dbSNP
rs1423412258 924 dbSNP
rs1423976737 926 dbSNP
rs930706439 928 dbSNP
rs190220286 930 dbSNP
rs1370532920 939 dbSNP
rs1361996302 954 dbSNP
rs1425923076 958 dbSNP
rs908020392 964 dbSNP
rs1458143224 970 dbSNP
rs1240152707 971 dbSNP
rs569353235 977 dbSNP
rs940853419 979 dbSNP
rs1040593842 989 dbSNP
rs1202550504 989 dbSNP
rs901161054 993 dbSNP
rs1349064807 995 dbSNP
rs1298213729 998 dbSNP
rs780687651 999 dbSNP
rs923529775 1017 dbSNP
rs1379719570 1025 dbSNP
rs932267592 1027 dbSNP
rs1378019223 1029 dbSNP
rs538367229 1038 dbSNP
rs1334323960 1053 dbSNP
rs1382578690 1056 dbSNP
rs1415810835 1056 dbSNP
rs182223647 1057 dbSNP
rs141430176 1059 dbSNP
rs1440276787 1059 dbSNP
rs563385742 1059 dbSNP
rs1227652528 1060 dbSNP
rs891600845 1062 dbSNP
rs1445471993 1074 dbSNP
rs1344172695 1076 dbSNP
rs1284056349 1081 dbSNP
rs1217754814 1091 dbSNP
rs983968608 1096 dbSNP
rs1356490343 1098 dbSNP
rs1290143750 1107 dbSNP
rs1243140395 1110 dbSNP
rs1017207576 1111 dbSNP
rs777697770 1112 dbSNP
rs1284255707 1115 dbSNP
rs142243393 1119 dbSNP
rs972622322 1135 dbSNP
rs1297382014 1137 dbSNP
rs927867819 1145 dbSNP
rs1001891748 1147 dbSNP
rs1161669251 1150 dbSNP
rs1404682473 1151 dbSNP
rs1414685411 1156 dbSNP
rs1034319623 1163 dbSNP
rs1474567436 1173 dbSNP
rs1262679423 1174 dbSNP
rs1194858820 1187 dbSNP
rs938963432 1188 dbSNP
rs1267205672 1194 dbSNP
rs990516783 1198 dbSNP
rs1322821161 1211 dbSNP
rs1290011430 1216 dbSNP
rs1337056858 1219 dbSNP
rs1277105839 1220 dbSNP
rs916328593 1226 dbSNP
rs1388897637 1228 dbSNP
rs1400225570 1243 dbSNP
rs1342208518 1244 dbSNP
rs1301038683 1260 dbSNP
rs1435722216 1261 dbSNP
rs1350356742 1268 dbSNP
rs1167029236 1271 dbSNP
rs761713728 1273 dbSNP
rs767489399 1292 dbSNP
rs1171736577 1310 dbSNP
rs976274900 1313 dbSNP
rs1043220191 1315 dbSNP
rs923470502 1321 dbSNP
rs1489108403 1326 dbSNP
rs1248909018 1327 dbSNP
rs1223133504 1329 dbSNP
rs3831330 1330 dbSNP
rs1256856204 1335 dbSNP
rs932220718 1338 dbSNP
rs1358040633 1344 dbSNP
rs867768996 1352 dbSNP
rs934851578 1365 dbSNP
rs1218377376 1367 dbSNP
rs1368225789 1373 dbSNP
rs1295143698 1374 dbSNP
rs1439925594 1374 dbSNP
rs1399719786 1384 dbSNP
rs750193853 1388 dbSNP
rs1406286658 1393 dbSNP
rs1427405190 1397 dbSNP
rs187295598 1409 dbSNP
rs1295064787 1418 dbSNP
rs1434058622 1420 dbSNP
rs1331839468 1423 dbSNP
rs935680523 1429 dbSNP
rs998135345 1435 dbSNP
rs1054075813 1457 dbSNP
rs1198679515 1475 dbSNP
rs1367326423 1483 dbSNP
rs1050229093 1488 dbSNP
rs760464040 1495 dbSNP
rs2298057 1499 dbSNP
rs1311665132 1507 dbSNP
rs866743783 1508 dbSNP
rs1312622836 1516 dbSNP
rs77545240 1519 dbSNP
rs1237929389 1520 dbSNP
rs1017037467 1523 dbSNP
rs753498375 1533 dbSNP
rs1449019092 1537 dbSNP
rs907036657 1539 dbSNP
rs1001419330 1543 dbSNP
rs1466733947 1551 dbSNP
rs1361313228 1561 dbSNP
rs1157338540 1563 dbSNP
rs1419655744 1565 dbSNP
rs1381419497 1566 dbSNP
rs1178728239 1577 dbSNP
rs961160654 1586 dbSNP
rs1440924768 1590 dbSNP
rs1253452764 1591 dbSNP
rs545806315 1593 dbSNP
rs1034694728 1595 dbSNP
rs1483358916 1596 dbSNP
rs1451921802 1598 dbSNP
rs191839997 1599 dbSNP
rs1352919189 1604 dbSNP
rs994007485 1608 dbSNP
rs1187614082 1612 dbSNP
rs1286572422 1618 dbSNP
rs951972820 1620 dbSNP
rs1034925751 1621 dbSNP
rs1312070960 1623 dbSNP
rs754643336 1624 dbSNP
rs1006207958 1632 dbSNP
rs1381560912 1633 dbSNP
rs1287506289 1636 dbSNP
rs1419416339 1641 dbSNP
rs1014972903 1642 dbSNP
rs1161046023 1643 dbSNP
rs1423276477 1644 dbSNP
rs560305817 1649 dbSNP
rs1429581532 1651 dbSNP
rs1424055517 1652 dbSNP
rs376771067 1656 dbSNP
rs1257766366 1664 dbSNP
rs764885745 1668 dbSNP
rs990479921 1673 dbSNP
rs150144431 1674 dbSNP
rs967754249 1678 dbSNP
rs1218770165 1679 dbSNP
rs757771107 1682 dbSNP
rs1264971815 1689 dbSNP
