miRTarBase - #MIRT174781 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RNF38   
Synonyms -
Description ring finger protein 38
Transcript NM_022781   
Other Transcripts NM_194328 , NM_194329 , NM_194330 , NM_194332   
Expression
Putative miRNA Targets on RNF38
3'UTR of RNF38
(miRNA target sites are highlighted)
>RNF38|NM_022781|3'UTR
   1 CCAACCTAAGAAGCACAAATTTAGTTTGGGTGTTCCTCATCACATGTATATACGGACTATCCATTGAACTTAATCTGTGT
  81 GGCTTCCAGCCCTCCCTTTACCAAAAGGGTCAATGGACCTTTCTTTGCACTGTGTGACTTAATCAACTATAAAAGCTTAC
 161 AATTAGTCTTCACAGTTATGGGATTGTTATACTAACCGTGTGATTGGAACTCCAAAGACTTTTTCTTTAGCTTAATTTTG
 241 TGTGTGCACTAACATTCCCTGGTTTTTGTGTGATCATTCCGAGTGTTGCTGCAAGATTACAGTGGACGTGATCTTTTAGC
 321 ATGTGCTTTTATAAAAAGTGGTAGCTACAGATGATATAGCAATCTACCTTATATAGAGCCTTCAGAAACTGTGAGTGGAA
 401 ATGAATGCGCAGCGTATGACTGTTGGTGATAAGTGTATCTGTGTGAGTGTGTGCAACTACTTGTGTGAGGGCATGGTAGC
 481 TAACGTGTGTATGAGATCCTATATACCAGCATGTACCAAGAATGTGTGTGTAGTTTTAATTATGCTGCAATGTATAATCT
 561 GGTGTGTTATTTAAACAGCACTAGTACTGTACACTGGTTTTTTTCCCTTGTGTTTGCTGTTGCACACTGATTGCTGAGGG
 641 TGCATCAATTACAAGCATTGAATACTCCATCCCCTTCCCTCCCAGTGAATGGAATGAGAAAAGCCTTCTTCCTTTGCTTC
 721 AGGCAGCTGTCACCTTCTCTTTATTGGTGGTCCTAAGTGGGTCACTTAAGAAAAAAAAGTGTAACAAATTCTCGCTCCAT
 801 GAACCTGGTTTTTTTTTATTCTGTTGTGGAAATTTTTAAATCTCCAACTTGCTGTTTCCAAAAAGAAGGTGCAATATCAT
 881 ATATCATCAGTTAGCAATATTAGCATTTCAATCAGTGATTTGAATGTTGATACTTTTTTTTCCTTTACATTTCCAGTAAG
 961 TTTCTTACAGAAAGTACCTGTGATTTTTTTTAATGTTTAGATTTGTAGTCTAGTCTATTCTGAAGATATTTGATTAATAT
1041 ATTTCTAAGAAGACCACTAGTCCCATGAAGTCTCACCTTGTTGACTTCCACCAGAACAAAACCTGTTAATTCAGCTTGAC
1121 TTCTCATATGTGTTCTGTGTTCAAGCTCCTGTGGGCAACTCAATTGTTTTAAGAAAACTCTATTTCTGTTCATATTAATT
1201 CACTTGCCAGACTCCAATTCTGAAAGTTGTCTAGTTCTTCCTTCATCACACGTGCTTCTCATCGAAACCCTGGTTTCAGG
1281 ATGGATCAAGTGCTGTTACAGCTCATGTTCCTTAGACCTGATTTGTTTTGATATTTTACTGCCTTTCCTTTTAATTTTTG
1361 TTTGAATGAGAAAAGTTTAATACAACAGGTGTCCAGAATACTTGCAGTATAAATGAAGATTTGGTTTTTGTATAAAAAAA
1441 TAATGCTGTTAAACAGGAGTTGACCTTCATTTAGTTGATGTAATACATAGCTGTATGGGGTTTTTTTTAGTAAGTTCTTT
1521 GAGCATAATTCACTTTAAAGTCATTTTTCCAGCAATGTTTAAATTACTTTCTCATTCTTTTAGTGTATTCAACATTGTCT
1601 GCCTCTTCCTGCAGTTGATGTAATTGCTTTGTTTGCAATAGCACAAGCTGCATTATTCCAGTCAGGACTGTGATAACTTG
1681 CTGCCAGCCCCACTCAACTTTCAGTTGGCTCTGTGTCAGTTTTCCATTCAGTGTTAACTACTTGTTACTGCCATGCTGCT
1761 TGCCCTCCCTTGAAGTGTCTATAAGCTCATCACAGCCTAGAGTTAAGTAAAGTCAATTCACAGAAGCACAATTTTGCCCT
1841 TTGCGAGACATTGTTGCCTCTATCTAGTCCTACAAGTAGGGTTTTGCATACTGTGTTTGCCCCTAGGGTTGTCAGTGCAT
1921 CAGAAATACTTCTAAATAGTGGTAAAAATGCACATGGTTAATGCACATGTTACTTTTAAATCATTAGGATATCCCTCACC
2001 TGTTCCTGATGAATAAAAAGTGTGTTAAAGACCAAAATTCTTGGCATAATAATCAGCTACATACAAATCACATATAGTTT
2081 AATCTTTTTTAATGAAAAAAAATCATGTTTAAAATGGCAAAAGCCCATCTTATACACTTTTATATAGCTGCAAAAAATTT
2161 ATATCTGTACAGATCTAACACTACGACACTCAGTATTCATTTTATTGAAGCATGCAAGTAAAGCACTTTTTCTAATTTAT
2241 ATAGAGGTATCTAATTAACACAGCACATTGTACTAATGACTAGGAGTAGCAGCTTTTTCTTCTCTCCCTCTATGAATTCT
2321 TATAATGTCCCTTTTTCTGTAAGTTTTTGAGAGGCAATTGGCAATTTAGGAGGCAGCAGGGTCTGTTTTGGTCAAATCTT
2401 GAATTTCGTTGTTGCACTCTAGTGACTGATCTTTGGGAATGTCTTGTCTTTGCATGGGGCTCATAGAGATGTGTGCAGAC
2481 TTGCTTATTGTGGTTAGTGTGTATCAGGAACACACACACAGGTGTTCTGACCAGCTCAGGCTTGCCACAGTGAGCAACTC
2561 TGTGGCTAGCAAAAGAGAAGTTTATTTGTGCCCAGCCATTGGTCACCTTGGGTGATGCACCAGATAGCAGGCAGATGTTG
2641 GTTCATTGGCCTTCGTCCTCTTTCCTCCTAAAATAATATTGGCTTTACCATCTTAACTCAGCTGTGGGTTTTTTGTGGGT
2721 TCTTGTTTGTTTTTTGGCATGAATTGTCATCTTTGGTGTTTTTTTAACCCCCAGCCCCTCAAAAAAATAAGGCCTCCAGG
2801 TATCAAGATCTCATATTAGGATTTTCTGTCCTTAATTTTTTGAGCAAAATCTGGAAAATGTGAAAGCATATTTAGATTTT
2881 ATATACTATCTGAAATGTGATTTGTTAAGATTCTTAAATTTGGGCCTCTTAGAATAATTTTGAATGAGATCTACCGACTC
2961 ACTTGTGAGAATATTTTTCACAGATTATCTTTGGGCCTTTTCATTAGAAAGCTGTTTGTTTGTCCCCCTGTTGGTACATT
