miRTarBase - #MIRT170136 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KLHDC10   
Synonyms slim
Description kelch domain containing 10
Transcript NM_014997   
Expression
Putative miRNA Targets on KLHDC10
3'UTR of KLHDC10
(miRNA target sites are highlighted)
>KLHDC10|NM_014997|3'UTR
   1 GGATTTCTGGACTGTTCATTGATACTGGAAATGTTAATTTAAAGAGACTCCTTTATTTATGGGCAGTGTAGAATGTGCTA
  81 CAAAGAGGATTGGTTACCCTGATCAAGGCCTTATTTAGAAAATACATCAGATGCCTTTCTGTAAATTGGTTTTTCAGTTT
 161 ATGGACATCTCACTTTCCCACGTGCTTCCTTCTTTGCTTCTGTTCCTCCTGACCCATTACATGCACATGTACTCACATAC
 241 TCCCTCTTCCTTCTCGATGGAGTTAAGGGAAAGCCTGAAAGTACCTTAATAATGTTATTAATCAAGACAGATTCCTTTTT
 321 AAAGGAATTCTGAATAGTTCCATGTCATACAATATTCTAGAAATTAAAACATCATCAACATAAAGAAAAATGAAATTAAA
 401 AAATTTTTACATCTAGCAACAGCAACAACCACAAATTTAGGGGAAGCTGAGAAGGCTAACCTTGGGAATCTTGCAGGTTA
 481 TACTTAAACCTAGATGTTTAACTTAGTGTTTTCAAGATGTGTCTAACTGAGTAGTAGCTGGGTCTGATGGCAGCAGTGCT
 561 TGCCATCTTGTTGCACAGATAACTCAAACCTACCCTTTGGCTTTGAAGGAAGGTTAAGCAGCCCAGCAACTCTTGGTTAG
 641 TGATTTCTTTCTCATCCTCATGGTGCCAGCAGTGGTTAGAGTTGGTTTGTCAAAAGACTTACGTGTGTGTCGTGGTCGTG
 721 CTCTTTGTTGTTGCTCTTAGAAATTATGGCACCAAGAATGTTTCAAACGGAAAAACTTGTGGTGGCCAAAGTTCTTCATT
 801 CTGGCAGTTTTGAAACTCTCTTATGCTTATTAATGGTTTTAAATATCTCTTTGACTTCTTCATGGGGAATTGTAGACCCT
 881 AAGTATGTGGTGTAAATGCCATGTAACATGAACACAAGCTCCCGAGGGAGGCCAGAGAAGAGCCAGGCAGAGAAAACCTG
 961 CATCCTCTGGGCTTGTTAACTTGGCTTCCACTCGGGCTGTGGTCTTTGGCTATCATCTTGGCCATTTCCTTTTGAGAACT
1041 TGTTTCTTTTCTAATCTCTGGGCCAGGTACCTGCCATTTTCTCAGGCAGTTGGTCCTTGATTTTTCCCTTAGCTTGTTGC
1121 CTTCTTTTCCGTCTGCTTTAATGTGCATGGTGCTGTGAATAATTGTCTAGTAATTGGATACAAGGTCTTGGGGGTAAAGC
1201 CACAGGTCATCCTTCCTGAAGAACCAAGTATCATTTAAAAACTAGCATGAGGAAGGAATGAAACTGAGTAGCATTCATTT
1281 TGTGTGTGTGAAATTTTAGTTCTGGTTTGTTTGATTTGTTTTTTTTTTAATTCTAAAAAGAATGACATAAATTTTCACTC
1361 GCTTTGCCATCTGGCTGCTAGGGGAGCTGAGCAAGAGGCTCACCATGCGCATGTGTAAGCCGCAGGTGTACTCAAGGTGC
1441 TGAAGGCGTGCAAGGGGCAGCGCTGGTCCTCCCGGGGCCAACTCACAGCAGGAGACTCGCATGGGAGAGTTGGAACACAT
1521 CTTTCCTTTAAGTGCCTCTTTTTTCACCTAGCTTTTAAAGTTATTCTTTGTCCTTCATCTCAGAAGGGATCTCTTTAGCT
1601 TATGTGTGGATTTAAAATGACCTTTGAGCTACGGTTAAAAAGCTACCATCTGGTGTTCAGTTCTGGGAAAGAGAAAACCG
1681 TAGCCTCCAGACATGCTCCTGATTTCTAGGCCTTATCATACCATCCCCTCTGTGATGGGTTGAGTTCATGGAGCCTGTAT
1761 TCTGGGAAGTCTTATAATAACCACGCACCTGTGAACGTGGGTCCTTTCTGGGGAGTGAGGAATGTGGGAGAGAGGCAGAA
1841 AAAGGAGCAGCTCCTCTAGGGGCCCATCCTCCCACATCTTGCCATTACCAGTCTGTGTAGCACTTAACCTCCTGCCACCA
1921 CTGCCAGGCTTGCTCCTCCGTTCTCTCCCAGAGCAAGTCAGTCTGAGCAGCTCCATTAGTCCAAAACAGAGCTTTGCTGC
2001 ATGACTTCAGCCTGGCCTCTGGATATTTGGTGGAAATATATTCTAAATTGAACAAGCCAGGCTGTCCAGGGTGGCAAGAG
2081 GATTTTTGACCTGGATTTATACAGGGACCAAAGACTGAATGCTCAGCCTCTGTGCTTAGACTTTCATGGTCCTTAGGATA
2161 GAAGTGAGTCTCTAGCCCTGCTACACCAGAGAGCTGAAGAGAGATGTGGTCTGGTTCCATCCATACTTGCTGGCATCCTT
2241 TGTTAAGCCTTCTGAGGGCAGTCTTCTTTGAGGTAGACCTTGGAGGCCTGACATCGAAGACCTGTGTGTTTTATTTTCAT
2321 AAAAGTATATATCCTTGGTCTAAAGTGTCTTCTTTTAATATAACACTAGTAAAAATGACATGGTATGACCAGCACTGAGT
2401 GCTATAGAACCACACATGTGTACATGTTCTGGATGCCAAATGAGACTGTGTGTAAATGACTAAGTGTAGATAACTAGAAA
2481 TTAGATAGGGGTCATCAGGCGTTTCGGTATACCTATAACCAGCACTCGGAATTCCTGACACTGTTTACTTGATTTAGGAA
2561 AGTTTATGCCTGCTGCTTCTCTGCCTCTTTGAGGTACTCCCAGCCGTCTTACTACAGTCCTGTAAATTTAAGTGCAATAT
2641 ATAGAAACATATGGATATATACAGATTATATATAGGGTGTAACTATAAAGCAGGTAGACTACTTTTTTGCATCTTGGGGA
2721 AGTGAGCTCATTACTTTAGGTTCAAATTATGCCAAGAATTTTAGATGTGATCAGCTGGCTTAAGCCAACTCATGTCATGA
2801 TAAAGCTGGATTTTCAAGTCCATGTTTTCTTACTCCAACTCTTAGAGACTCATTGTTCCTTAGGTTTGTTAGAGTTGAGA
2881 TTTTTTTTCTCCCTGTCATCTTTGTACTCTCTCATGTTTGCATGTCTTACATTTTGTTGCCGGAGAACAAGGAAGTCCAT
2961 CTGTAAGGAGTTTCCTAAACGGAGAATTAAAACCTAGTATTTAACACTAACCATTCTCCTATGTATATACTAATTTATCT
3041 GGGAATGTAATACTTTATTAAATGAAGAAAATGATGCTTTCTTCATTTAATATTTTCCACATCCTGGAAAAACTATAAAC
3121 TGACACAGAATAGGTTGAAATCTTAACTGGGGCTAAACAAAACCCTTTCCATTGGCAGAATCTCCTTTTTTCAGGGCCAT
3201 AATGACATGATGTAAAAATTTGCTTTAAACCATTCATGCCCTTAAATAGCTAGATTTTAAAGCATAATAAGCATATTAAC
3281 ATTTTTAAGCAAAAGATACGTTAACAGTGACCTTTGGTTATCCACAGTAGCAAGAGTAAAGCACAGATCATTGAAATCCA
3361 TAGATAATCAGTGAATCAACTTTCCTACCAAACAATAGATTCATTTACATTTCTTTTTCCTCCCTATCCTTTCCTGTAAG
3441 CACCTGTTTTTCCATGGAATGGGGTTAATGAGTAGGTAGAAAAGGAAAAGGAATAATCAGTAGGAGCTGACAACCAGTGA
3521 CCATATAAGCAGCTGATTGCCTGTAATTAGTCAGGCTGAACAATTAGAGTTGAATGCTGAAATTAGGAACCACAGGTGGT