rs1245548498 1698 dbSNP
rs2298056 1705 dbSNP
rs934796258 1711 dbSNP
rs1399625514 1721 dbSNP
rs1341585580 1729 dbSNP
rs1300411569 1732 dbSNP
rs36012214 1737 dbSNP
rs1385629915 1738 dbSNP
rs1390588484 1750 dbSNP
rs1292448918 1751 dbSNP
rs1457910168 1755 dbSNP
rs1390551351 1759 dbSNP
rs1369690564 1762 dbSNP
rs1168172052 1765 dbSNP
rs1431464688 1766 dbSNP
rs923426621 1774 dbSNP
rs1195528071 1777 dbSNP
rs1292881077 1778 dbSNP
rs1053250768 1781 dbSNP
rs527488486 1782 dbSNP
rs922855492 1786 dbSNP
rs1217575119 1788 dbSNP
rs934268943 1792 dbSNP
rs576091245 1797 dbSNP
rs756419607 1801 dbSNP
rs986369607 1802 dbSNP
rs116731685 1810 dbSNP
rs541876411 1812 dbSNP
rs373829233 1814 dbSNP
rs563232980 1818 dbSNP
rs9524569 1820 dbSNP
rs1216884587 1825 dbSNP
rs1389021442 1827 dbSNP
rs1396101015 1828 dbSNP
rs1328654028 1830 dbSNP
rs768852749 1837 dbSNP
rs1464810283 1838 dbSNP
rs1400515050 1846 dbSNP
rs993997466 1848 dbSNP
rs1034873517 1857 dbSNP
rs960598368 1859 dbSNP
rs1376848002 1866 dbSNP
rs2298055 1872 dbSNP
rs148956272 1878 dbSNP
rs182369112 1879 dbSNP
rs1198042737 1905 dbSNP
rs748196408 1906 dbSNP
rs1458396472 1912 dbSNP
rs1260165161 1932 dbSNP
rs1198942934 1934 dbSNP
rs1472096212 1945 dbSNP
rs1055656561 1948 dbSNP
rs968081667 1953 dbSNP
rs1375279690 1957 dbSNP
rs1306486109 1962 dbSNP
rs1445322506 1964 dbSNP
rs568418483 1968 dbSNP
rs1413640483 1973 dbSNP
rs1412383572 1982 dbSNP
rs1401292880 1986 dbSNP
rs1172914607 1987 dbSNP
rs1006176879 1995 dbSNP
rs1436537165 1995 dbSNP
rs1178107564 2007 dbSNP
rs1401078425 2010 dbSNP
rs377358770 2012 dbSNP
rs773155249 2015 dbSNP
rs997588010 2016 dbSNP
rs760416062 2017 dbSNP
rs554142905 2037 dbSNP
rs766313670 2057 dbSNP
rs1375408175 2060 dbSNP
rs1478012328 2064 dbSNP
rs1202497738 2066 dbSNP
rs78914826 2081 dbSNP
rs776541643 2084 dbSNP
rs1305076088 2085 dbSNP
rs1353864927 2089 dbSNP
rs934193927 2090 dbSNP
rs1346226863 2097 dbSNP
rs143735330 2103 dbSNP
rs986683257 2104 dbSNP
rs1334592683 2105 dbSNP
rs1032509612 2113 dbSNP
rs1358387914 2124 dbSNP
rs1158035440 2127 dbSNP
rs1286706057 2129 dbSNP
rs1410314787 2139 dbSNP
rs1161497844 2153 dbSNP
rs1472606265 2160 dbSNP
rs759315487 2164 dbSNP
rs1190516113 2166 dbSNP
rs764975955 2168 dbSNP
rs1224721397 2172 dbSNP
rs1487549740 2184 dbSNP
rs958274406 2187 dbSNP
rs1218043698 2190 dbSNP
rs9524570 2194 dbSNP
rs897223545 2195 dbSNP
rs1320480610 2196 dbSNP
rs185124946 2199 dbSNP
rs1355223256 2200 dbSNP
rs1284494029 2205 dbSNP
rs1234736532 2217 dbSNP
rs945720210 2224 dbSNP
rs1297323652 2225 dbSNP
rs1400573819 2229 dbSNP
rs1056576037 2233 dbSNP
rs1321686432 2233 dbSNP
rs1269042746 2244 dbSNP
rs7984105 2245 dbSNP
rs1476949232 2246 dbSNP
rs1423400205 2247 dbSNP
rs575681516 2251 dbSNP
rs937146548 2259 dbSNP
rs1253561152 2270 dbSNP
rs767929868 2271 dbSNP
rs1450600348 2276 dbSNP
rs138309708 2286 dbSNP
rs1215221398 2298 dbSNP
rs1315644016 2302 dbSNP
rs555055243 2305 dbSNP
rs1407079279 2309 dbSNP
rs1036299909 2314 dbSNP
rs142802307 2318 dbSNP
rs997910618 2328 dbSNP
rs1435652991 2329 dbSNP
rs74104285 2331 dbSNP
rs146054537 2333 dbSNP
rs1429195959 2340 dbSNP
rs1464290860 2346 dbSNP
rs1306221032 2347 dbSNP
rs1399772123 2350 dbSNP
rs1171845664 2351 dbSNP
rs975780254 2358 dbSNP
rs1430596241 2371 dbSNP
rs1030039550 2373 dbSNP
rs889194791 2378 dbSNP
rs1007675283 2380 dbSNP
rs373771159 2406 dbSNP
rs1443163138 2412 dbSNP
rs750980683 2413 dbSNP
rs1032439038 2427 dbSNP
rs190282332 2429 dbSNP
rs1214965675 2432 dbSNP
rs139028815 2446 dbSNP
rs543390576 2450 dbSNP
rs1248544992 2454 dbSNP
rs985680300 2460 dbSNP
rs1309096309 2464 dbSNP
rs1293143746 2467 dbSNP
rs1276213628 2469 dbSNP
rs1218613268 2479 dbSNP
rs1009750321 2484 dbSNP
rs78015317 2493 dbSNP
rs1444582277 2496 dbSNP
rs1376443212 2507 dbSNP