3041 TGGTTACCTCATTTTGCCGTTTCAGATTGTGAAAGCTCACAGGGGTGTTTTTTGGAATCATTTGCTGAGTCATTTTCTCA
3121 AATCATATTCCATTGTATCAGTTAACATATAGTTTTAAATGTATGTATTATAAATATCTGTAACCAAATCATTTGAAGGC
3201 TTGATAAATTTTTAACAAAGTTTGTACATTTTTTATGAAAGTTACTAGTAATGCTTTACTAAGTAGTGCAATGAATTTTT
3281 ATTTTTAATCCCTGTGCCCAATTTTGGAGTTGAGAGGGTTGTTGGTAATAAATGTATGATGTACACTTAAAAAAAAAAAA
3361 AA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU-AC---ACGACGAu 5'
            | | :::||| ||   ||||||| 
Target 5' aaCTACTTGTTACTGCCATGCTGCTt 3'
1736 - 1761 152.00 -11.70
2
miRNA  3' guguUUGGUAA--UACACGACGAu 5'
              :|:||||  : |||:|||| 
Target 5' gtgtGATCATTCCGAGTGTTGCTg 3'
268 - 291 144.00 -14.70
3
miRNA  3' guguuuGGUAAUAC--ACGACGAu 5'
                || ||:||  |||||:| 
Target 5' ttttttCCCTTGTGTTTGCTGTTg 3'
599 - 622 142.00 -13.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30463069 29 COSMIC
COSN30168335 54 COSMIC
COSN26564749 62 COSMIC
COSN30536638 92 COSMIC
COSN30122051 116 COSMIC
COSN31607050 144 COSMIC
COSN4945295 175 COSMIC
COSN17183095 253 COSMIC
COSN26646408 307 COSMIC
COSN31585267 307 COSMIC
COSN30159241 408 COSMIC
COSN15694292 426 COSMIC
COSN8520568 629 COSMIC
COSN2514584 691 COSMIC
COSN31534172 808 COSMIC
COSN22119807 864 COSMIC
COSN31483232 927 COSMIC
COSN20106195 933 COSMIC
COSN20106194 983 COSMIC
COSN19432876 1026 COSMIC
COSN30538832 1032 COSMIC
COSN31567659 1069 COSMIC
COSN19656277 1072 COSMIC
COSN29416791 1139 COSMIC
COSN19468181 1695 COSMIC
COSN31603608 1752 COSMIC
COSN31570273 1884 COSMIC
COSN9283107 1900 COSMIC
COSN31516237 1985 COSMIC
COSN31520491 2040 COSMIC
COSN31515351 2082 COSMIC
COSN20106190 2094 COSMIC
COSN26548769 2175 COSMIC
COSN31557892 2232 COSMIC
COSN5703353 2332 COSMIC
COSN28706645 2403 COSMIC
COSN31512865 2408 COSMIC
COSN6390287 2798 COSMIC
COSN31480488 2946 COSMIC
COSN5703352 2965 COSMIC
COSN31596232 3123 COSMIC
COSN31608046 3207 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1258681563 1 dbSNP
rs1275148314 2 dbSNP
rs760218308 4 dbSNP
rs1341181322 5 dbSNP
rs571616511 10 dbSNP
rs200646561 11 dbSNP
rs1289405658 13 dbSNP
rs749811942 15 dbSNP
rs1180723459 16 dbSNP
rs1253679337 17 dbSNP
rs1385321396 18 dbSNP
rs773380104 21 dbSNP
rs1429968116 22 dbSNP
rs770256448 24 dbSNP
rs1324764946 25 dbSNP
rs1188776201 26 dbSNP
rs1320356819 26 dbSNP
rs748363779 33 dbSNP
rs781609645 34 dbSNP
rs373555424 38 dbSNP
rs1428214707 43 dbSNP
rs747039180 45 dbSNP
rs544904345 52 dbSNP
rs79193527 53 dbSNP
rs1465638356 59 dbSNP
rs534719661 61 dbSNP
rs1011536384 63 dbSNP
rs893409105 78 dbSNP
rs1436166940 88 dbSNP
rs1297139911 90 dbSNP
rs567183971 93 dbSNP
rs1053333510 95 dbSNP
rs1225827909 103 dbSNP
rs934842682 108 dbSNP
rs372003346 109 dbSNP
rs750685968 113 dbSNP
rs1040841789 114 dbSNP
rs1276921213 123 dbSNP
rs1253783625 126 dbSNP
rs878899923 129 dbSNP
rs1486552079 146 dbSNP
rs1225554809 149 dbSNP
rs774631272 154 dbSNP
rs919097121 158 dbSNP
rs976404347 160 dbSNP
rs1195850961 162 dbSNP
rs1426279211 166 dbSNP
rs943780130 173 dbSNP
rs910940946 174 dbSNP
rs1174560441 179 dbSNP
rs910197636 181 dbSNP
rs985534903 190 dbSNP
rs1386664184 191 dbSNP
rs1432671958 193 dbSNP
rs930958380 196 dbSNP
rs529399904 197 dbSNP
rs765399702 198 dbSNP
rs1299094876 200 dbSNP
rs567454592 204 dbSNP
rs1330604872 213 dbSNP
rs956829507 215 dbSNP
rs1334586134 219 dbSNP
rs1035233909 225 dbSNP
rs1267139129 225 dbSNP
rs866628481 226 dbSNP
rs1247715172 228 dbSNP
rs1189988624 229 dbSNP
rs1488357194 229 dbSNP
rs1469187906 238 dbSNP
rs1410729433 240 dbSNP
rs1472970787 242 dbSNP
rs1402684866 248 dbSNP
rs1158468568 260 dbSNP
rs1174045202 261 dbSNP