3601 AATCCTGAGTAGATGTAGCTCTTCAGCGTCATCTCCTGCCCTGAGCTCCAGGCCATCTCTCTAACCACCAAAGAACTCTT
3681 AGTACCTACGGGAAGGAAAAGCTGTGTGCGACACAGAGGAAACTCCATTATTTGAACACATTTCTTTGGCTCTTGACAAA
3761 TACTTGCTTTTCCTCTAATCTTGCAAGAGCTATGGCTCTTCTATTTTCCAATCACACAGCTTGGCATGTAGGAAAGGTTG
3841 AATGATCCTCTAAGACTGTGTTGGTCTTCGTATTCTGTAAAACCCATTTTTTTTTTGTGGTCTTACAGATGTTTAGAAAG
3921 TGGCACAGGTTACTGAATTGTCTACCTGCCAGCATTCTGATATAGCACAAAAAGCTATTTTCCTTTATTTTTTGTATTAT
4001 TTTTTATTTTTCTGGCATTGAGCTCTAGGGTGGATGAGGGTTTATGGTCCTCTGATCATAAGCTCCATTCTAAAAACTGG
4081 TCACTGTTAGCTGAAATTGCTTTGGTTCCCCAAATGCCTTGGAACTCCAGACGCACCCGCAGGGCCTGAGGTAGGCTTCA
4161 TAGAGTTCTAGGACTTCCGTGTGCGTTGCCACCAGATCCTGCCCAGCAATGGCCTTTCCCTTCTAAGGTCATTAGATTCA
4241 GCCAAAAGCGACCTCTTCTCTAGTCCGGTGTTACGAACAGAAGTTCTGAGTTGTGCTACAAAAGTAGTTCCATCTTTTTG
4321 GTGTAATTTTCATGTTTTTAATTTGAAAAAAAAAAAAAAAAAAAAACAACTTTTTATAAGTTTTTTAAGGGCCCTGCTTA
4401 GTCAGTGTACAGGGTGGAGTCAGAGGCAGTTTTCAGAAAAAAACAAAAAACAATTTCACCAAGCGGTAGTAATTGTTGTT
4481 TTACTAGTTATACATTTAGAATATAAAGGAGGCATCAGAAAACACACTCTCTAAAGCCACTTCCTTGTGCACAGAGTCTG
4561 CACAGGGAGAGCACAGGCATCTCCCTGGAAAAGCACCTGCCAATGACGAATTTCATGGAAGAACCTAGGCAAGAAAGGAA
4641 GCCTCTTTCTGAGACACAGTCTCTGAGAGGTGAGCCTAGCTTTGCTCTTCCTACAGGGTATGCTTGGGCCATACACAATG
4721 CTCGCCTTACTTTAAAGCTATTTTGCCACAGTCCTGTTAAATAGTGTGGACGTCCTTTTGCAGTCTGGTGTGCATGCCAT
4801 ATGATCAGGACAGCTTTTCCACTTTACTCGGTTTCCTACAAGCAAGTAGGAAATACAGTGAATTTACCCTAAAATGTCCA
4881 ATCTGTATTTATGTACCTTGTCAGTGTTTTGCTGTTGGTTTTCTAAAACAATCTGATCAATAAATCTTATCCAAATCAAT
4961 TTGGTTCAAGTTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUAC--ACGACGAu 5'
             ||| : |||||  ||||||| 
Target 5' aggAAAGT-TTATGCCTGCTGCTt 3'
2556 - 2578 160.00 -11.50
2
miRNA  3' guGUUUGGUAAU-ACACGACGau 5'
            |||| ||  : | ||||||  
Target 5' tcCAAAACAGAGCTTTGCTGCat 3'
1980 - 2002 136.00 -9.50
3
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            |: :|: || || ||:|||| 
Target 5' gtCGTGCTCTT-TGTTGTTGCTc 3'
715 - 736 135.00 -8.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30103919 20 COSMIC
COSN30468490 47 COSMIC
COSN30530096 56 COSMIC
COSN31515276 58 COSMIC
COSN30157255 63 COSMIC
COSN7959877 163 COSMIC
COSN17691552 182 COSMIC
COSN16639844 1151 COSMIC
COSN20956520 1633 COSMIC
COSN30299185 1786 COSMIC
COSN26421474 1807 COSMIC
COSN23633223 1911 COSMIC
COSN27384849 2018 COSMIC
COSN5647793 2056 COSMIC
COSN9922915 2095 COSMIC
COSN26831907 2102 COSMIC
COSN20776813 2290 COSMIC
COSN27823519 2393 COSMIC
COSN20104773 2458 COSMIC
COSN19122113 2610 COSMIC
COSN9922916 2650 COSMIC
COSN25741203 2799 COSMIC
COSN20104774 2913 COSMIC
COSN16003392 3148 COSMIC
COSN27996771 3368 COSMIC
COSN17038082 3389 COSMIC
COSN6351043 3843 COSMIC
COSN2201329 4107 COSMIC
COSN25022301 4194 COSMIC
COSN30590568 4704 COSMIC
COSN19728775 4724 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755205343 11 dbSNP
rs1234290154 14 dbSNP
rs779104361 16 dbSNP
rs772117468 19 dbSNP
rs1217470991 26 dbSNP
rs375534602 33 dbSNP
rs747587208 37 dbSNP
rs1427476213 38 dbSNP
rs1190491706 39 dbSNP
rs1192686895 45 dbSNP
rs1399732488 46 dbSNP
rs757252438 52 dbSNP
rs985985069 55 dbSNP
rs1408292158 61 dbSNP
rs924590951 67 dbSNP
rs934617392 67 dbSNP
rs377566944 75 dbSNP
rs1242387307 110 dbSNP
rs909143737 127 dbSNP
rs1237524689 135 dbSNP
rs1454636425 140 dbSNP
rs1484235681 150 dbSNP
rs1259010523 157 dbSNP
rs941994532 169 dbSNP
rs751336355 170 dbSNP
rs35624913 177 dbSNP
rs1375417597 178 dbSNP
rs890505460 182 dbSNP
rs1477531573 183 dbSNP
rs943190368 186 dbSNP
rs757116798 203 dbSNP
rs755905994 212 dbSNP
rs1398272627 214 dbSNP
rs767617569 215 dbSNP
rs1286559514 223 dbSNP
rs1039271295 224 dbSNP
rs1360690432 227 dbSNP
rs1160097933 228 dbSNP
rs1156881554 229 dbSNP
rs1422420951 230 dbSNP
rs545611530 253 dbSNP
rs1331055678 256 dbSNP
rs919121992 282 dbSNP
rs1395910049 297 dbSNP
rs995151287 300 dbSNP
rs141300725 308 dbSNP
rs527358755 310 dbSNP
rs1454129039 312 dbSNP
rs894123408 316 dbSNP
rs1486238903 341 dbSNP
rs886124815 345 dbSNP
rs755050661 350 dbSNP
rs1034742626 351 dbSNP
rs1292930594 353 dbSNP
rs1247470745 370 dbSNP
rs1043296397 371 dbSNP
rs1330600724 373 dbSNP
rs959109373 374 dbSNP
rs991713647 375 dbSNP
rs1213414104 402 dbSNP