rs1332366158 2509 dbSNP
rs971027956 2518 dbSNP
rs1274471699 2519 dbSNP
rs941643466 2525 dbSNP
rs566648766 2527 dbSNP
rs918560937 2528 dbSNP
rs991241544 2532 dbSNP
rs909025053 2534 dbSNP
rs548660729 2537 dbSNP
rs1177472878 2538 dbSNP
rs929980307 2539 dbSNP
rs1446243494 2543 dbSNP
rs1209102078 2546 dbSNP
rs1036227708 2547 dbSNP
rs1282293579 2554 dbSNP
rs1237861947 2576 dbSNP
rs756593191 2584 dbSNP
rs896578867 2585 dbSNP
rs568592103 2588 dbSNP
rs527817245 2589 dbSNP
rs1052189257 2604 dbSNP
rs1377650181 2606 dbSNP
rs1044944778 2607 dbSNP
rs889130038 2610 dbSNP
rs1166833622 2616 dbSNP
rs538869822 2622 dbSNP
rs1159139804 2625 dbSNP
rs1053816028 2629 dbSNP
rs1253571315 2638 dbSNP
rs1000819351 2645 dbSNP
rs77510022 2662 dbSNP
rs1259328613 2663 dbSNP
rs1214414884 2665 dbSNP
rs1357575802 2687 dbSNP
rs1487898872 2688 dbSNP
rs1261412595 2689 dbSNP
rs1320149817 2694 dbSNP
rs1021119352 2702 dbSNP
rs1234120467 2706 dbSNP
rs1454945071 2712 dbSNP
rs892091636 2715 dbSNP
rs1399963739 2726 dbSNP
rs1003807399 2728 dbSNP
rs1365165657 2733 dbSNP
rs1454831135 2737 dbSNP
rs1366197623 2739 dbSNP
rs1163705860 2740 dbSNP
rs1035726787 2744 dbSNP
rs997146445 2746 dbSNP
rs12100358 2749 dbSNP
rs953193331 2759 dbSNP
rs1262266154 2777 dbSNP
rs908951349 2778 dbSNP
rs986012251 2782 dbSNP
rs779143017 2783 dbSNP
rs971885622 2791 dbSNP
rs963216180 2799 dbSNP
rs556586078 2805 dbSNP
rs74806901 2806 dbSNP
rs918847218 2822 dbSNP
rs951328783 2826 dbSNP
rs1276720083 2828 dbSNP
rs1204089562 2841 dbSNP
rs1247163859 2844 dbSNP
rs1327532852 2851 dbSNP
rs1298459832 2852 dbSNP
rs1385581858 2855 dbSNP
rs772153360 2858 dbSNP
rs1463538509 2859 dbSNP
rs535098803 2860 dbSNP
rs1324589248 2863 dbSNP
rs555015249 2868 dbSNP
rs1195220000 2869 dbSNP
rs369826494 2874 dbSNP
rs141558454 2882 dbSNP
rs1396149887 2885 dbSNP
rs1168282846 2889 dbSNP
rs1477413075 2890 dbSNP
rs1373421763 2893 dbSNP
rs1195306882 2898 dbSNP
rs1475783482 2901 dbSNP
rs917992663 2902 dbSNP
rs534450934 2906 dbSNP
rs1172030059 2910 dbSNP
rs948186763 2910 dbSNP
rs150878184 2913 dbSNP
rs1340573591 2914 dbSNP
rs1051688065 2917 dbSNP
rs910519404 2918 dbSNP
rs577807046 2925 dbSNP
rs1302082220 2931 dbSNP
rs543654922 2939 dbSNP
rs1471064997 2941 dbSNP
rs563583338 2945 dbSNP
rs1053743450 2959 dbSNP
rs1328947026 2971 dbSNP
rs925112387 2986 dbSNP
rs1397000505 2994 dbSNP
rs746989903 2996 dbSNP
rs1464499451 3003 dbSNP
rs936509630 3004 dbSNP
rs1320867966 3018 dbSNP
rs182650303 3019 dbSNP
rs892416759 3020 dbSNP
rs997136552 3021 dbSNP
rs1295675335 3026 dbSNP
rs1438577562 3035 dbSNP
rs1051461213 3037 dbSNP
rs1199036431 3042 dbSNP
rs1344930235 3045 dbSNP
rs1223739169 3046 dbSNP
rs1267325979 3048 dbSNP
rs542223567 3054 dbSNP
rs1326829929 3063 dbSNP
rs562101241 3070 dbSNP
rs1349488493 3077 dbSNP
rs1309906585 3087 dbSNP
rs1007280576 3090 dbSNP
rs1262379412 3094 dbSNP
rs906705549 3096 dbSNP
rs527775802 3097 dbSNP
rs1004181389 3098 dbSNP
rs1450911193 3100 dbSNP
rs1313466661 3104 dbSNP
rs1374619990 3104 dbSNP
rs547623273 3107 dbSNP
rs4417425 3110 dbSNP
rs895431878 3114 dbSNP
rs533374049 3117 dbSNP
rs1365690191 3121 dbSNP
rs1185687499 3122 dbSNP
rs550416996 3125 dbSNP
rs570038608 3128 dbSNP
rs963113606 3134 dbSNP
rs992142068 3135 dbSNP
rs1452090225 3142 dbSNP
rs1350946987 3149 dbSNP
rs1280993966 3155 dbSNP
rs1026527344 3156 dbSNP
rs917954353 3158 dbSNP
rs954586213 3161 dbSNP
rs969807884 3163 dbSNP
rs987765312 3168 dbSNP
rs1160618975 3170 dbSNP
rs1401428336 3171 dbSNP
rs1386345389 3177 dbSNP
rs1161732215 3187 dbSNP
rs1474987634 3192 dbSNP
rs1386687815 3195 dbSNP
rs188567721 3197 dbSNP
rs943329773 3198 dbSNP
rs139381737 3200 dbSNP
rs1404964604 3204 dbSNP
rs565374474 3218 dbSNP
rs193068399 3223 dbSNP
rs555964010 3232 dbSNP