rs1409808315 268 dbSNP
rs961218043 274 dbSNP
rs1035925304 280 dbSNP
rs1350317209 281 dbSNP
rs1045452528 304 dbSNP
rs150397812 307 dbSNP
rs530775720 308 dbSNP
rs1241885447 321 dbSNP
rs1228902642 322 dbSNP
rs970548649 330 dbSNP
rs1326446969 331 dbSNP
rs1229743883 341 dbSNP
rs202023965 356 dbSNP
rs111790358 357 dbSNP
rs1281168695 360 dbSNP
rs1023024890 364 dbSNP
rs1219759398 367 dbSNP
rs1012003144 372 dbSNP
rs1483690683 379 dbSNP
rs1182059975 387 dbSNP
rs930086296 392 dbSNP
rs773212197 394 dbSNP
rs1164051266 395 dbSNP
rs1413268562 396 dbSNP
rs1404586521 406 dbSNP
rs919087165 408 dbSNP
rs371744534 409 dbSNP
rs944603166 411 dbSNP
rs544984571 412 dbSNP
rs1348092483 413 dbSNP
rs776577559 414 dbSNP
rs1355159043 425 dbSNP
rs1380709692 427 dbSNP
rs986467183 435 dbSNP
rs1343302814 437 dbSNP
rs764175162 437 dbSNP
rs967652435 437 dbSNP
rs186172975 439 dbSNP
rs140458880 441 dbSNP
rs760583666 443 dbSNP
rs987847509 444 dbSNP
rs1236948365 446 dbSNP
rs1336000786 446 dbSNP
rs956488463 446 dbSNP
rs1407995084 449 dbSNP
rs1190744325 450 dbSNP
rs559935162 450 dbSNP
rs1391857813 453 dbSNP
rs1394329715 454 dbSNP
rs999102969 454 dbSNP
rs1003735611 456 dbSNP
rs148323582 459 dbSNP
rs1415712289 460 dbSNP
rs902048351 463 dbSNP
rs1339343202 467 dbSNP
rs1445428162 471 dbSNP
rs1023859099 472 dbSNP
rs1040953198 478 dbSNP
rs943512067 483 dbSNP
rs1296071299 484 dbSNP
rs547185337 485 dbSNP
rs1168815139 487 dbSNP
rs183043790 491 dbSNP
rs931008950 493 dbSNP
rs919575547 499 dbSNP
rs571863864 501 dbSNP
rs1036943131 502 dbSNP
rs1473418459 503 dbSNP
rs939948343 505 dbSNP
rs1248820541 506 dbSNP
rs928530204 509 dbSNP
rs1180160332 512 dbSNP
rs981699520 522 dbSNP
rs1437592364 527 dbSNP
rs1371096241 532 dbSNP
rs969887019 532 dbSNP
rs1173072898 541 dbSNP
rs1207603201 549 dbSNP
rs190756025 550 dbSNP
rs577889955 559 dbSNP
rs1322151509 561 dbSNP
rs901281574 562 dbSNP
rs879633789 564 dbSNP
rs1434863053 568 dbSNP
rs1291151321 570 dbSNP
rs1333179273 574 dbSNP
rs1246789306 581 dbSNP
rs1234689780 583 dbSNP
rs1274715482 584 dbSNP
rs558046275 604 dbSNP
rs944528900 605 dbSNP
rs1269046101 608 dbSNP
rs888955523 610 dbSNP
rs1207031105 612 dbSNP
rs186414635 619 dbSNP
rs946673557 620 dbSNP
rs1199496225 624 dbSNP
rs1376940125 632 dbSNP
rs914901359 636 dbSNP
rs1479182219 645 dbSNP
rs987795157 648 dbSNP
rs1308366255 649 dbSNP
rs935061549 652 dbSNP
rs1456433232 654 dbSNP
rs1286752378 661 dbSNP
rs1393335136 662 dbSNP
rs927709435 665 dbSNP
rs998824703 682 dbSNP
rs966700109 704 dbSNP
rs750213032 706 dbSNP
rs781004102 707 dbSNP
rs772030889 720 dbSNP
rs1008155441 724 dbSNP
rs572087938 732 dbSNP
rs769884326 735 dbSNP
rs540458893 738 dbSNP
rs1226861086 739 dbSNP
rs1328555098 739 dbSNP
rs889278779 742 dbSNP
rs1049966466 743 dbSNP
rs1358217851 751 dbSNP
rs530268490 752 dbSNP
rs757164903 753 dbSNP
rs1025634892 757 dbSNP
rs368108526 760 dbSNP
rs1405438142 765 dbSNP
rs1416653629 766 dbSNP
rs1157366330 767 dbSNP
rs1036659057 768 dbSNP
rs1470041000 770 dbSNP
rs1252999819 771 dbSNP
rs1251992502 773 dbSNP
rs774242134 773 dbSNP
rs1471940148 779 dbSNP
rs1156517157 783 dbSNP
rs1184714344 785 dbSNP
rs1458767511 790 dbSNP
rs1489937805 791 dbSNP
rs7863199 794 dbSNP
rs1349950438 798 dbSNP
rs550434140 799 dbSNP
rs867502520 800 dbSNP
rs1007387581 805 dbSNP
rs888951614 809 dbSNP
rs948582308 816 dbSNP
rs181802752 817 dbSNP
rs200703721 818 dbSNP
rs946622379 818 dbSNP
rs1349777652 821 dbSNP
rs990264910 824 dbSNP
rs1207218160 829 dbSNP
rs755636934 830 dbSNP
rs35212434 838 dbSNP
rs747581881 840 dbSNP
rs1229986285 849 dbSNP
rs780509616 852 dbSNP
rs1174934594 854 dbSNP
rs758812262 859 dbSNP
rs550720801 860 dbSNP