rs1272166571 404 dbSNP
rs1023534757 405 dbSNP
rs1337649322 412 dbSNP
rs1364629357 416 dbSNP
rs904764768 419 dbSNP
rs542329526 421 dbSNP
rs115741448 428 dbSNP
rs572343308 432 dbSNP
rs531169111 442 dbSNP
rs979433768 443 dbSNP
rs1169674194 448 dbSNP
rs1468905323 449 dbSNP
rs371093939 456 dbSNP
rs1197422999 462 dbSNP
rs1490233405 466 dbSNP
rs749481546 469 dbSNP
rs1211932446 474 dbSNP
rs1032236447 479 dbSNP
rs1251159488 485 dbSNP
rs1205825013 497 dbSNP
rs901368235 497 dbSNP
rs1450557153 504 dbSNP
rs1320676644 505 dbSNP
rs1193219310 523 dbSNP
rs12534379 532 dbSNP
rs1344435983 535 dbSNP
rs147016223 543 dbSNP
rs1388239270 547 dbSNP
rs1394051162 554 dbSNP
rs13241007 559 dbSNP
rs984080638 577 dbSNP
rs1419022245 583 dbSNP
rs137871603 588 dbSNP
rs943430933 595 dbSNP
rs747440219 601 dbSNP
rs1378362590 602 dbSNP
rs972035339 614 dbSNP
rs930470675 615 dbSNP
rs79863181 625 dbSNP
rs1199723611 626 dbSNP
rs1459446516 630 dbSNP
rs1261853534 636 dbSNP
rs1201161835 650 dbSNP
rs1320332997 656 dbSNP
rs938514238 661 dbSNP
rs1338780847 667 dbSNP
rs748222260 671 dbSNP
rs536465669 675 dbSNP
rs1234955510 676 dbSNP
rs1333671812 699 dbSNP
rs1305964956 701 dbSNP
rs1447283787 702 dbSNP
rs769128288 702 dbSNP
rs555542028 703 dbSNP
rs575197086 704 dbSNP
rs1402989510 710 dbSNP
rs1246646046 712 dbSNP
rs1042741327 713 dbSNP
rs1003198363 718 dbSNP
rs567756253 719 dbSNP
rs934893704 723 dbSNP
rs1441939929 726 dbSNP
rs1053384101 734 dbSNP
rs143454731 740 dbSNP
rs1443565569 741 dbSNP
rs1263197623 746 dbSNP
rs998310004 748 dbSNP
rs1259787729 750 dbSNP
rs556636576 760 dbSNP
rs1028483862 761 dbSNP
rs777164223 769 dbSNP
rs889867939 770 dbSNP
rs537742546 774 dbSNP
rs1341046706 778 dbSNP
rs1163071504 779 dbSNP
rs1368436600 780 dbSNP
rs1454742594 782 dbSNP
rs1017336980 789 dbSNP
rs180830440 792 dbSNP
rs539371275 799 dbSNP
rs1421816917 806 dbSNP
rs554528234 819 dbSNP
rs1399411420 821 dbSNP
rs572515461 821 dbSNP
rs1313731574 837 dbSNP
rs1473383456 837 dbSNP
rs1239753432 843 dbSNP
rs1188940098 855 dbSNP
rs1357559618 858 dbSNP
rs987509125 859 dbSNP
rs772551694 865 dbSNP
rs1216876739 866 dbSNP
rs769213258 867 dbSNP
rs1227558620 868 dbSNP
rs543217315 871 dbSNP
rs959827219 877 dbSNP
rs1239514026 883 dbSNP
rs992653500 890 dbSNP
rs560774001 891 dbSNP
rs1287984127 919 dbSNP
rs1298953388 920 dbSNP
rs915786100 924 dbSNP
rs554492580 925 dbSNP
rs1047550834 929 dbSNP
rs147160812 939 dbSNP
rs1215510953 947 dbSNP
rs939255197 961 dbSNP
rs34888782 969 dbSNP
rs1166646261 986 dbSNP
rs1056083951 990 dbSNP
rs1422241794 994 dbSNP
rs1312859808 995 dbSNP
rs978561721 1003 dbSNP
rs925579983 1013 dbSNP
rs1220474191 1016 dbSNP
rs1451983869 1026 dbSNP
rs934359065 1029 dbSNP
rs1180573464 1030 dbSNP
rs369705870 1034 dbSNP
rs1317261876 1035 dbSNP
rs375041477 1048 dbSNP
rs1278898984 1052 dbSNP
rs564573476 1060 dbSNP
rs1343800736 1067 dbSNP
rs1274497363 1071 dbSNP
rs903567578 1076 dbSNP
rs934286774 1077 dbSNP
rs1327313227 1087 dbSNP
rs1409870080 1089 dbSNP
rs1000805294 1094 dbSNP
rs1031840746 1103 dbSNP
rs1478521733 1114 dbSNP
rs956297811 1117 dbSNP
rs1174537770 1125 dbSNP
rs532249526 1127 dbSNP
rs531938146 1129 dbSNP
rs1248210746 1130 dbSNP
rs747518691 1131 dbSNP
rs547257639 1132 dbSNP
rs1258636290 1133 dbSNP
rs1200541682 1146 dbSNP
rs1005564645 1151 dbSNP
rs952161615 1153 dbSNP
rs1391956086 1171 dbSNP
rs1311157233 1181 dbSNP
rs1370063664 1187 dbSNP
rs1038473821 1191 dbSNP
rs897108449 1192 dbSNP
rs1446555511 1218 dbSNP
rs559614237 1219 dbSNP
rs939156879 1223 dbSNP
rs1468758624 1226 dbSNP
rs992052924 1231 dbSNP
rs994188805 1242 dbSNP
rs916459623 1244 dbSNP
rs1426857065 1248 dbSNP
rs1156521832 1249 dbSNP
rs1313382205 1250 dbSNP
rs1438865280 1269 dbSNP
rs1238623757 1275 dbSNP
rs1180426804 1277 dbSNP
rs185193944 1279 dbSNP
rs548414329 1281 dbSNP
rs374433521 1283 dbSNP
rs1254972031 1285 dbSNP
rs1210936937 1305 dbSNP
rs947718202 1306 dbSNP
rs1481237440 1310 dbSNP
rs1282431404 1314 dbSNP
rs1239805245 1316 dbSNP
rs1354853269 1319 dbSNP
rs145982899 1319 dbSNP
rs959942672 1319 dbSNP
rs796750415 1321 dbSNP
rs76313440 1329 dbSNP
rs1448163854 1335 dbSNP
rs1022790142 1341 dbSNP
rs767386728 1346 dbSNP
rs1156442248 1349 dbSNP
rs1418781892 1349 dbSNP