rs1285720403 3235 dbSNP
rs1052259002 3239 dbSNP
rs1333654681 3240 dbSNP
rs1293691998 3247 dbSNP
rs1234834421 3248 dbSNP
rs1261069891 3255 dbSNP
rs1355604008 3258 dbSNP
rs184045325 3259 dbSNP
rs149611484 3261 dbSNP
rs1289757655 3262 dbSNP
rs1431364029 3291 dbSNP
rs933265442 3297 dbSNP
rs1052127599 3307 dbSNP
rs1490865399 3313 dbSNP
rs377461562 3315 dbSNP
rs1321630583 3318 dbSNP
rs1461146763 3320 dbSNP
rs1395415495 3322 dbSNP
rs1251404647 3327 dbSNP
rs78803229 3328 dbSNP
rs1419231937 3333 dbSNP
rs1007642098 3343 dbSNP
rs1184489835 3349 dbSNP
rs557263480 3351 dbSNP
rs939524330 3355 dbSNP
rs189125885 3363 dbSNP
rs1055727623 3364 dbSNP
rs895395902 3365 dbSNP
rs1364711039 3367 dbSNP
rs1037424251 3376 dbSNP
rs577556970 3384 dbSNP
rs898951127 3391 dbSNP
rs542984504 3392 dbSNP
rs1315891881 3393 dbSNP
rs193051212 3395 dbSNP
rs183638771 3396 dbSNP
rs993629501 3402 dbSNP
rs1264733059 3410 dbSNP
rs1026075605 3411 dbSNP
rs1440170884 3413 dbSNP
rs1371809474 3420 dbSNP
rs1025841266 3422 dbSNP
rs1444807815 3435 dbSNP
rs954643794 3441 dbSNP
rs987302788 3446 dbSNP
rs1171516032 3461 dbSNP
rs1412153499 3462 dbSNP
rs1173557980 3467 dbSNP
rs951596945 3468 dbSNP
rs1453332921 3469 dbSNP
rs1367930642 3477 dbSNP
rs1017889727 3480 dbSNP
rs34869283 3480 dbSNP
rs1013817676 3482 dbSNP
rs1025667094 3483 dbSNP
rs969380884 3485 dbSNP
rs964564574 3492 dbSNP
rs1278185614 3498 dbSNP
rs1306819024 3500 dbSNP
rs7326576 3506 dbSNP
rs1392740974 3509 dbSNP
rs1032425053 3510 dbSNP
rs1238285724 3524 dbSNP
rs115100632 3540 dbSNP
rs1299112902 3542 dbSNP
rs1339641154 3543 dbSNP
rs987918362 3544 dbSNP
rs1242264112 3545 dbSNP
rs945394120 3546 dbSNP
rs1312860313 3558 dbSNP
rs978528391 3563 dbSNP
rs928054326 3564 dbSNP
rs913706851 3565 dbSNP
rs1360017360 3566 dbSNP
rs1481524661 3566 dbSNP
rs1223353441 3567 dbSNP
rs895322236 3569 dbSNP
rs1485934346 3572 dbSNP
rs533544607 3578 dbSNP
rs144511610 3588 dbSNP
rs1038649464 3592 dbSNP
rs1225661937 3593 dbSNP
rs563572689 3603 dbSNP
rs993165719 3611 dbSNP
rs1047873933 3615 dbSNP
rs529531035 3628 dbSNP
rs1009070676 3632 dbSNP
rs1451075896 3634 dbSNP
rs943044020 3635 dbSNP
rs964533918 3647 dbSNP
rs1251437275 3668 dbSNP
rs1186895879 3670 dbSNP
rs540038468 3683 dbSNP
rs1203299541 3691 dbSNP
rs1037813585 3695 dbSNP
rs549310341 3699 dbSNP
rs559845444 3702 dbSNP
rs967054862 3716 dbSNP
rs929069988 3717 dbSNP
rs1047526249 3727 dbSNP
rs1332887557 3744 dbSNP
rs555412491 3747 dbSNP
rs1272957323 3748 dbSNP
rs1182087107 3754 dbSNP
rs1234209338 3761 dbSNP
rs565290447 3764 dbSNP
rs1357759585 3766 dbSNP
rs1294135226 3769 dbSNP
rs139534977 3772 dbSNP
rs145051893 3773 dbSNP
rs1445740797 3774 dbSNP
rs755289358 3776 dbSNP
rs779037410 3784 dbSNP
rs1352255019 3786 dbSNP
rs188105654 3797 dbSNP
rs74104287 3798 dbSNP
rs1461819166 3803 dbSNP
rs1190983222 3808 dbSNP
rs927986781 3808 dbSNP
rs1400967291 3816 dbSNP
rs1450224198 3817 dbSNP
rs1338403987 3821 dbSNP
rs1188294402 3824 dbSNP
rs1383504813 3825 dbSNP
rs114983573 3829 dbSNP
rs1214543471 3833 dbSNP
rs991313660 3837 dbSNP
rs1227386115 3839 dbSNP
rs1032334259 3843 dbSNP
rs1295691957 3852 dbSNP
rs557185636 3863 dbSNP
rs988160535 3867 dbSNP
rs4771890 3871 dbSNP
rs1324860388 3881 dbSNP
rs556749018 3896 dbSNP
rs1483018769 3897 dbSNP
rs941522139 3901 dbSNP
rs1165887566 3909 dbSNP
rs553316279 3913 dbSNP
rs1172436525 3915 dbSNP
rs1452726576 3916 dbSNP
rs1245319010 3918 dbSNP
rs918824311 3921 dbSNP
rs1194550982 3924 dbSNP
rs1462207763 3926 dbSNP
rs1248892022 3949 dbSNP
rs1188470030 3953 dbSNP
rs1195534655 3956 dbSNP
rs1481249461 3963 dbSNP
rs112553599 3964 dbSNP
rs541091055 3965 dbSNP
rs1047358016 3973 dbSNP
rs1302012217 3979 dbSNP
rs1170488996 3981 dbSNP
rs1234596205 3984 dbSNP
rs140618300 3988 dbSNP
rs191860325 3996 dbSNP