rs1424083001 866 dbSNP
rs977439026 869 dbSNP
rs1383847917 872 dbSNP
rs1431939235 874 dbSNP
rs1169793148 878 dbSNP
rs1302125869 879 dbSNP
rs1460555420 882 dbSNP
rs1304700657 883 dbSNP
rs1436694865 889 dbSNP
rs927626584 890 dbSNP
rs966045291 890 dbSNP
rs1380325824 900 dbSNP
rs1230283892 903 dbSNP
rs1019643740 911 dbSNP
rs1341421543 913 dbSNP
rs916744065 915 dbSNP
rs947832009 915 dbSNP
rs1483287153 925 dbSNP
rs1199526416 928 dbSNP
rs750816794 932 dbSNP
rs1240817362 933 dbSNP
rs953713203 937 dbSNP
rs1400652291 941 dbSNP
rs1025873684 942 dbSNP
rs1178865191 942 dbSNP
rs1189569786 942 dbSNP
rs535857199 942 dbSNP
rs952876019 942 dbSNP
rs1359822476 944 dbSNP
rs1465558465 945 dbSNP
rs972989998 947 dbSNP
rs965368553 949 dbSNP
rs1027787039 956 dbSNP
rs1428915042 966 dbSNP
rs1020072081 978 dbSNP
rs1321038795 982 dbSNP
rs1006966752 992 dbSNP
rs1222318204 992 dbSNP
rs1361000003 992 dbSNP
rs144549185 992 dbSNP
rs398113456 992 dbSNP
rs570114446 992 dbSNP
rs1192016437 995 dbSNP
rs1466006398 996 dbSNP
rs954298679 1001 dbSNP
rs1028764997 1005 dbSNP
rs1489565048 1008 dbSNP
rs1240433648 1009 dbSNP
rs1010669301 1012 dbSNP
rs994926057 1017 dbSNP
rs1215081193 1018 dbSNP
rs1464429666 1020 dbSNP
rs898267233 1021 dbSNP
rs1458022005 1024 dbSNP
rs1158697140 1025 dbSNP
rs375168174 1029 dbSNP
rs1428307317 1033 dbSNP
rs1210397812 1035 dbSNP
rs1295239607 1040 dbSNP
rs1368164503 1051 dbSNP
rs1404225094 1054 dbSNP
rs1280865505 1058 dbSNP
rs1228631686 1059 dbSNP
rs1330585359 1059 dbSNP
rs1052268763 1065 dbSNP
rs1003861772 1071 dbSNP
rs1321184571 1071 dbSNP
rs189206560 1072 dbSNP
rs1046098037 1081 dbSNP
rs906193148 1086 dbSNP
rs1219457445 1092 dbSNP
rs1254159435 1093 dbSNP
rs745658497 1097 dbSNP
rs1369219338 1099 dbSNP
rs948654748 1108 dbSNP
rs1472919193 1116 dbSNP
rs1267958726 1123 dbSNP
rs1429408290 1124 dbSNP
rs1405997890 1130 dbSNP
rs894352070 1135 dbSNP
rs550451315 1137 dbSNP
rs1350228885 1139 dbSNP
rs1424000860 1141 dbSNP
rs1323115456 1142 dbSNP
rs1301210843 1143 dbSNP
rs1468653216 1143 dbSNP
rs1405849443 1144 dbSNP
rs779310327 1147 dbSNP
rs1351814721 1151 dbSNP
rs1054294980 1161 dbSNP
rs185921172 1163 dbSNP
rs1278623371 1164 dbSNP
rs1435137870 1178 dbSNP
rs947813912 1181 dbSNP
rs199773884 1182 dbSNP
rs1291115069 1188 dbSNP
rs1186069581 1203 dbSNP
rs551678910 1214 dbSNP
rs1318735715 1215 dbSNP
rs537122494 1217 dbSNP
rs1277316819 1221 dbSNP
rs931436039 1223 dbSNP
rs1181121940 1225 dbSNP
rs1190471302 1230 dbSNP
rs1231215633 1231 dbSNP
rs977491152 1232 dbSNP
rs765570241 1239 dbSNP
rs145075232 1240 dbSNP
rs1443723278 1245 dbSNP
rs530864871 1245 dbSNP
rs1161620608 1249 dbSNP
rs966047703 1251 dbSNP
rs778844316 1252 dbSNP
rs912551103 1263 dbSNP
rs1236863256 1264 dbSNP
rs1365321033 1268 dbSNP
rs1449867117 1268 dbSNP
rs41277103 1270 dbSNP
rs953657784 1276 dbSNP
rs954088063 1292 dbSNP
rs754074103 1293 dbSNP
rs528936483 1295 dbSNP
rs548137674 1299 dbSNP
rs1467893462 1316 dbSNP
rs973554166 1317 dbSNP
rs962171652 1318 dbSNP
rs957825805 1324 dbSNP
rs563262081 1329 dbSNP
rs529666876 1330 dbSNP
rs906468838 1331 dbSNP
rs1003961498 1335 dbSNP
rs906895631 1343 dbSNP
rs1046331457 1348 dbSNP
rs756119692 1352 dbSNP
rs1442774484 1353 dbSNP
rs1255379702 1358 dbSNP
rs1182275390 1363 dbSNP
rs1404849025 1365 dbSNP
rs577803338 1367 dbSNP
rs894821665 1370 dbSNP
rs1366360382 1376 dbSNP
rs1227426121 1379 dbSNP
rs1023980104 1380 dbSNP
rs1347247923 1382 dbSNP
rs1219847173 1389 dbSNP
rs1262559364 1394 dbSNP
rs1484100589 1395 dbSNP
rs1012959071 1405 dbSNP
rs1048134941 1406 dbSNP
rs564370136 1409 dbSNP
rs1447300160 1411 dbSNP
rs559553045 1414 dbSNP
rs1342349810 1415 dbSNP
rs1240231091 1424 dbSNP