rs1380646962 1369 dbSNP
rs978893344 1372 dbSNP
rs925726360 1374 dbSNP
rs1442646081 1379 dbSNP
rs189809182 1381 dbSNP
rs1182456888 1384 dbSNP
rs1484287197 1394 dbSNP
rs1240494352 1395 dbSNP
rs1019216223 1403 dbSNP
rs1488763616 1407 dbSNP
rs988494592 1409 dbSNP
rs1431731436 1410 dbSNP
rs1314083222 1414 dbSNP
rs571641347 1415 dbSNP
rs1230587593 1422 dbSNP
rs749311025 1423 dbSNP
rs1295853395 1426 dbSNP
rs1355241045 1427 dbSNP
rs1462407396 1428 dbSNP
rs1333321192 1433 dbSNP
rs934233009 1434 dbSNP
rs1360786778 1436 dbSNP
rs539051627 1437 dbSNP
rs1049981642 1448 dbSNP
rs1397788990 1449 dbSNP
rs1165382506 1454 dbSNP
rs996621297 1461 dbSNP
rs182420395 1462 dbSNP
rs572702817 1463 dbSNP
rs1193105099 1469 dbSNP
rs1027639285 1472 dbSNP
rs1220637250 1473 dbSNP
rs536442752 1474 dbSNP
rs941540618 1475 dbSNP
rs1224388362 1478 dbSNP
rs952259163 1489 dbSNP
rs983511181 1497 dbSNP
rs1340674036 1499 dbSNP
rs139541399 1500 dbSNP
rs897230196 1502 dbSNP
rs1366644831 1509 dbSNP
rs1293939033 1528 dbSNP
rs1459361035 1536 dbSNP
rs576041029 1543 dbSNP
rs994699433 1548 dbSNP
rs1220954437 1552 dbSNP
rs1425942749 1553 dbSNP
rs1197017404 1556 dbSNP
rs1256738190 1557 dbSNP
rs1432860760 1558 dbSNP
rs1056449516 1559 dbSNP
rs896516226 1560 dbSNP
rs960528905 1561 dbSNP
rs1014149556 1564 dbSNP
rs1479919505 1566 dbSNP
rs115839013 1567 dbSNP
rs1317990017 1573 dbSNP
rs576391813 1574 dbSNP
rs1230578541 1580 dbSNP
rs947993382 1592 dbSNP
rs1301659104 1593 dbSNP
rs1388330387 1600 dbSNP
rs979531949 1600 dbSNP
rs924959916 1604 dbSNP
rs969837495 1605 dbSNP
rs1248881040 1606 dbSNP
rs934960647 1611 dbSNP
rs1170942569 1628 dbSNP
rs187051705 1633 dbSNP
rs149612085 1634 dbSNP
rs144316313 1635 dbSNP
rs955799599 1643 dbSNP
rs1179812746 1650 dbSNP
rs988997487 1668 dbSNP
rs548067780 1673 dbSNP
rs900776537 1680 dbSNP
rs867617983 1681 dbSNP
rs1421395573 1702 dbSNP
rs1343803154 1722 dbSNP
rs1256233033 1724 dbSNP
rs1465100534 1727 dbSNP
rs1326317725 1732 dbSNP
rs1351224768 1740 dbSNP
rs955060484 1757 dbSNP
rs985638637 1764 dbSNP
rs1351453312 1767 dbSNP
rs1379052068 1774 dbSNP
rs911482025 1775 dbSNP
rs200142557 1776 dbSNP
rs757651478 1776 dbSNP
rs1403106508 1782 dbSNP
rs60941031 1785 dbSNP
rs1418176147 1786 dbSNP
rs773899977 1789 dbSNP
rs918774700 1798 dbSNP
rs1442040853 1800 dbSNP
rs1275836358 1801 dbSNP
rs1367268053 1810 dbSNP
rs114477486 1813 dbSNP
rs960768988 1814 dbSNP
rs1256320786 1816 dbSNP
rs1212536141 1820 dbSNP
rs1487131798 1828 dbSNP
rs1284982659 1829 dbSNP
rs1234495923 1832 dbSNP
rs1240637763 1834 dbSNP
rs1355677663 1845 dbSNP
rs867050469 1846 dbSNP
rs1282365105 1849 dbSNP
rs1341133169 1850 dbSNP
rs1056574221 1860 dbSNP
rs1482774982 1862 dbSNP
rs746378171 1874 dbSNP
rs948036386 1876 dbSNP
rs1360161624 1883 dbSNP
rs1299144158 1886 dbSNP
rs1044300097 1889 dbSNP
rs1421911198 1891 dbSNP
rs905770262 1895 dbSNP
rs1389135015 1909 dbSNP
rs1163176771 1910 dbSNP
rs1473434152 1912 dbSNP
rs770272608 1922 dbSNP
rs1368517450 1924 dbSNP
rs1189472347 1926 dbSNP
rs1023448631 1930 dbSNP
rs1262020429 1936 dbSNP
rs115244714 1939 dbSNP
rs1032835050 1940 dbSNP
rs1242928875 1941 dbSNP
rs780424678 1943 dbSNP
rs1209136610 1951 dbSNP
rs891637729 1957 dbSNP
rs1275078393 1966 dbSNP
rs748891372 1977 dbSNP
rs1029371071 1989 dbSNP
rs571779871 1993 dbSNP
rs925153494 2000 dbSNP
rs956368847 2006 dbSNP
rs987798884 2008 dbSNP
rs985084582 2012 dbSNP
rs1323367692 2023 dbSNP
rs1406409153 2030 dbSNP
rs1017934445 2041 dbSNP
rs943751781 2057 dbSNP
rs1191591621 2061 dbSNP
rs1040975320 2066 dbSNP
rs1193923791 2068 dbSNP
rs962974447 2071 dbSNP
rs1476211304 2072 dbSNP
rs922138415 2079 dbSNP
rs148770976 2085 dbSNP
rs1452072686 2100 dbSNP
rs918733876 2106 dbSNP
rs1403628326 2109 dbSNP
rs930152732 2110 dbSNP
rs75282831 2122 dbSNP
rs1258874689 2124 dbSNP
rs918011273 2127 dbSNP
rs1415639977 2135 dbSNP
rs948150322 2148 dbSNP
rs566231405 2152 dbSNP
rs1004872141 2171 dbSNP
rs1045071638 2173 dbSNP
rs1163558052 2195 dbSNP
rs903883392 2200 dbSNP
rs1437634265 2202 dbSNP
rs3800562 2203 dbSNP
rs1329887579 2205 dbSNP
rs896597314 2218 dbSNP
rs1295791925 2219 dbSNP
rs1013610464 2221 dbSNP
rs1411250650 2225 dbSNP
rs1422660230 2229 dbSNP
rs1171711373 2231 dbSNP