rs973081595 3999 dbSNP
rs920231702 4000 dbSNP
rs6492724 4008 dbSNP
rs781217855 4011 dbSNP
rs1309834393 4014 dbSNP
rs745678787 4019 dbSNP
rs1394592127 4021 dbSNP
rs543548773 4025 dbSNP
rs562109066 4032 dbSNP
rs563533978 4039 dbSNP
rs1174290581 4046 dbSNP
rs1455758727 4048 dbSNP
rs1434361309 4049 dbSNP
rs900291290 4052 dbSNP
rs1010677610 4076 dbSNP
rs1483633559 4077 dbSNP
rs1022126197 4080 dbSNP
rs1209392126 4081 dbSNP
rs949574691 4085 dbSNP
rs1047022193 4090 dbSNP
rs77725645 4096 dbSNP
rs1346498901 4098 dbSNP
rs999855672 4111 dbSNP
rs1237856062 4114 dbSNP
rs34520068 4121 dbSNP
rs868614733 4125 dbSNP
rs1412883853 4129 dbSNP
rs1221905197 4136 dbSNP
rs35199534 4140 dbSNP
rs969627966 4140 dbSNP
rs542872496 4141 dbSNP
rs961007778 4142 dbSNP
rs34977431 4146 dbSNP
rs527713188 4147 dbSNP
rs990873151 4156 dbSNP
rs1032574453 4162 dbSNP
rs1470611604 4169 dbSNP
rs893768108 4171 dbSNP
rs1009529631 4172 dbSNP
rs142195055 4176 dbSNP
rs1240899644 4179 dbSNP
rs769590873 4181 dbSNP
rs918767005 4182 dbSNP
rs775126840 4190 dbSNP
rs1204220826 4191 dbSNP
rs1281491543 4191 dbSNP
rs368270968 4194 dbSNP
rs1350884476 4197 dbSNP
rs1269802787 4205 dbSNP
rs1231157711 4211 dbSNP
rs1354578225 4216 dbSNP
rs528058916 4217 dbSNP
rs930204038 4218 dbSNP
rs1450101710 4221 dbSNP
rs1324793807 4223 dbSNP
rs1317666307 4225 dbSNP
rs762726343 4226 dbSNP
rs768189497 4230 dbSNP
rs1186651101 4236 dbSNP
rs773857219 4244 dbSNP
rs1266020806 4245 dbSNP
rs1461300437 4254 dbSNP
rs911533811 4271 dbSNP
rs1418995827 4274 dbSNP
rs1479292893 4274 dbSNP
rs964590655 4277 dbSNP
rs761258791 4286 dbSNP
rs1191778284 4287 dbSNP
rs1465072788 4290 dbSNP
rs1249585490 4296 dbSNP
rs551067436 4297 dbSNP
rs1429467458 4309 dbSNP
rs1456532370 4313 dbSNP
rs920515247 4317 dbSNP
rs1156604834 4318 dbSNP
rs1333957338 4325 dbSNP
rs950330491 4325 dbSNP
rs1229980747 4332 dbSNP
rs1346941691 4333 dbSNP
rs1269676875 4334 dbSNP
rs1447621505 4336 dbSNP
rs1454218677 4337 dbSNP
rs1038701224 4339 dbSNP
rs1289586790 4340 dbSNP
rs1344949592 4342 dbSNP
rs571262699 4348 dbSNP
rs766897746 4351 dbSNP
rs1395718751 4357 dbSNP
rs1167292257 4359 dbSNP
rs1408728773 4364 dbSNP
rs1419348007 4368 dbSNP
rs754306379 4370 dbSNP
rs773922638 4370 dbSNP
rs1391458993 4384 dbSNP
rs1191404870 4402 dbSNP
rs755170712 4404 dbSNP
rs916982507 4405 dbSNP
rs949865110 4406 dbSNP
rs1044165818 4412 dbSNP
rs1035360327 4413 dbSNP
rs1435859990 4414 dbSNP
rs1272272484 4420 dbSNP
rs1215064068 4431 dbSNP
rs530618510 4433 dbSNP
rs1223603106 4443 dbSNP
rs1301283545 4450 dbSNP
rs550699491 4454 dbSNP
rs1012235315 4455 dbSNP
rs1282572400 4464 dbSNP
rs12100322 4466 dbSNP
rs151221588 4475 dbSNP
rs962778821 4478 dbSNP
rs1432136915 4481 dbSNP
rs1217132603 4488 dbSNP
rs1371892896 4491 dbSNP
rs974157779 4493 dbSNP
rs760007976 4500 dbSNP
rs1453424499 4512 dbSNP
rs1425511625 4519 dbSNP
rs1489648675 4520 dbSNP
rs1192554085 4523 dbSNP
rs536470015 4527 dbSNP
rs1468451867 4528 dbSNP
rs951644673 4532 dbSNP
rs553277607 4552 dbSNP
rs765679118 4553 dbSNP
rs1009521391 4565 dbSNP
rs1269176570 4571 dbSNP
rs942996106 4588 dbSNP
rs1303753674 4589 dbSNP
rs1042394585 4596 dbSNP
rs921613352 4602 dbSNP
rs1409882425 4619 dbSNP
rs1401272807 4622 dbSNP
rs1374106486 4639 dbSNP
rs1164009036 4643 dbSNP
rs890532261 4644 dbSNP
rs1363565741 4651 dbSNP
rs1009371428 4654 dbSNP
rs1422857229 4658 dbSNP
rs1017709067 4659 dbSNP
rs964864448 4661 dbSNP
rs1407002536 4665 dbSNP
rs994681982 4671 dbSNP
rs1027568540 4672 dbSNP
rs902313676 4679 dbSNP
rs566634952 4681 dbSNP
rs1056321652 4682 dbSNP
rs950634583 4685 dbSNP
rs1483649185 4686 dbSNP
rs1257803817 4689 dbSNP
rs896390515 4691 dbSNP
rs1316496574 4693 dbSNP
rs1269166885 4705 dbSNP
rs1230694017 4710 dbSNP
rs1353937785 4717 dbSNP
rs983100041 4722 dbSNP
rs547895125 4725 dbSNP
rs1224632295 4734 dbSNP
rs898517746 4738 dbSNP
rs995563532 4744 dbSNP
rs971105788 4753 dbSNP
rs1428235692 4754 dbSNP
rs1344174032 4755 dbSNP
rs1159442961 4758 dbSNP
rs1458674147 4764 dbSNP
rs117358184 4768 dbSNP
rs1164176978 4774 dbSNP
rs980219784 4790 dbSNP
rs1258380565 4791 dbSNP
rs1184787797 4799 dbSNP
rs371276351 4804 dbSNP
rs2226078 4807 dbSNP
rs758708980 4809 dbSNP
rs938168842 4817 dbSNP
rs2226077 4821 dbSNP
rs1019816630 4827 dbSNP
rs1246191291 4831 dbSNP
rs751702286 4832 dbSNP
rs1323965183 4840 dbSNP
rs1314258909 4849 dbSNP
rs915475884 4853 dbSNP
rs1380097049 4855 dbSNP
rs1470392987 4862 dbSNP
rs1181027881 4867 dbSNP
rs1320870870 4905 dbSNP
rs183893861 4917 dbSNP
rs557044185 4933 dbSNP
rs1165596436 4937 dbSNP
rs140339832 4943 dbSNP
rs1370188368 4946 dbSNP
rs573861194 4952 dbSNP
rs921575379 4956 dbSNP
rs1409670227 4966 dbSNP
rs1390827776 4981 dbSNP
rs1190783026 4985 dbSNP
rs1042632571 4990 dbSNP
rs1327122345 4994 dbSNP
rs149383711 5001 dbSNP
rs1356434441 5011 dbSNP
rs1443410189 5017 dbSNP
rs1250188081 5019 dbSNP
rs1336455565 5019 dbSNP
rs542833626 5025 dbSNP
rs1248795864 5029 dbSNP
rs764072359 5031 dbSNP
rs1338195510 5032 dbSNP
rs1297643848 5040 dbSNP
rs1230190171 5041 dbSNP
rs1368264197 5043 dbSNP
rs1300158600 5051 dbSNP
rs1039497540 5052 dbSNP
rs979148834 5053 dbSNP
rs559924414 5059 dbSNP
rs900620842 5062 dbSNP
rs935134612 5063 dbSNP
rs994652658 5071 dbSNP
rs865973797 5073 dbSNP
rs1452810158 5078 dbSNP
rs1394781520 5082 dbSNP
rs1199837858 5091 dbSNP
rs1435334449 5092 dbSNP
rs917763456 5094 dbSNP
rs1195764525 5098 dbSNP
rs528772131 5102 dbSNP
rs1274751505 5107 dbSNP
rs552352563 5111 dbSNP
rs1206763235 5114 dbSNP
rs947928313 5117 dbSNP
rs545732498 5129 dbSNP
rs1332638029 5134 dbSNP
rs1304531227 5141 dbSNP
rs1462651952 5143 dbSNP
rs1350958776 5149 dbSNP
rs1309773806 5150 dbSNP
rs1433005773 5158 dbSNP
rs1184119452 5160 dbSNP
rs564680039 5163 dbSNP
rs1401561893 5166 dbSNP
rs530530723 5169 dbSNP
rs190116873 5172 dbSNP
rs1475130737 5173 dbSNP
rs140628512 5174 dbSNP
rs781133959 5174 dbSNP
rs1473208507 5186 dbSNP
rs1421973045 5194 dbSNP
rs1410712070 5195 dbSNP
rs1176239503 5196 dbSNP
rs1277244332 5197 dbSNP
rs1024227746 5210 dbSNP
rs1346609330 5220 dbSNP
rs1404344035 5222 dbSNP
rs971435256 5227 dbSNP
rs1047098313 5230 dbSNP
rs757363223 5233 dbSNP
rs1428066413 5234 dbSNP
rs1412829397 5235 dbSNP
rs1339982170 5236 dbSNP
rs781307344 5244 dbSNP
rs1398020945 5247 dbSNP
rs1034512136 5249 dbSNP
rs957142747 5253 dbSNP
rs560989785 5254 dbSNP
rs989594489 5255 dbSNP
rs1414608737 5258 dbSNP
rs915381049 5262 dbSNP
rs757338980 5263 dbSNP
rs1163441134 5264 dbSNP
rs964196691 5270 dbSNP
rs1236393822 5273 dbSNP
rs1187553254 5277 dbSNP
rs745840073 5288 dbSNP
rs997023572 5290 dbSNP
rs1021817097 5293 dbSNP
rs529845144 5308 dbSNP
rs945569258 5309 dbSNP
rs546464870 5310 dbSNP
rs912156499 5321 dbSNP
rs1261088925 5355 dbSNP
rs566696640 5360 dbSNP
rs979503986 5367 dbSNP
rs116278251 5368 dbSNP
rs956624098 5369 dbSNP
rs991940744 5381 dbSNP
rs917728846 5382 dbSNP
rs779122419 5384 dbSNP
rs569016080 5388 dbSNP
rs1478303198 5397 dbSNP
rs1198980167 5400 dbSNP
rs1044943930 5405 dbSNP
rs919839914 5410 dbSNP
rs1324230942 5416 dbSNP
rs1405292283 5418 dbSNP
rs779968324 5433 dbSNP
rs1165492465 5434 dbSNP
rs1473522932 5438 dbSNP
rs1387754685 5441 dbSNP
rs1471178625 5442 dbSNP
rs930683665 5446 dbSNP
rs1049190061 5448 dbSNP
rs1249677044 5452 dbSNP
rs1399433804 5452 dbSNP
rs1319798421 5453 dbSNP
rs1290564899 5459 dbSNP
rs886233622 5466 dbSNP
rs1337567171 5469 dbSNP
rs748970174 5470 dbSNP
rs1024633888 5474 dbSNP
rs552446465 5480 dbSNP
rs887121296 5482 dbSNP
rs1350813177 5503 dbSNP
rs1008702551 5507 dbSNP
rs1041144910 5508 dbSNP