rs1054346778 1429 dbSNP
rs1176570933 1432 dbSNP
rs1276172699 1433 dbSNP
rs935850482 1434 dbSNP
rs78254954 1440 dbSNP
rs1160917579 1441 dbSNP
rs903001941 1441 dbSNP
rs1381949713 1442 dbSNP
rs1389847811 1442 dbSNP
rs1316882526 1454 dbSNP
rs1333372748 1462 dbSNP
rs117301940 1465 dbSNP
rs1282794249 1472 dbSNP
rs1321503820 1479 dbSNP
rs775614317 1496 dbSNP
rs1230470806 1497 dbSNP
rs1041863495 1500 dbSNP
rs944802540 1501 dbSNP
rs985740945 1502 dbSNP
rs1453302694 1504 dbSNP
rs954010530 1508 dbSNP
rs1267636095 1509 dbSNP
rs914575904 1509 dbSNP
rs1372630555 1516 dbSNP
rs767588777 1520 dbSNP
rs780697341 1521 dbSNP
rs759509426 1523 dbSNP
rs1161828096 1525 dbSNP
rs931945738 1527 dbSNP
rs1157244811 1534 dbSNP
rs1424066873 1540 dbSNP
rs1393312441 1549 dbSNP
rs181493270 1549 dbSNP
rs1303007637 1552 dbSNP
rs956155191 1555 dbSNP
rs1411690198 1561 dbSNP
rs1030775688 1562 dbSNP
rs973605067 1567 dbSNP
rs962222556 1573 dbSNP
rs1015035525 1577 dbSNP
rs1425443217 1580 dbSNP
rs762039644 1585 dbSNP
rs577121838 1587 dbSNP
rs1358194904 1592 dbSNP
rs1181112648 1608 dbSNP
rs755677351 1632 dbSNP
rs115120482 1638 dbSNP
rs1012169353 1639 dbSNP
rs894811762 1646 dbSNP
rs1026686894 1650 dbSNP
rs1024453818 1660 dbSNP
rs1012599064 1665 dbSNP
rs72731446 1670 dbSNP
rs1265463494 1673 dbSNP
rs1179221159 1677 dbSNP
rs1370571216 1681 dbSNP
rs1445558920 1682 dbSNP
rs796635772 1698 dbSNP
rs1364205247 1702 dbSNP
rs1432131827 1704 dbSNP
rs1036800848 1708 dbSNP
rs1395842228 1711 dbSNP
rs1315594881 1719 dbSNP
rs1288182541 1725 dbSNP
rs7034595 1727 dbSNP
rs903053170 1728 dbSNP
rs1246375705 1729 dbSNP
rs571498972 1731 dbSNP
rs1050390974 1738 dbSNP
rs1230507060 1739 dbSNP
rs1251453834 1740 dbSNP
rs752094783 1748 dbSNP
rs539967314 1765 dbSNP
rs914562930 1767 dbSNP
rs1009122872 1781 dbSNP
rs207470216 1785 dbSNP
rs547373849 1786 dbSNP
rs1183405476 1788 dbSNP
rs571462835 1791 dbSNP
rs551642748 1797 dbSNP
rs981556895 1809 dbSNP
rs1171724493 1813 dbSNP
rs1372581690 1817 dbSNP
rs1460476581 1821 dbSNP
rs1304831153 1826 dbSNP
rs1158234694 1829 dbSNP
rs542397751 1831 dbSNP
rs1452164406 1838 dbSNP
rs970928754 1844 dbSNP
rs1413780827 1847 dbSNP
rs534873553 1848 dbSNP
rs1216262928 1849 dbSNP
rs1296141101 1850 dbSNP
rs73648735 1851 dbSNP
rs1432171609 1852 dbSNP
rs1257216120 1856 dbSNP
rs759184303 1862 dbSNP
rs1202623759 1863 dbSNP
rs920591847 1872 dbSNP
rs1241753421 1878 dbSNP
rs1037949832 1882 dbSNP
rs1466477167 1887 dbSNP
rs940953229 1888 dbSNP
rs1261583088 1898 dbSNP
rs548936451 1899 dbSNP
rs1178387982 1902 dbSNP
rs1211095832 1904 dbSNP
rs959304156 1905 dbSNP
rs1026632835 1912 dbSNP
rs1403655523 1915 dbSNP
rs1485216971 1917 dbSNP
rs1268025377 1919 dbSNP
rs1432581786 1921 dbSNP
rs982322384 1929 dbSNP
rs971276475 1937 dbSNP
rs1289408776 1938 dbSNP
rs1209807350 1946 dbSNP
rs1331688455 1950 dbSNP
rs1361241370 1951 dbSNP
rs1380431513 1961 dbSNP
rs368313152 1962 dbSNP
rs758908255 1966 dbSNP
rs1331836479 1976 dbSNP
rs374603966 1977 dbSNP
rs1032671691 1983 dbSNP
rs1015723247 1987 dbSNP
rs896837007 1987 dbSNP
rs1485211885 1989 dbSNP
rs549446419 1997 dbSNP
rs1193423264 2003 dbSNP
rs1269704498 2005 dbSNP
rs999829532 2005 dbSNP
rs1480119049 2007 dbSNP
rs1386408941 2011 dbSNP
rs1319780891 2017 dbSNP
rs1414418423 2020 dbSNP
rs1007978366 2021 dbSNP
rs532911111 2025 dbSNP
rs1170536591 2031 dbSNP
rs1344368777 2037 dbSNP
rs1465286977 2044 dbSNP
rs1377841002 2048 dbSNP
rs1200424318 2052 dbSNP
rs1451624642 2056 dbSNP
rs1304806343 2064 dbSNP
rs34507367 2067 dbSNP
rs1020591531 2069 dbSNP
rs1403740809 2070 dbSNP
rs1246828188 2072 dbSNP
rs1189813874 2075 dbSNP
rs1223981354 2079 dbSNP
rs1315436549 2082 dbSNP