rs117023943 2239 dbSNP
rs761513837 2256 dbSNP
rs1457294798 2260 dbSNP
rs969251931 2264 dbSNP
rs1206749484 2272 dbSNP
rs1440839760 2282 dbSNP
rs570201271 2283 dbSNP
rs1175159181 2286 dbSNP
rs1228115466 2287 dbSNP
rs1029485878 2296 dbSNP
rs113772418 2297 dbSNP
rs1214781790 2302 dbSNP
rs1285359234 2305 dbSNP
rs1240026825 2306 dbSNP
rs1486056908 2307 dbSNP
rs1378322814 2320 dbSNP
rs191631987 2328 dbSNP
rs766405898 2332 dbSNP
rs1017881873 2338 dbSNP
rs4728185 2341 dbSNP
rs912220864 2345 dbSNP
rs965015583 2346 dbSNP
rs1414752493 2348 dbSNP
rs962705869 2349 dbSNP
rs1471647387 2353 dbSNP
rs1181059512 2355 dbSNP
rs753705172 2360 dbSNP
rs975210621 2365 dbSNP
rs920971458 2381 dbSNP
rs1380740169 2388 dbSNP
rs146882438 2389 dbSNP
rs932175263 2390 dbSNP
rs1049685788 2393 dbSNP
rs909506425 2394 dbSNP
rs1359297184 2395 dbSNP
rs139497874 2404 dbSNP
rs1336643717 2409 dbSNP
rs1284262883 2411 dbSNP
rs1486803881 2411 dbSNP
rs1216385970 2416 dbSNP
rs574625302 2416 dbSNP
rs1026316889 2418 dbSNP
rs1036348950 2425 dbSNP
rs1357924800 2427 dbSNP
rs896504247 2440 dbSNP
rs1227167455 2451 dbSNP
rs561595581 2457 dbSNP
rs951542303 2461 dbSNP
rs542082370 2466 dbSNP
rs563451915 2477 dbSNP
rs530683681 2478 dbSNP
rs1348605014 2487 dbSNP
rs1345625804 2492 dbSNP
rs980866688 2493 dbSNP
rs546025772 2501 dbSNP
rs925286847 2506 dbSNP
rs1413135954 2507 dbSNP
rs565375684 2510 dbSNP
rs1476288390 2513 dbSNP
rs1054345789 2514 dbSNP
rs1193325308 2516 dbSNP
rs1238520946 2520 dbSNP
rs913132991 2520 dbSNP
rs946007335 2529 dbSNP
rs1219970790 2540 dbSNP
rs1050866197 2542 dbSNP
rs1288475656 2543 dbSNP
rs763133176 2547 dbSNP
rs764120779 2550 dbSNP
rs1275894432 2551 dbSNP
rs1173809416 2568 dbSNP
rs532692994 2569 dbSNP
rs1039877535 2571 dbSNP
rs1456282381 2587 dbSNP
rs753618264 2594 dbSNP
rs952566256 2595 dbSNP
rs1165663464 2601 dbSNP
rs183620907 2606 dbSNP
rs1421650594 2607 dbSNP
rs909370767 2609 dbSNP
rs1478296621 2612 dbSNP
rs1264277361 2613 dbSNP
rs566093030 2628 dbSNP
rs1488401229 2630 dbSNP
rs1445042157 2633 dbSNP
rs75263429 2643 dbSNP
rs1255650038 2649 dbSNP
rs1025341051 2650 dbSNP
rs951605117 2652 dbSNP
rs1235765654 2657 dbSNP
rs1013875243 2665 dbSNP
rs113498062 2666 dbSNP
rs1366752597 2674 dbSNP
rs756425261 2678 dbSNP
rs1443099044 2680 dbSNP
rs905300731 2683 dbSNP
rs868862454 2686 dbSNP
rs1462645933 2687 dbSNP
rs969566284 2702 dbSNP
rs1053844458 2712 dbSNP
rs1258647934 2714 dbSNP
rs570020502 2715 dbSNP
rs1432950016 2718 dbSNP
rs980815443 2719 dbSNP
rs780656127 2720 dbSNP
rs1456861305 2735 dbSNP
rs1235773392 2743 dbSNP
rs1009366861 2744 dbSNP
rs1019548335 2756 dbSNP
rs958182536 2763 dbSNP
rs1196523791 2765 dbSNP
rs1237403693 2771 dbSNP
rs537200308 2776 dbSNP
rs913928400 2784 dbSNP
rs1200601212 2793 dbSNP
rs1374603716 2809 dbSNP
rs4728186 2809 dbSNP
rs1050979105 2821 dbSNP
rs912371226 2836 dbSNP
rs1137778 2840 dbSNP
rs984290366 2848 dbSNP
rs1301308997 2850 dbSNP
rs1465763707 2851 dbSNP
rs1171933706 2854 dbSNP
rs534441229 2856 dbSNP
rs898228738 2863 dbSNP
rs1380229670 2881 dbSNP
rs995305557 2881 dbSNP
rs1180391834 2882 dbSNP
rs547179047 2891 dbSNP
rs1170388202 2892 dbSNP
rs972198391 2893 dbSNP
rs918209374 2896 dbSNP
rs1485170740 2899 dbSNP
rs752814701 2904 dbSNP
rs1212798185 2905 dbSNP
rs148134545 2907 dbSNP
rs375529189 2907 dbSNP
rs1330539165 2908 dbSNP
rs1400697000 2914 dbSNP
rs886789585 2915 dbSNP
rs1308424988 2932 dbSNP
rs980826225 2937 dbSNP
rs1013822849 2942 dbSNP
rs1025235608 2943 dbSNP
rs1319896851 2944 dbSNP
rs1216775155 2945 dbSNP
rs538306787 2947 dbSNP
rs1222226396 2960 dbSNP
rs936664093 2961 dbSNP
rs969513020 2964 dbSNP
rs1053877420 2973 dbSNP
rs1455844737 2974 dbSNP
rs892517676 2975 dbSNP
rs11541722 2976 dbSNP
rs1002776777 2981 dbSNP
rs1184813481 2985 dbSNP
rs552817315 2986 dbSNP
rs1032551194 2988 dbSNP
rs958346975 2994 dbSNP
rs1264841925 2999 dbSNP
rs1474654688 3009 dbSNP
rs1257793457 3014 dbSNP
rs1189694620 3021 dbSNP
rs1487181892 3022 dbSNP
rs988273538 3024 dbSNP
rs1450467692 3028 dbSNP
rs1193746490 3030 dbSNP
rs1264771573 3042 dbSNP
rs778515241 3051 dbSNP
rs1193619108 3068 dbSNP
rs954728279 3075 dbSNP
rs1369365885 3077 dbSNP
rs552256205 3087 dbSNP
rs901111358 3089 dbSNP
rs986640797 3096 dbSNP
rs189007227 3101 dbSNP
rs1295336861 3104 dbSNP
rs1398458216 3113 dbSNP
rs1340262412 3125 dbSNP
rs997152723 3131 dbSNP
rs3800563 3135 dbSNP
rs1479569650 3136 dbSNP
rs1161613512 3137 dbSNP
rs942651568 3148 dbSNP
rs771783567 3153 dbSNP
rs1300091092 3171 dbSNP
rs888128080 3181 dbSNP
rs1476661879 3182 dbSNP
rs1241255182 3186 dbSNP
rs1005136039 3190 dbSNP
rs1015331529 3193 dbSNP
rs1265197291 3200 dbSNP
rs961110170 3201 dbSNP
rs993651852 3205 dbSNP
rs975647599 3207 dbSNP
rs1339010906 3208 dbSNP
rs1294797761 3213 dbSNP
rs1271100546 3224 dbSNP
rs1433333837 3225 dbSNP
rs1329800817 3227 dbSNP
rs1323468518 3231 dbSNP
rs1340785999 3242 dbSNP
rs919791667 3250 dbSNP
rs1394539940 3265 dbSNP
rs537876724 3266 dbSNP
rs1263524292 3272 dbSNP
rs1463697729 3280 dbSNP
rs931029035 3281 dbSNP
rs1418356488 3299 dbSNP
rs1046831001 3300 dbSNP
rs1025552397 3301 dbSNP
rs1355188097 3301 dbSNP
rs1468898598 3327 dbSNP
rs1254915926 3329 dbSNP
rs1196868473 3332 dbSNP
rs151061343 3333 dbSNP
rs1287494501 3336 dbSNP
rs1487037798 3351 dbSNP
rs554431165 3358 dbSNP
rs193131600 3359 dbSNP
rs1046131500 3376 dbSNP
rs1426146475 3384 dbSNP
rs1373867305 3394 dbSNP
rs772734385 3396 dbSNP
rs905442414 3398 dbSNP
rs1002484654 3402 dbSNP
rs1353474973 3403 dbSNP
rs746880048 3405 dbSNP
rs1329117007 3408 dbSNP
rs989471020 3415 dbSNP
rs1399770970 3423 dbSNP
rs1440521136 3428 dbSNP
rs1160712915 3445 dbSNP
rs1358649176 3447 dbSNP
rs1396821164 3459 dbSNP
rs1419185702 3471 dbSNP
rs1032911576 3473 dbSNP
rs372185966 3476 dbSNP
rs1469683147 3485 dbSNP
rs140969430 3492 dbSNP
rs35585693 3495 dbSNP
rs1397772080 3499 dbSNP
rs79956745 3500 dbSNP
rs1040926764 3506 dbSNP
rs1020998046 3507 dbSNP
rs1253861842 3514 dbSNP
rs1350608254 3522 dbSNP
rs922440456 3530 dbSNP
rs1223781348 3539 dbSNP
rs541486810 3540 dbSNP
rs559605609 3554 dbSNP
rs932477580 3556 dbSNP
rs1443865171 3558 dbSNP
rs1050110152 3563 dbSNP
rs987423036 3565 dbSNP
rs1311977667 3566 dbSNP
rs1435121880 3572 dbSNP
rs1381817661 3579 dbSNP
rs1156772908 3583 dbSNP
rs1240362021 3584 dbSNP
rs1408743678 3587 dbSNP
rs759421240 3593 dbSNP
rs1017595900 3597 dbSNP
rs1471893939 3611 dbSNP
rs1257093587 3616 dbSNP
rs11541724 3619 dbSNP
rs975383543 3620 dbSNP
rs919732413 3628 dbSNP
rs538933957 3629 dbSNP
rs982907983 3639 dbSNP
rs1284302740 3642 dbSNP
rs1036638134 3646 dbSNP
rs1332144588 3653 dbSNP
rs548292890 3664 dbSNP
rs1199286417 3666 dbSNP
rs896938837 3670 dbSNP
rs150220463 3673 dbSNP
rs949155248 3677 dbSNP
rs761880045 3679 dbSNP
rs1013973338 3683 dbSNP
rs1046079984 3690 dbSNP
rs531145474 3691 dbSNP
rs1161304307 3697 dbSNP
rs1459927458 3701 dbSNP
rs1417327219 3708 dbSNP
rs145551442 3710 dbSNP
rs1264942676 3720 dbSNP
rs1476338354 3733 dbSNP
rs570685512 3735 dbSNP
rs558868514 3737 dbSNP
rs1186332960 3752 dbSNP
rs1486442304 3753 dbSNP
rs767788768 3764 dbSNP
rs750592194 3774 dbSNP
rs1332032262 3780 dbSNP
rs756537211 3794 dbSNP
rs546634936 3803 dbSNP
rs1336531391 3804 dbSNP
rs73483669 3812 dbSNP
rs1213787529 3818 dbSNP
rs1362465642 3819 dbSNP
rs1290556132 3821 dbSNP
rs147006109 3831 dbSNP
rs766609726 3844 dbSNP
rs1405013124 3847 dbSNP
rs754388771 3848 dbSNP
rs1463175110 3860 dbSNP
rs1371562232 3861 dbSNP
rs964760889 3870 dbSNP
rs377114152 3871 dbSNP
rs1374184329 3878 dbSNP
rs1222900249 3883 dbSNP
rs1251786772 3885 dbSNP
rs1301324463 3886 dbSNP
rs11373790 3887 dbSNP
rs1249246864 3887 dbSNP
rs1307828773 3887 dbSNP
rs547781875 3887 dbSNP
rs1297517849 3896 dbSNP
rs75898677 3898 dbSNP
rs1231646445 3899 dbSNP
rs1263074926 3900 dbSNP
rs755482366 3902 dbSNP
rs1318957828 3903 dbSNP
rs975698317 3905 dbSNP
rs1026913646 3907 dbSNP
rs966672908 3910 dbSNP
rs1173871348 3917 dbSNP
rs1443217023 3925 dbSNP
rs952774916 3926 dbSNP
rs1394499322 3938 dbSNP
rs556724541 3963 dbSNP
rs908399287 3964 dbSNP
rs1480414979 3967 dbSNP
rs922672858 3968 dbSNP
rs183704524 3969 dbSNP
rs932485658 3975 dbSNP
rs970453222 3978 dbSNP
rs981871986 3983 dbSNP
rs1431527720 3988 dbSNP
rs78771330 3989 dbSNP
rs1434391333 4000 dbSNP
rs1247855011 4019 dbSNP
rs909813414 4026 dbSNP
rs1480768073 4029 dbSNP
rs1252812744 4040 dbSNP
rs547691959 4048 dbSNP
rs1346991116 4049 dbSNP
rs1036879645 4054 dbSNP
rs1236496347 4060 dbSNP
rs896842692 4066 dbSNP
rs1466130377 4067 dbSNP
rs565886819 4069 dbSNP
rs1306452628 4080 dbSNP
rs949681125 4087 dbSNP
rs1045896338 4102 dbSNP
rs781587679 4114 dbSNP
rs905602136 4123 dbSNP
rs1376512060 4127 dbSNP
rs539770530 4128 dbSNP
rs6821 4129 dbSNP
rs1033836007 4131 dbSNP
rs1361508110 4132 dbSNP
rs186676417 4133 dbSNP
rs1011177600 4134 dbSNP
rs1021195038 4137 dbSNP
rs966703980 4139 dbSNP
rs945656263 4140 dbSNP
rs540060448 4142 dbSNP
rs1384572620 4146 dbSNP
rs890651412 4149 dbSNP
rs1282160672 4160 dbSNP
rs1319189756 4166 dbSNP
rs1008906615 4179 dbSNP
rs191484972 4180 dbSNP
rs1348489535 4183 dbSNP
rs900469637 4185 dbSNP
rs1256524016 4186 dbSNP
rs1239873837 4189 dbSNP
rs11541725 4192 dbSNP
rs138221593 4193 dbSNP
rs954135887 4197 dbSNP
rs542195111 4203 dbSNP
rs1414435980 4215 dbSNP
rs1356478395 4219 dbSNP
rs554901007 4220 dbSNP
rs994841961 4223 dbSNP
rs1267464075 4224 dbSNP
rs1380984901 4230 dbSNP
rs985724963 4232 dbSNP
rs576977409 4234 dbSNP
rs1198778119 4238 dbSNP
rs747725563 4240 dbSNP
rs1264057838 4244 dbSNP
rs1162312381 4249 dbSNP
rs952641884 4250 dbSNP
rs757967095 4251 dbSNP
rs1478089631 4267 dbSNP
rs941172226 4268 dbSNP
rs1421146789 4273 dbSNP
rs373765219 4275 dbSNP
rs1015408032 4276 dbSNP
rs78208394 4287 dbSNP
rs1205712256 4294 dbSNP
rs1466284001 4300 dbSNP
rs1271400955 4306 dbSNP
rs1351254055 4307 dbSNP
rs1232848868 4309 dbSNP
rs1427234497 4311 dbSNP
rs545161691 4312 dbSNP
rs1225716518 4315 dbSNP
rs1326271743 4327 dbSNP
rs1319554319 4330 dbSNP
rs1390179895 4335 dbSNP
rs1456119516 4335 dbSNP
rs1323340146 4343 dbSNP
rs1164689631 4345 dbSNP
rs1460560135 4345 dbSNP
rs1491417668 4345 dbSNP
rs752112679 4345 dbSNP
rs775396231 4345 dbSNP
rs10707873 4346 dbSNP
rs1194364156 4346 dbSNP
rs1271192245 4346 dbSNP
rs1339108261 4346 dbSNP
rs1369476060 4346 dbSNP
rs1372327026 4346 dbSNP
rs1469031085 4346 dbSNP
rs1491109163 4346 dbSNP
rs200461473 4346 dbSNP
rs372630307 4346 dbSNP
rs576644658 4346 dbSNP
rs747839202 4346 dbSNP
rs773200734 4346 dbSNP
rs1300550574 4348 dbSNP
rs1340634876 4349 dbSNP
rs199670379 4351 dbSNP
rs1402351863 4352 dbSNP
rs1276877035 4353 dbSNP
rs1361621600 4354 dbSNP
rs918467847 4356 dbSNP
rs970567829 4357 dbSNP
rs200715501 4358 dbSNP
rs926399443 4359 dbSNP
rs1222077499 4360 dbSNP
rs76360356 4361 dbSNP
rs959417826 4361 dbSNP
rs1248571885 4362 dbSNP
rs989155866 4362 dbSNP
rs1179900679 4363 dbSNP
rs1207753081 4363 dbSNP
rs762119336 4363 dbSNP
rs770474109 4363 dbSNP
rs914913248 4363 dbSNP
rs1235760608 4364 dbSNP
rs1346233904 4364 dbSNP
rs945616781 4364 dbSNP
rs1218626878 4365 dbSNP
rs1367682329 4365 dbSNP
rs1334835352 4366 dbSNP
rs1439487852 4366 dbSNP
rs145862490 4367 dbSNP
rs1042630937 4368 dbSNP
rs552421228 4370 dbSNP
rs1415751295 4371 dbSNP
rs944885137 4372 dbSNP
rs1427285053 4375 dbSNP
rs1039213518 4378 dbSNP
rs1054587176 4383 dbSNP
rs1233649378 4393 dbSNP
rs900584823 4398 dbSNP
rs995355401 4401 dbSNP
rs1257332550 4408 dbSNP
rs1212155467 4413 dbSNP
rs1360547922 4418 dbSNP
rs1314469287 4419 dbSNP
rs893997658 4422 dbSNP
rs143414080 4427 dbSNP
rs113337100 4438 dbSNP
rs57491897 4438 dbSNP
rs867482971 4438 dbSNP
rs1449471369 4447 dbSNP
rs1353314429 4451 dbSNP
rs1312062530 4461 dbSNP
rs886453197 4465 dbSNP
rs1360855702 4466 dbSNP
rs116615857 4483 dbSNP
rs1400163640 4494 dbSNP
rs1408896558 4495 dbSNP
rs1015521016 4496 dbSNP
rs1161634499 4500 dbSNP
rs998617322 4502 dbSNP
rs1443661427 4513 dbSNP
rs1417509261 4515 dbSNP
rs1189136692 4516 dbSNP
rs537198722 4526 dbSNP
rs1484497437 4532 dbSNP
rs1240840181 4541 dbSNP
rs1245461404 4547 dbSNP
rs1310282811 4550 dbSNP
rs1268274939 4554 dbSNP
rs565423576 4568 dbSNP
rs1029650239 4571 dbSNP
rs970513758 4572 dbSNP
rs777530496 4574 dbSNP
rs184000914 4588 dbSNP
rs947538086 4589 dbSNP
rs1283723139 4592 dbSNP
rs1043211061 4596 dbSNP
rs962523965 4597 dbSNP
rs972530705 4604 dbSNP
rs568138996 4608 dbSNP
rs959132668 4609 dbSNP
rs1165812970 4615 dbSNP
rs1425892941 4616 dbSNP
rs989661189 4617 dbSNP
rs11541726 4626 dbSNP
rs575527570 4627 dbSNP
rs1476034319 4639 dbSNP
rs966366287 4643 dbSNP
rs978281105 4644 dbSNP
rs11541721 4650 dbSNP
rs926993392 4654 dbSNP
rs1272118666 4658 dbSNP
rs1380526695 4671 dbSNP
rs145809223 4675 dbSNP
rs1156285799 4681 dbSNP
rs945001154 4686 dbSNP
rs1293197354 4695 dbSNP
rs1213855447 4698 dbSNP
rs1054209093 4702 dbSNP
rs568841660 4706 dbSNP
rs914291309 4709 dbSNP
rs974923060 4713 dbSNP
rs1438777632 4716 dbSNP
rs922123273 4717 dbSNP
rs930717429 4722 dbSNP
rs539455091 4724 dbSNP
rs1353060343 4725 dbSNP
rs946902210 4727 dbSNP
rs34477168 4734 dbSNP
rs1392587583 4741 dbSNP
rs1049631120 4743 dbSNP
rs886401962 4745 dbSNP
rs1452032773 4747 dbSNP
rs1251903031 4748 dbSNP
rs902795992 4751 dbSNP
rs940679856 4759 dbSNP
rs1045794755 4772 dbSNP
rs1051759119 4773 dbSNP
rs1336745995 4782 dbSNP
rs867763381 4789 dbSNP
rs906446122 4796 dbSNP
rs1370318764 4800 dbSNP
rs1452374592 4810 dbSNP
rs1007266533 4820 dbSNP
rs1371490077 4821 dbSNP
rs1138035 4822 dbSNP
rs1017006080 4823 dbSNP
rs1003483101 4830 dbSNP
rs1033503580 4843 dbSNP
rs894982602 4850 dbSNP
rs1010630785 4854 dbSNP
rs1410799901 4857 dbSNP
rs1444905286 4859 dbSNP
rs1172304460 4866 dbSNP
rs1278998442 4867 dbSNP
rs1434660743 4867 dbSNP
rs1022473306 4872 dbSNP
rs1176200119 4878 dbSNP
rs966469370 4882 dbSNP
rs1434495171 4886 dbSNP
rs1247955354 4888 dbSNP
rs962763553 4891 dbSNP
rs977727274 4893 dbSNP
rs1253779315 4900 dbSNP
rs544651068 4903 dbSNP
rs1347065835 4905 dbSNP
rs1256619832 4909 dbSNP
rs1235537683 4912 dbSNP
rs1138040 4924 dbSNP
rs1321415089 4934 dbSNP
rs971610402 4939 dbSNP
rs1229309320 4945 dbSNP
rs1352659022 4946 dbSNP
rs1202786523 4953 dbSNP
rs966254262 4955 dbSNP
rs975413911 4960 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.284 4.6e-3 0.241 1.4e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.447 2.4e-2 0.496 1.3e-2 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.331 6.1e-2 0.500 7.6e-3 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.303 7.0e-2 0.110 3.0e-1 25 Click to see details
GSE19536 Breast cancer 0.142 7.9e-2 0.152 6.6e-2 100 Click to see details
GSE14794 Lymphoblastoid cells 0.126 1.2e-1 0.090 2.0e-1 90 Click to see details
GSE21849 B cell lymphoma -0.214 1.3e-1 0.115 2.8e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.128 1.6e-1 -0.168 9.2e-2 64 Click to see details
GSE28544 Breast cancer -0.205 1.7e-1 -0.532 3.7e-3 24 Click to see details
GSE19350 CNS germ cell tumors 0.278 1.9e-1 0.357 1.3e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.097 2.0e-1 0.146 1.0e-1 79 Click to see details
GSE28260 Renal cortex and medulla -0.252 2.0e-1 -0.264 1.9e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.172 2.1e-1 -0.112 3.0e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.164 2.7e-1 -0.179 2.5e-1 16 Click to see details
GSE38226 Liver fibrosis 0.111 3.2e-1 0.184 2.1e-1 21 Click to see details
GSE17306 Multiple myeloma -0.06 3.4e-1 -0.169 1.2e-1 49 Click to see details
GSE32688 Pancreatic cancer -0.071 3.5e-1 0.061 3.7e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.062 3.8e-1 0.051 4.0e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.052 4.1e-1 -0.005 4.9e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.052 4.1e-1 -0.005 4.9e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.639 0 -0.606 0 18 Click to see details
KIRP -0.357 0.02 -0.398 0.01 32 Click to see details
LIHC -0.285 0.02 -0.303 0.02 49 Click to see details
STAD -0.335 0.03 -0.348 0.03 32 Click to see details
CHOL -0.632 0.03 -0.500 0.09 9 Click to see details
THCA -0.215 0.05 -0.259 0.02 59 Click to see details
HNSC -0.163 0.15 -0.168 0.14 42 Click to see details
ESCA -0.318 0.17 -0.345 0.15 11 Click to see details
COAD 0.32 0.22 0.262 0.27 8 Click to see details
LUAD 0.244 0.22 0.273 0.2 12 Click to see details
KIRC -0.084 0.25 -0.112 0.18 68 Click to see details
CESC 0.626 0.28 0.500 0.33 3 Click to see details
KICH -0.111 0.3 -0.037 0.43 25 Click to see details
LUSC -0.07 0.34 -0.105 0.27 38 Click to see details
BRCA 0.045 0.34 0.041 0.36 84 Click to see details
UCEC 0.071 0.39 -0.007 0.49 19 Click to see details
PCPG -0.342 0.39 -0.500 0.33 3 Click to see details
PRAD -0.026 0.43 -0.092 0.26 50 Click to see details
PAAD -0.063 0.47 0.000 0.5 4 Click to see details
PAAD -0.063 0.47 0.000 0.5 4 Click to see details
PAAD -0.063 0.47 0.000 0.5 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3