rs1001590726 5509 dbSNP
rs1263326406 5515 dbSNP
rs1259911943 5516 dbSNP
rs1408675444 5518 dbSNP
rs1034048236 5521 dbSNP
rs150346033 5529 dbSNP
rs1167353686 5531 dbSNP
rs146586749 5532 dbSNP
rs1391706492 5536 dbSNP
rs559377471 5537 dbSNP
rs758519541 5539 dbSNP
rs557007353 5540 dbSNP
rs989834638 5542 dbSNP
rs1477596716 5545 dbSNP
rs1247025124 5549 dbSNP
rs1200940795 5550 dbSNP
rs1206822563 5551 dbSNP
rs1341267 5556 dbSNP
rs966818124 5561 dbSNP
rs978319220 5573 dbSNP
rs912129690 5591 dbSNP
rs34419754 5595 dbSNP
rs968933719 5599 dbSNP
rs1198724939 5608 dbSNP
rs1278516307 5609 dbSNP
rs536381710 5610 dbSNP
rs1031045509 5615 dbSNP
rs1276929086 5625 dbSNP
rs975412211 5626 dbSNP
rs1309170195 5635 dbSNP
rs1200082887 5636 dbSNP
rs921902730 5637 dbSNP
rs1173555760 5640 dbSNP
rs547755929 5647 dbSNP
rs1413504007 5654 dbSNP
rs773947575 5659 dbSNP
rs1425624889 5662 dbSNP
rs1363569180 5664 dbSNP
rs1471483390 5668 dbSNP
rs1288797191 5679 dbSNP
rs992264555 5689 dbSNP
rs917655447 5692 dbSNP
rs141284982 5696 dbSNP
rs761346658 5705 dbSNP
rs117212345 5714 dbSNP
rs1300695668 5725 dbSNP
rs772684550 5728 dbSNP
rs545338020 5729 dbSNP
rs1306111346 5736 dbSNP
rs1412175532 5750 dbSNP
rs886555944 5754 dbSNP
rs182038276 5756 dbSNP
rs138257215 5761 dbSNP
rs982740453 5767 dbSNP
rs1359445171 5771 dbSNP
rs940502519 5777 dbSNP
rs1280089914 5778 dbSNP
rs186636067 5780 dbSNP
rs1455485788 5782 dbSNP
rs1159862751 5800 dbSNP
rs1045593795 5802 dbSNP
rs908508024 5809 dbSNP
rs907103367 5810 dbSNP
rs1221895080 5811 dbSNP
rs944037602 5811 dbSNP
rs575285927 5816 dbSNP
rs1239491996 5823 dbSNP
rs771759989 5826 dbSNP
rs1207036038 5838 dbSNP
rs145006156 5839 dbSNP
rs1230787393 5857 dbSNP
rs1490918475 5859 dbSNP
rs1312622354 5863 dbSNP
rs892767201 5865 dbSNP
rs1249998915 5867 dbSNP
rs1011207421 5873 dbSNP
rs1436442512 5874 dbSNP
rs1379230958 5875 dbSNP
rs1019985808 5876 dbSNP
rs1304266887 5879 dbSNP
rs1432394161 5882 dbSNP
rs1387667210 5896 dbSNP
rs190649112 5902 dbSNP
rs1458755148 5910 dbSNP
rs775144091 5910 dbSNP
rs904692397 5921 dbSNP
rs1424525234 5930 dbSNP
rs1416017405 5934 dbSNP
rs1161197879 5944 dbSNP
rs1449028275 5947 dbSNP
rs1386557996 5948 dbSNP
rs576685100 5954 dbSNP
rs967141218 5956 dbSNP
rs1297267960 5961 dbSNP
rs1000087898 5964 dbSNP
rs999489437 5973 dbSNP
rs1265420542 5976 dbSNP
rs1031910284 5982 dbSNP
rs1392952541 5985 dbSNP
rs1321826165 5987 dbSNP
rs1019082531 5988 dbSNP
rs1331752873 5991 dbSNP
rs966626896 5993 dbSNP
rs896080353 5998 dbSNP
rs1313091231 6001 dbSNP
rs974981867 6020 dbSNP
rs1013250767 6022 dbSNP
rs1292910786 6029 dbSNP
rs1458313587 6031 dbSNP
rs922186370 6032 dbSNP
rs1166719693 6037 dbSNP
rs1429177551 6042 dbSNP
rs181800251 6047 dbSNP
rs546718946 6051 dbSNP
rs1197964266 6066 dbSNP
rs984826832 6069 dbSNP
rs907940682 6072 dbSNP
rs940816064 6073 dbSNP
rs879697524 6077 dbSNP
rs1026793016 6105 dbSNP
rs560041235 6110 dbSNP
rs775924027 6115 dbSNP
rs1245450994 6124 dbSNP
rs1046247370 6126 dbSNP
rs1274972768 6129 dbSNP
rs138786237 6131 dbSNP
rs1169089089 6138 dbSNP
rs983052112 6145 dbSNP
rs552152759 6151 dbSNP
rs1347386591 6152 dbSNP
rs6492725 6156 dbSNP
rs943994085 6160 dbSNP
rs367710928 6161 dbSNP
rs1169898611 6164 dbSNP
rs1171197959 6164 dbSNP
rs1464687928 6169 dbSNP
rs976714527 6169 dbSNP
rs1405077467 6171 dbSNP
rs1450104482 6174 dbSNP
rs1177157492 6175 dbSNP
rs1435274806 6177 dbSNP
rs1250322185 6181 dbSNP
rs1182066601 6182 dbSNP
rs1482467708 6183 dbSNP
rs149349236 6192 dbSNP
rs1011196016 6193 dbSNP
rs932699649 6194 dbSNP
rs1255043609 6196 dbSNP
rs1379740022 6199 dbSNP
rs1043141486 6204 dbSNP
rs1396705368 6208 dbSNP
rs1294901289 6209 dbSNP
rs748654701 6219 dbSNP
rs576555015 6220 dbSNP
rs1007952483 6222 dbSNP
rs1330913165 6229 dbSNP
rs1394515913 6248 dbSNP
rs934826168 6251 dbSNP
rs1303631492 6255 dbSNP
rs1471191223 6258 dbSNP
rs1053734876 6260 dbSNP
rs1159116697 6261 dbSNP
rs1412067593 6262 dbSNP
rs896060847 6265 dbSNP
rs1440179852 6272 dbSNP
rs1019783276 6274 dbSNP
rs966202232 6278 dbSNP
rs371926868 6289 dbSNP
rs1255100489 6307 dbSNP
rs1323294244 6307 dbSNP
rs1200644989 6308 dbSNP
rs1202114464 6309 dbSNP
rs996782210 6318 dbSNP
rs1329706943 6328 dbSNP
rs550544847 6328 dbSNP
rs1014520874 6331 dbSNP
rs751790289 6339 dbSNP
rs1242775803 6342 dbSNP
rs904876093 6343 dbSNP
rs1259040281 6349 dbSNP
rs1430000586 6350 dbSNP
rs1386939514 6356 dbSNP
rs546037598 6358 dbSNP
rs879334094 6360 dbSNP
rs757521080 6361 dbSNP
rs984777906 6363 dbSNP
rs907847681 6368 dbSNP
rs1161951183 6370 dbSNP
rs567369933 6374 dbSNP
rs1425943067 6375 dbSNP
rs1026724820 6380 dbSNP
rs767764921 6384 dbSNP
rs982634546 6385 dbSNP
rs544594278 6394 dbSNP
rs1207953095 6402 dbSNP
rs981510748 6404 dbSNP
rs1207959992 6407 dbSNP
rs1286319938 6407 dbSNP
rs1355776036 6436 dbSNP
rs1015879170 6437 dbSNP
rs928720929 6440 dbSNP
rs536302680 6441 dbSNP
rs1297121792 6450 dbSNP
rs1436337529 6463 dbSNP
rs1328530111 6470 dbSNP
rs1322180083 6479 dbSNP
rs1359709095 6486 dbSNP
rs1055593567 6499 dbSNP
rs556705389 6501 dbSNP
rs976640998 6507 dbSNP
rs1359965136 6515 dbSNP
rs921240767 6517 dbSNP
rs564549023 6519 dbSNP
rs954058787 6519 dbSNP
rs1187517892 6522 dbSNP
rs553443490 6525 dbSNP
rs1243596049 6528 dbSNP
rs1041633533 6540 dbSNP
rs533336643 6542 dbSNP
rs902807023 6545 dbSNP
rs943708477 6548 dbSNP
rs1450906885 6558 dbSNP
rs1290689933 6564 dbSNP
rs1224888672 6565 dbSNP
rs1340109240 6571 dbSNP
rs1345078050 6573 dbSNP
rs1222110345 6577 dbSNP
rs934774403 6584 dbSNP
rs1053256382 6591 dbSNP
rs1273381297 6596 dbSNP
rs1215698727 6609 dbSNP
rs773824861 6610 dbSNP
rs1332248091 6621 dbSNP
rs1259418583 6622 dbSNP
rs533399207 6624 dbSNP
rs1216636393 6625 dbSNP
rs1406294842 6629 dbSNP
rs1267767819 6637 dbSNP
rs1479232611 6638 dbSNP
rs1368128099 6643 dbSNP
rs1167612223 6648 dbSNP
rs1040790870 6650 dbSNP
rs1201375063 6653 dbSNP
rs899620000 6659 dbSNP
rs996325885 6662 dbSNP
rs1029193421 6664 dbSNP
rs1170527788 6666 dbSNP
rs576603394 6666 dbSNP
rs1477565130 6675 dbSNP
rs1269579050 6677 dbSNP
rs887959810 6681 dbSNP
rs1006455579 6692 dbSNP
rs1482130405 6696 dbSNP
rs1251109985 6704 dbSNP
rs1044678960 6706 dbSNP
rs1417456810 6710 dbSNP
rs1276763492 6716 dbSNP
rs1219070536 6718 dbSNP
rs1346126030 6719 dbSNP
rs1015187295 6728 dbSNP
rs962037904 6744 dbSNP
rs906145924 6752 dbSNP
rs75414664 6753 dbSNP
rs1306814725 6755 dbSNP
rs542486111 6756 dbSNP
rs201811452 6762 dbSNP
rs143838968 6770 dbSNP
rs984258133 6771 dbSNP
rs1298854405 6772 dbSNP
rs1429678274 6779 dbSNP
rs1004378877 6792 dbSNP
rs148162099 6793 dbSNP
rs1177920879 6801 dbSNP
rs1481652299 6816 dbSNP
rs1235997180 6824 dbSNP
rs965203548 6826 dbSNP
rs998029613 6840 dbSNP
rs1403322461 6848 dbSNP
rs1207408865 6852 dbSNP
rs368546157 6853 dbSNP
rs796483116 6853 dbSNP
rs1308337096 6856 dbSNP
rs991271527 6865 dbSNP
rs1223898785 6870 dbSNP
rs575602394 6882 dbSNP
rs954002259 6884 dbSNP
rs1282096169 6887 dbSNP
rs1172975326 6888 dbSNP
rs978722927 6891 dbSNP
rs925953529 6892 dbSNP
rs1305521974 6894 dbSNP
rs1338381571 6908 dbSNP
rs1455438630 6916 dbSNP
rs956107685 6930 dbSNP
rs1159717348 6931 dbSNP
rs914381661 6941 dbSNP
rs1181520831 6944 dbSNP
rs947223292 6951 dbSNP
rs1245363275 6953 dbSNP
rs917393957 6961 dbSNP
rs977272585 6979 dbSNP
rs114897263 6989 dbSNP
rs1218509261 6993 dbSNP
rs1318217776 6994 dbSNP
rs1398167467 6998 dbSNP
rs529271160 6998 dbSNP
rs1383158803 7005 dbSNP
rs1316703718 7009 dbSNP
rs544964109 7011 dbSNP
rs779799176 7016 dbSNP
rs1455240943 7044 dbSNP
rs1348224482 7045 dbSNP