rs754448557 2082 dbSNP
rs1008760451 2084 dbSNP
rs1049957536 2086 dbSNP
rs1261674125 2087 dbSNP
rs1490216910 2088 dbSNP
rs1220408763 2091 dbSNP
rs1254046013 2094 dbSNP
rs932887721 2099 dbSNP
rs1054649984 2103 dbSNP
rs147870982 2103 dbSNP
rs893367416 2103 dbSNP
rs1366069020 2104 dbSNP
rs1423892543 2106 dbSNP
rs564333951 2108 dbSNP
rs762639713 2110 dbSNP
rs1200224471 2111 dbSNP
rs774755971 2120 dbSNP
rs1355768656 2123 dbSNP
rs779203343 2126 dbSNP
rs1346057629 2127 dbSNP
rs1248574455 2129 dbSNP
rs200384701 2133 dbSNP
rs1257947800 2136 dbSNP
rs375988686 2140 dbSNP
rs528254982 2140 dbSNP
rs950197087 2144 dbSNP
rs1438398990 2150 dbSNP
rs917731023 2154 dbSNP
rs1231343557 2158 dbSNP
rs990673905 2158 dbSNP
rs1185238360 2159 dbSNP
rs1385609520 2161 dbSNP
rs1444005051 2163 dbSNP
rs1161526142 2165 dbSNP
rs1298370295 2174 dbSNP
rs1435745013 2175 dbSNP
rs1352445200 2181 dbSNP
rs899221156 2183 dbSNP
rs527955521 2184 dbSNP
rs754043787 2185 dbSNP
rs919812163 2186 dbSNP
rs562257684 2191 dbSNP
rs1451098662 2192 dbSNP
rs1395206113 2195 dbSNP
rs1402536883 2211 dbSNP
rs973991754 2218 dbSNP
rs542543231 2219 dbSNP
rs576334070 2223 dbSNP
rs1214018003 2224 dbSNP
rs10972862 2232 dbSNP
rs1270930154 2232 dbSNP
rs1173994792 2234 dbSNP
rs556566462 2241 dbSNP
rs940674531 2245 dbSNP
rs146593726 2249 dbSNP
rs1168605178 2254 dbSNP
rs1243738386 2259 dbSNP
rs1451937829 2262 dbSNP
rs1008383190 2263 dbSNP
rs1420812971 2267 dbSNP
rs955176485 2270 dbSNP
rs1176625981 2278 dbSNP
rs1028510795 2281 dbSNP
rs10972861 2283 dbSNP
rs1443331428 2284 dbSNP
rs1258641897 2286 dbSNP
rs577424657 2287 dbSNP
rs1047075236 2288 dbSNP
rs764508991 2288 dbSNP
rs996943351 2291 dbSNP
rs893316387 2292 dbSNP
rs1268552032 2295 dbSNP
rs764352860 2299 dbSNP
rs1054597165 2300 dbSNP
rs1224369092 2302 dbSNP
rs768398046 2302 dbSNP
rs1262692749 2304 dbSNP
rs1322589741 2305 dbSNP
rs999103421 2308 dbSNP
rs903175853 2310 dbSNP
rs1045760732 2311 dbSNP
rs557938793 2312 dbSNP
rs1260421938 2314 dbSNP
rs1199728576 2322 dbSNP
rs1481101435 2322 dbSNP
rs534834152 2323 dbSNP
rs1428119788 2327 dbSNP
rs950158910 2327 dbSNP
rs371953753 2345 dbSNP
rs559193950 2345 dbSNP
rs1386115798 2347 dbSNP
rs1400706033 2349 dbSNP
rs3209858 2353 dbSNP
rs1055901107 2354 dbSNP
rs565932143 2356 dbSNP
rs919758051 2357 dbSNP
rs1282690048 2363 dbSNP
rs1343922382 2367 dbSNP
rs973981869 2368 dbSNP
rs916733123 2369 dbSNP
rs1281134053 2385 dbSNP
rs1344280335 2389 dbSNP
rs1282335186 2392 dbSNP
rs532479194 2407 dbSNP
rs958452794 2408 dbSNP
rs555359698 2415 dbSNP
rs1490707191 2416 dbSNP
rs1340881563 2419 dbSNP
rs1267530707 2420 dbSNP
rs908189142 2431 dbSNP
rs1183530706 2436 dbSNP
rs925654552 2437 dbSNP
rs368518927 2443 dbSNP
rs1369542336 2447 dbSNP
rs1387676297 2451 dbSNP
rs1425819313 2451 dbSNP
rs1027997686 2452 dbSNP
rs967021226 2453 dbSNP
rs1329726432 2459 dbSNP
rs1336156133 2462 dbSNP
rs1020224043 2464 dbSNP
rs1238012816 2465 dbSNP
rs1306772233 2466 dbSNP
rs1361567742 2466 dbSNP
rs1009227414 2470 dbSNP
rs1431068434 2471 dbSNP
rs1290489698 2478 dbSNP
rs1487181316 2480 dbSNP
rs957533111 2483 dbSNP
rs767641909 2484 dbSNP
rs1412321876 2487 dbSNP
rs1436831579 2488 dbSNP
rs1177212200 2490 dbSNP
rs41277101 2496 dbSNP
rs576100277 2500 dbSNP
rs1163427396 2505 dbSNP
rs1366808183 2507 dbSNP
rs1473388261 2511 dbSNP
rs995925349 2515 dbSNP
rs899272095 2517 dbSNP
rs762775474 2521 dbSNP
rs1016275873 2522 dbSNP
rs1482891640 2527 dbSNP
rs1384722199 2529 dbSNP
rs1453293001 2530 dbSNP
rs1314234071 2531 dbSNP
rs1252771842 2546 dbSNP
rs1319436411 2552 dbSNP
rs1207444939 2555 dbSNP
rs1251359434 2557 dbSNP
rs144426829 2561 dbSNP
rs189852175 2564 dbSNP
rs1289196295 2565 dbSNP
rs1245356205 2566 dbSNP
rs75462814 2569 dbSNP
rs930752300 2570 dbSNP
rs1356895863 2576 dbSNP
rs547547800 2577 dbSNP
rs1194059804 2581 dbSNP
rs1372567739 2583 dbSNP
rs1178771778 2584 dbSNP
rs1464324803 2584 dbSNP
rs1046685810 2585 dbSNP
rs1285791912 2593 dbSNP
rs527863664 2597 dbSNP
rs1038237935 2598 dbSNP
rs1376944230 2601 dbSNP
rs1383837364 2607 dbSNP
rs1226339778 2608 dbSNP
rs562333797 2615 dbSNP
rs1339189487 2616 dbSNP
rs1216421498 2620 dbSNP
rs895366237 2620 dbSNP
rs111399567 2621 dbSNP
rs766155511 2624 dbSNP
rs1203481237 2626 dbSNP
rs532070600 2628 dbSNP
rs184743308 2630 dbSNP
rs925720403 2631 dbSNP
rs978488559 2637 dbSNP
rs1487172279 2641 dbSNP
rs945771471 2644 dbSNP
rs1206236500 2654 dbSNP
rs912880369 2655 dbSNP
rs987130602 2664 dbSNP
rs987118043 2669 dbSNP
rs1201901923 2672 dbSNP
rs933633224 2677 dbSNP
rs116185342 2679 dbSNP
rs748082883 2679 dbSNP
rs957149226 2684 dbSNP
rs1406473923 2685 dbSNP
rs1359368964 2686 dbSNP
rs374508011 2687 dbSNP
rs1284615949 2690 dbSNP
rs1345808770 2693 dbSNP
rs762779270 2704 dbSNP
rs1218267115 2709 dbSNP
rs1028884909 2710 dbSNP
rs1157457299 2715 dbSNP
rs974563153 2720 dbSNP
rs1472456218 2725 dbSNP
rs1299728478 2730 dbSNP
rs977592672 2733 dbSNP
rs1184655991 2737 dbSNP
rs865983734 2739 dbSNP
rs772791422 2740 dbSNP
rs1024523962 2748 dbSNP
rs1016328649 2751 dbSNP
rs1269676614 2752 dbSNP
rs1490266621 2755 dbSNP
rs1014921573 2766 dbSNP
rs149661091 2771 dbSNP
rs886476703 2772 dbSNP
rs1159780712 2777 dbSNP
rs1379662084 2788 dbSNP
rs1222386150 2792 dbSNP
rs1304493224 2793 dbSNP
rs1034384004 2796 dbSNP
rs41277099 2797 dbSNP
rs1291373644 2798 dbSNP
rs1376012465 2800 dbSNP
rs1452172189 2805 dbSNP
rs769459947 2808 dbSNP
rs1308960904 2809 dbSNP
rs540757371 2810 dbSNP
rs1352224844 2812 dbSNP
rs1292592783 2819 dbSNP
rs34231879 2819 dbSNP
rs899270770 2819 dbSNP
rs1243055851 2826 dbSNP
rs1321135146 2826 dbSNP
rs1219668134 2828 dbSNP
rs1234774601 2830 dbSNP
rs1206637960 2842 dbSNP
rs1481066626 2842 dbSNP
rs770149696 2846 dbSNP
rs1177624224 2855 dbSNP
rs572127625 2858 dbSNP
rs761387428 2860 dbSNP
rs1036868996 2862 dbSNP
rs1385330211 2863 dbSNP
rs1328245086 2865 dbSNP
rs1162297717 2868 dbSNP
rs1288703442 2870 dbSNP
rs1442465431 2872 dbSNP
rs35533603 2878 dbSNP
rs1331172257 2881 dbSNP
rs776129935 2889 dbSNP
rs1455063791 2892 dbSNP
rs1316283986 2901 dbSNP
rs886945439 2915 dbSNP
rs1226719008 2922 dbSNP
rs756277317 2932 dbSNP
rs748272289 2948 dbSNP
rs936845421 2951 dbSNP
rs1198249661 2953 dbSNP
rs1257199058 2954 dbSNP
rs920918361 2955 dbSNP
rs904020373 2956 dbSNP
rs1472409104 2960 dbSNP
rs935688618 2962 dbSNP
rs1042861716 2982 dbSNP
rs1410185656 2983 dbSNP
rs945792754 2983 dbSNP
rs1436536743 2992 dbSNP
rs1398583402 2996 dbSNP
rs561061951 3013 dbSNP
rs1337762980 3017 dbSNP
rs1319158310 3018 dbSNP
rs1446450002 3022 dbSNP
rs1362673743 3024 dbSNP
rs542269145 3024 dbSNP
rs1218268449 3025 dbSNP
rs1024931421 3026 dbSNP
rs987559738 3027 dbSNP
rs555585345 3029 dbSNP
rs1389853204 3036 dbSNP
rs932971794 3038 dbSNP
rs1279051947 3053 dbSNP
rs921883676 3056 dbSNP
rs1441834988 3059 dbSNP
rs192795804 3069 dbSNP
rs1243358654 3070 dbSNP
rs139488436 3075 dbSNP
rs1192517454 3083 dbSNP
rs1034331639 3085 dbSNP
rs994811947 3086 dbSNP
rs1177679440 3088 dbSNP
rs963222964 3092 dbSNP
rs1424717219 3094 dbSNP
rs1320789618 3099 dbSNP
rs899173206 3101 dbSNP
rs759880276 3109 dbSNP
rs1016045380 3111 dbSNP
rs555695319 3115 dbSNP
rs983215422 3116 dbSNP
rs950865626 3147 dbSNP
rs1224348521 3149 dbSNP
rs1051400134 3152 dbSNP
rs886941790 3152 dbSNP
rs998042522 3162 dbSNP
rs746425318 3166 dbSNP
rs1025036899 3167 dbSNP
rs899738230 3171 dbSNP
rs1014018227 3177 dbSNP
rs1488557478 3177 dbSNP
rs1039609163 3178 dbSNP
rs1490758406 3184 dbSNP
rs1199055251 3185 dbSNP
rs959381617 3199 dbSNP
rs1477217222 3205 dbSNP
rs779440512 3207 dbSNP
rs1268540988 3220 dbSNP
rs1419605611 3224 dbSNP
rs1217660436 3228 dbSNP
rs1296496646 3235 dbSNP
rs1001108965 3238 dbSNP
rs1405795153 3240 dbSNP
rs1310117656 3245 dbSNP
rs925622246 3246 dbSNP
rs1434075764 3268 dbSNP
rs1041463215 3269 dbSNP
rs945820681 3271 dbSNP
rs904069154 3275 dbSNP
rs1277453096 3282 dbSNP
rs188222099 3290 dbSNP
rs1346546862 3292 dbSNP
rs1360909792 3300 dbSNP
rs917410438 3301 dbSNP
rs1435035795 3304 dbSNP
rs1366543422 3315 dbSNP
rs1266179958 3317 dbSNP
rs1323054208 3318 dbSNP
rs1042578415 3325 dbSNP
rs993427197 3328 dbSNP
rs1184487887 3342 dbSNP
rs1009712389 3352 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.688 6.8e-6 -0.292 5.2e-2 32 Click to see details
GSE21032 Prostate cancer 0.388 1.4e-4 0.214 2.6e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.612 2.1e-3 0.653 9.0e-4 20 Click to see details
GSE28260 Renal cortex and medulla -0.506 3.9e-2 -0.549 2.6e-2 13 Click to see details
GSE19783 ER- ER- breast cancer 0.112 1.6e-1 0.168 6.9e-2 79 Click to see details
GSE14794 Lymphoblastoid cells 0.099 1.8e-1 0.139 9.6e-2 90 Click to see details
GSE19350 CNS germ cell tumors 0.281 1.9e-1 0.133 3.4e-1 12 Click to see details
GSE38226 Liver fibrosis -0.182 2.1e-1 0.036 4.4e-1 21 Click to see details
GSE19536 Breast cancer 0.074 2.3e-1 0.056 2.9e-1 100 Click to see details
GSE28544 Breast cancer -0.132 2.7e-1 -0.517 4.8e-3 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.104 3.1e-1 -0.055 4.0e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.061 3.2e-1 0.127 1.6e-1 64 Click to see details
GSE17306 Multiple myeloma -0.067 3.2e-1 -0.064 3.3e-1 49 Click to see details
GSE17498 Multiple myeloma -0.067 3.4e-1 0.067 3.4e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer -0.067 3.9e-1 -0.024 4.6e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.055 4.0e-1 -0.066 3.8e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.042 4.2e-1 0.048 4.1e-1 23 Click to see details
GSE27834 Pluripotent stem cells 0.03 4.6e-1 0.076 3.9e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.015 4.7e-1 -0.062 3.9e-1 24 Click to see details
GSE21849 B cell lymphoma 0.008 4.8e-1 -0.106 2.9e-1 29 Click to see details
GSE21849 B cell lymphoma 0.008 4.8e-1 -0.106 2.9e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.616 0 -0.640 0 32 Click to see details
BLCA -0.754 0 -0.783 0 18 Click to see details
HNSC -0.261 0.05 -0.234 0.07 42 Click to see details
LIHC 0.193 0.09 0.254 0.04 49 Click to see details
UCEC 0.309 0.1 0.195 0.21 19 Click to see details
THCA -0.143 0.14 -0.189 0.08 59 Click to see details
KIRP -0.191 0.15 -0.237 0.1 32 Click to see details
PRAD -0.134 0.18 -0.119 0.21 50 Click to see details
CHOL -0.247 0.26 -0.267 0.24 9 Click to see details
LUAD 0.178 0.29 0.252 0.21 12 Click to see details
PAAD 0.36 0.32 0.400 0.3 4 Click to see details
LUSC 0.076 0.33 0.070 0.34 38 Click to see details
ESCA 0.13 0.35 -0.091 0.4 11 Click to see details
KICH -0.061 0.39 0.140 0.25 25 Click to see details
CESC 0.339 0.39 0.500 0.33 3 Click to see details
COAD 0.107 0.4 -0.095 0.41 8 Click to see details
PCPG 0.239 0.42 -0.500 0.33 3 Click to see details
BRCA 0.016 0.44 -0.022 0.42 84 Click to see details
KIRC 0.008 0.47 0.012 0.46 68 Click to see details
KIRC 0.008 0.47 0.012 0.46 68 Click to see details
KIRC 0.008 0.47 0.012 0.46 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta