miRTarBase - #MIRT158519 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TNRC6B   
Synonyms -
Description trinucleotide repeat containing 6B
Transcript NM_001024843   
Other Transcripts NM_001162501 , NM_015088   
Expression
Putative miRNA Targets on TNRC6B
3'UTR of TNRC6B
(miRNA target sites are highlighted)
>TNRC6B|NM_001024843|3'UTR
   1 ACTTAGAACTTTCAACTCTGACCTCGTGACCTTTTTTGGAACAGCAGCAGCACTAACTTGACCTTTTCGTTTTTTTTTTC
  81 AACTTGCAATAAATACATTTTTAAAAGGAAAAAAGAAAACGGAGAGAAAAAAAGGTGGGTCATTGACAGACTGTCTGAGC
 161 ACATAGTTGCCTCCCTTATAACTTCAGTTTTTTCGTTTGGAATATGAATCCAAAAAGAGAACATATCACTCTTGAAATAC
 241 TTGAATCATGAACGCCAACCTAGAAAGACAATGTGAAGCAAGTACACATACCATTTAAATTTAAACACAAAAAAATTAAA
 321 AAAATTAGTTTCTAGTTTTTCACTTTTTTCATGTTATATGGAAGTTGTTGCTAAGAAACATATATACTGAAAAAAAATAG
 401 CTTTTTAACTTTGTTTGCACTGGGTGTGTTTCCGTCCTTAGGTCTACCATGTTTGGGAGGGAGGGAAATTCAAAAGAATT
 481 GTTGGGGGAGGGGGGAGGGAAGACTTGACGGAGCCTCACTTTAAAAACAAAAACACAAAAAACCTAAAAAAAAAAAAAAG
 561 GAAAAAATTTGTGATTGGCTGGTTGATAAATACCAGTGTGTTCTGGCACATGTAACTGCCCAGGCATGCTCGTTCTGGTG
 641 TGTGTGTGCACGTGTGTTCATGTGCATTCGCGTGCATCCTTCTCTGTCTCTGTGTGTGTGCCTGTGTTCTTCCCTTCTCC
 721 CCTGCCCCACCCTGACTTCTCAGAAAGCTGCATCGCTGACAGTCTGCAGGCTGGCTGGCCGGCCCATCTGCTTTTTATTT
 801 TATTTTTTTAACTATGAGAACACACAGGCCCGGAGAGCCACTGCTACTAAAGCAACTCCATTGGGCTGCATTAAGATGAA
 881 CAGAGTGCTTTTTAATGATGAAAGCAGGGAGCTCCTTTCCATTTGCAACTTAGCCTGAATGTGGGGTTTCTCTGGCTGTT
 961 CTTTTGACCTAGCAGTAGAGTGGAGCACTGCCAAGTCCAAAAAACTAGAGCAGGAGGTACCTCTTGGAGCAACGGTGTGT
1041 TTATTTCTGTTTTTTTTTTTTTTTAAGTGAATGGCCACCAGGCACATCTGAGTATCTGTTAAGTTTCATGCAGGCCTTTT
1121 CGTTAGTTTGAAATGGGAACGGAAGATAACTTTTGATGATGCGATGTCTCAAAAACAGAGAAACTTTGTTCCCTCTTTCC
1201 TTATGATCAGGTTTGAGAAATTCTTCAAAAAATTAGGTGAAGTTGAGTTACATATTTCTGTTGGTTGGTTCTCTTTTTCA
1281 TTTTATGAAAACAGAAAAGAATAAGTGGTGAGCAGCCTCCTGAAAGCATCTGCAGCTACTCCCTCTGCTCCTTTCTCGCC
1361 GAGCGTTACCTGTGCCAGGCCGTGGCGCGTTACAGCACCAGGCCATCACTGACAGAAACGTTTACTTAACGAATGTTCTT
1441 AAACCAGTGTGTACTTCAAGCGTTTCCTTTTGTTTCTCTGTGTTGTGTATTTCCTGTGTATGTGGTTTTGCTTAGGCAGG
1521 TATAACTTAGCGAAGACTTTTAAGTATTGCACCTTTTTTTGATTTTTGACCTCTTCCCCCCACCTTGTAATTTTGCTTTT
1601 TTAATTTCGGTATTTAAATACTTTTTTTTTTTTTTAAGCATCAATGTAGTAGTACTCTGGGCCGAACAGGGGTCAACGTT
1681 TAATCTACAGTTATCACCAACATGTATGTACTTATGTCGGAATCAAAATGTATCAAACTGCTTATTGTGAAGAGAATTAT
1761 AGCAGACCTGAAGGGGGCGAAAAACCAGATAGGGTGGGGGGATGGATGCCGGTGACGTGCTAGCACTTGTGTGGACATCC
1841 CAGTCTGCATTATGCTGTTTAACATAAAGTGCCGACATTTTGTACCAGCAAATACCTGCCCATTCCAACCCTTGGTGGGA
1921 GCAGACCTCTACTGTCCTCTGTAACTTGCTGCTATTGAGGACAAGGGAGTTTTTCTTTCTTTAGCGTCTTCAGTGAAGGA
2001 TACAATACAACAATGCCTAATGTATTTGACTTTTTAGCTTGTGTCTGTGTGTAGGTGGGTGGGTGGGTGTGTATAGGAAA
2081 AGCCTAAAACAAGTTATTTGCATTTCAGTGGTTTTGTGAGACAAAGAATGGGAAATTCTGTAGCCCTTCTGGCTTACCCT
2161 GTTGATTATAAACCTAGCCTCAAAAGAGATTGACAGGCATGACTCAAGTGAGTGTTCACATATACAAGCCTGCATGAGCC
2241 CTCTGTGGGTAGGTGGTCACACTTGGCATCTGCAGCATTGACGTGGCCCCGCTGGGTGCCTTGAGCATGCCCTCTTCCTG
2321 CTCTGCAATTTGAATCACCACCGTGCCCCTTCCACCACTGTTCCCCATGCAAAAGCTCTGCTTCCAGCAGCCCCCACTGA
2401 CCGCTCTCTGTGTGGAGCAAAGTGCTGTCGTGCGGTGACCACCAGGTGAAGAGCAGCTTGTATTCAGACATCTAGAGAAG
2481 GTTAAATCTTAGTGTCCCTGGGCCAGGAGCATATCCCAAGGCTCCTGCGAGCCAGTGGCGACCCTGTCCACTGCCGCTCT
2561 TGGTTCACTGCTGTGTCCTGCCCCACCCTCCTCTCCTCCTGCCTGTTGGTTCCTTGACCTGCACTATGGGTTAGTTGAGT
2641 TCCTTACGATACTACGGTGAAAGCCGGGTGCTAGAGCCCCTCTTGTTTACAAGACATAATGAGGGATTTGAAATATGTAA
2721 AAATAAACATGAGAAGCTAAAATGTTCTTCCATCATAAGCTTAAAGGGAAAAAAACTAAAAACTTTAAAAAAAAAAGACC
2801 AAAAAGTGCGTATATATATACATATAAATATATATTTTAGATGAAGACTAACTCTGGGAGCATTTAACAGTGTTTTTTGT
2881 TTCTGTTTTTAACATTTGTTTTCCTGCTTTAAAATTTGCAAGCATTCTCAGGAATTCTAGGGTAGGAAGCCAGTTTTTTG
2961 AAGATGGTTTATTTAACCATATCTTATCCTAGAGAGATGGCTGTTTCTTTCCTGTTAATAAACTTTTACAAGTTCCTGAA
3041 ACTTCAGAAAGTTTAAACAATTTTTACTTAAAAAAATGTAAAAAGAAAAGTCTCCAAACATTATTGTCATACTGGGGATC
3121 ACACATTTTAAAACACATAGAAATATTTTTTAAAAATTATCAATTTAGCAGCAACAGGTAAATTCATTATCTTAAAAATA
3201 TGGGAGAAGGATTAAGCTTTGTAAGAGCTCGATCATGGATTCTTTTGAAATTGTGTGTAGTTTAATGGGAGAGTGTTTGG
3281 TGTATATAGATGAGAATGCCATCACTTTGTTCCTTTCCATTTGAGACTGAACTGAAATCTCCCCTAGTAATTTTTATTTT
3361 TTTAAAGGAACCCTTCTCCTTGTCCCCACAACCCCAGCAACAAAAGAAAGGAAGGAAGGAAGAAACAACAGCTTAAAAAA
3441 AAAAGTAATCTGTAAAATAGTACAGTTGGATTGCTGAGAATCTATGTAAAGAGTTAGGAAATATAGGTTAATAATTTTTG
3521 GAACAAATTTTAAATATAGGCATTACTAGAGGAAAATTATCTATGGACTGTCCTATTAATGAAGAATGTCTGTCTTACCT
3601 CCGTTTGTTTTGGGAGGAGGAGAAAATATAGAAGAATCTAATAAGGAACAAGTGATTTTACTTTTTTAGCTCCCAGCTAC
3681 TGTTGTGCTCGTTTTAATTGCTGTTTTGAAGATCTGCTGCTTAATTATCCCCATCCCTTAGCCGGAGATGTGGAGTGTTT
3761 CCTTTCAGTTTTTGGTGATGTTGAATTCTTTTGTATTCCCTCCTGGGGCCAGGGGTCAGAATTCCCAAGCATGACCACAG
3841 CTTCTTTTAAACATTAAGCTTCCCAGTGGGAAGGAAACTCCAGCTCGACAGGTAAAGGGAGTGGGTGGGGTTGCTGCCTG
3921 CAATTTCTCTAAAACCGCTTTAGTGCCTTCGTACATACACCCAGACATCCTGAGCAAGGGGGACGCACATGTGTGTGTGT
4001 GTGGTCCAGTCACTCCACAGATGTAAGATACTCACCCATAAAGGAAATTGGAGTGGTTCTGGACAGGCCCCAAAGGCAGT
4081 GGGCTGAATTTAAAATAAATAAACAAACGTCAAGCAAGTTAATATGCTTATGTCTCAGTAATGTAGAATGCCAAGTTCCT
4161 TCCTGTGTCGTGTGCCCTCCATTACTGTGCATTGATTCCTCCAGGTGTGTAATTGTGACAACTGCAGTGATTTGGAAAGT
4241 CTCTTTGTCTTGGGCAAATAGAAGGGGTTCCTGTTGTTCTGCTCTTGTCCTTCGTCTCCTCCCCTTTTCCCCCAGACCTC
4321 CCCCTTCTTTTTGTCAACTTGCTGGGAGCTTTGCTTTATTGGTTGGCAGTGACCTAAGAACAGGATATGGTGAGGATGTC
4401 ATGGAAGAGAAGAGCTCTTTCCGTGGTATTCTTTGGCAAGAGCCATGTCTACTAAGAGGTTAGATGACTTCAGTATACTT
4481 ATAAAATTCAGTGAGAGTGCCTTCTTCTCTTCTACCACACTCTGGCATAGATACAGGCTTGCTGGTCACCTCTCATTACA
4561 TAGATTTATTTTAAAAACATTTTGATTATGTTAATTTGAGCTTTCCCTTTTTTTTTTTTAACTACTTTTTAAAACACTTG
4641 ATTACTAGTGGCTTAGAGGTGTGTACATCTCCTGAACATCACAAACTTGGTTTCTACCTACCACACGAGTAGCCAAAAGA
4721 AAAGAAGCACTAATAGAGAAAGGGGTGTCTCACACCAGACAGAGGACCTCTGCTGTCAATTAGATCCAGTATCATGACCT
4801 AACTTTAAGTGTGGAAAAGAGTTCAGATCTCTGAGACACTGTGAAGAAATGGATGGCTCATGTAACATCTCTGATCCCTC
4881 AGTCCCCAACCCTGGACGTGTTTCATTTACAACATTCATAGGAGTTAACTTAGCAGTGTTGCAAGTTAAGGTTCCAAACC
4961 AAATTATTTAATCAGTGTCCCCCCAATAAATCACTTATCCATTTATTGCTAGTTAGTTTTATTTATAGCAACTTGATTTC
5041 CTATGAGTATGGCTCCTGTTGTAAGAATTTTCCCACCTCTTCTGACATGAATGTAGCATAAGTTAGCAATCGGTTCTTCC
5121 AAACTCCTGTGGGTTGAATATGGTATAGAAGGTATGCAAGAGGAAAAAGAAAGGAAAAGATAAAACTCCTGCCTGAGAAT
5201 TTGGAAGCACCTTTATTAACACATATATCTCGCAGAAACTAGAAGCTCATAGGCTGTTAACTTTTTGCAACTATTCACTC
5281 ATTTTTACCACTTTTTTTTTTGGGTGAGGGGGTGATTTTTGTAAGGTTAACAGCCAGATTCCATTTTGACCTCAGATGCT
5361 GTGTACTTTTTAATTTCATTTTTTATATTCTGCCATCTTGACTCTTCTCTAAAACAGAATGAAAATGTCTGCATGCTGAG
5441 CAAAATGCTTACGCCAAGCCTGTTTTTCTCTGCAGAGTAAACAGGATGTTTTCAGCAGACTTGGCTCTAATAGCCATCTC
5521 TAAGATTAGGGAACAATTGAGTCTTTATGTAGAAAAGATCCATTTTTTCCCCATCCTCAGAGTTAAAATTCAACATTTAA
5601 AGCTTTATCGGTTATTGTTTTAGATTTGAGATTTTTGTTTTTAAGTATCTATAAGATCTTTAGAAGTGAGATAAATTTTT
5681 CGCTGGTTAAAAAAAATCAAACTTTCCTCTGCAGTGTTTTTGCCAAGTTTTGTCACACTTCATGTGTATGCATTAACTAT
5761 ACTTCTTAGTGTTACTGCAAAAAAAAAAAACAAAAACAAAACAAAAAAAAGCCTTGTTCTTTAATTGTGTTTTTCCTCCT
5841 GTGAGTGGACAACTAAAGCCGCGTGATGATGCGGATGAAAATATTCTGGTCTGTGTGTATACAATGAATTGTCAGTCTTC
5921 AGACCTCATGGTCGTTAAGAAAATAGGGAACTCACAAACCCTGCTGCGCACTACATTTACTTCTTTATCTGCAAGTACAG
6001 GGAGTCCATACAGTCAAGAAACACACAGATACACATAATGCTATTGAGGACATTGTCATTCTGTAAGAAAACAGAATATT
6081 ATCTAGATTTCCAGAGTTAGTGCAGACCCTGTGATAACAGTCTGTGGGTTTGTGGCCAGCGCCAAAGGTGTGTGTATTTT
6161 CAGAAATGGTCCCTATTTGTCAGTGATAGTGTTTTTTTTTTCTTAAGTTTGACAAAGGGGGTGGTAATATCACATTCTTT
6241 AGATTTGAAATAATTATCAGCTCCAAGAATCTGTGAACATAGTAATAACAATAAAAATTCAACATCGACCCTCCCTAACC
6321 TGCTCACCATACCTCCCCACCCCATGCCTCTGAAGAAAGAGGCCATGAACCTACGAGGTGGTAAAGGGGGACACAGGTCA
6401 GGGAGTGGAGAGCTACTCCTCCAGCAGCTCAGCACCCACACTGCCCGCATGCGTGTGGCCACCGGGACCAGATCCCGAGT
6481 GATTGTGGCATACCCCTAATATTTGAGTAGTTTTTAAGCTGTCAGTCTCTTGTCATAACCTCCTACCGCCACCCAAAAAA
6561 GTAACGAAAGTTGCAGTAACTGCCAGTGTTTGCCTCACCAAATTTAAATCGTTCCCTTTTCAGTTAGCTATATACCTGAA
6641 TTTGTTTTTAACAAGAAACTGTACATGGCCAGGAAAAATGGTACTACCTTGGCCAAAGGGTCTTTGCAAAAAGCTCAGTC
6721 TTCAGTTCTTCACTGTGACAAATGCTTATCTTGTTCATGGGAGGGGAAAGATCAGATAAATAGGCAAGAAGTACTCTGTT
6801 TTAAATAAAGAATAAATAGTGTCCGTTTAAAGCACTTTGTGCCTCAACTTCATTTTTAAACTGTAAATCATTGCTTTGGA
6881 AATAAATTCCCAATTATAATTGACCCATATCTAGCCAATATCAACAAGTTGGGATGGTTTTTGTTTTTTTCTTTTTTTTC
6961 AAAAAGGGAAATTCCTCTTTACTGCTCACAGTAAGCTGCAAAAGAAAGTTGTCAAGGTGGCTTATGATGCTGTTGTAGCA
7041 GAGCTGTGAAAGGAAGTGCTTTGCTTTCTCTCCCGCCTTCCGGAATCTGGCGTTCCTTCCCCTTCGGCTACTGAAAGGTG
7121 TGTACAACTCCCAGAGGGGTGGCTGTAAAAGTTGACTGGAGGCAAAGTGGAGTGGCCTTATTGCCAGGACTAGCCCTACA
7201 GAAGAGCTTTACAGAGAGGAGGACAGTACATCCTATGTGTGTTCGCCAAAAATGGGAAAGGTGGGTATTTAGGCAAAACA
7281 AAATAAAAACCTTTGGAACCCTTTAAGAAGTTACATACCTTTTAAAGGTAGTATAGTTTCTCACCAAGTGATGCATTTTA
7361 GCATGACACTTCTTGCCAGAAATTTTGGGATAAGTTGGAATAAATGTGTTTAAAACATCATCCACCGCCCTTTTTAAATT
7441 TTGTCTAAGGAATTACTTAAGTATAGTATTTCTGAATGTGCCTTTGTGAGTACAGAGACCGTCCGTTCTAGGAAGAAGCT
7521 ATCCGTTGGATACAAACAAACAGACGGTCAGCTTTAGTCATTAGGGAAGTCAAAGTTCCTCCTGGAAGTCCCAGGAGCAG
7601 CTGTTGAGATTTCATTAGCATCAATATTGCACAGTGTAGAGTTGAGTGGAAGAGATTCTGGGACTTGGGAGAGGAGACAG
7681 GGGAAGGTACCCAGGCGACGCAGACCCACGTTAGTCCAAGAGCGCAGGTTTACACATCTGCATTCCCTAGTTTTCTCCGT
7761 CTGTATGTTTGTGCTCATGTGGCTTTGGCTGTTTTGTTTTTTGTTTTTCTGTAAGCACTGGAGAATTGGAATATGGTGAT
7841 ACTTGTGACACATTCATGCATGTAAACAAGGCATTTTCCAGCTTCTGCCGTGTGCAGAGCGGGCAGCACGCTTTTACCCT
7921 TTGAGTCTGTGTCCTGAGGCGGCCATTACATTCCCACATGGGCGTCACATCACGTTGCTGTTGATGCAAACAGGGTATTA
8001 CACACAAGGAAAAGGGGTTTTGAAGAGTTAAGATTGAAGTGTTTGAGAAAGAAAAGAGAAAAATCTGAAATCATATTTTA
8081 TTTCTTCAGAGCTATTATAGTTGAACACAGAAATCTGCAGTGTCTTTATTTGTTTTTATGTTTTAAACAATTTCACCTCT
8161 TCTCCCCACTCCTATCTTCTAAAGAAATATCAAGCAAATGCTAAGGGCCATTTCCATGATTCCTCAGAGCTCCCCCAAAG
8241 AGGAGAACAGTCCCTCCCACTCGATTCCTTCAGCTTCATTCAGGAAGACACAGGGAGGAGAGATGCTGCTTCTGCGCTTT
8321 GCTCTCATTCCTCTCTCATGGCCTTGAAATGTATTATTATGCAAATGTGAATTTTGATACTGAATTTAAGAAGAGGTTGT
8401 TGGATTTTTTTTTTTTTTTTTTTTTTTTTCAAAAAAAAAAGTCCCACATGTGGTCATCGTCGCTTCTTTATGTTGTAAGG
8481 TGAATTGTAACTATGCATTCTGCAAAGGGGGTGGGGAGGAGAGGGCAGAAAGGGGAAGGGAGTAGCGTTGCATCCTTGTT
8561 CTTCAGTTTCTGTGTCCATGGTGTCCCCGTGTCCTGGAGGGGAAGGGGAGTGAGAGACGAATGTGGTAAGGTCAGCACAG
8641 TGAGATAGAGACCTCTGAGTCCTCTTGCCACTGTTGCTGGCAGGTCTGATGGCCAGGTAAATTCCAGGGGGCCTGCAGTT
8721 CCTGTCAACCAATGTGGTTCAGGATTCTTGATCCTAGCCGTGCAGTGTTAATCCAGTGCAGCAATGGAACTCCACAGGCT
8801 CCAGTGTTCTCTGGAAAAAGTACTCATCCTTTCCTGAATTCAGAGCCCTTCAAGCTCAGGAAACCACGCTTCACTCGTGC
8881 TGACCTGAAAGTTAATCTTTAGGTCGATTTTGAAAAACTCCGCCTCCTCTCTCCTTTTTAATATTTCTTTCTTCCTTTTT
8961 AATCATGTTTAAGTGAACTTACTCTTAGTTATAAGGAACTGTCCTGCTTTGTGGGGAAGAGGGCTGTTGCTTGTCAGGCA
9041 AAAAAGTTTTCTCTTCCTACCCACCATCCCTCTCTCTGCTTCCCTTGCATTTGGCAGGCTGTATGAAGCCAATGAGCTGC
9121 GAGGTGTTTTGACAGGGGAGGTCTGCATGCAGCCTCTTCTTTGTCCTAACAATTCCTTTGTTGATCTTGCCTGTGATGAA
9201 TCATAGCGCCTGCATTGCTCTGGTCTAGGCATTATTTGCAACACACAGTATCGTAAGCGAGAGATTGTTCTGCCTATATT
9281 CAGTGTTTTCCATGCAGCAATTCTTCTTGTTGACGTTCACAGTACTGTAACGAGTAACAGACTTGATCACAGTCTCCTCG
9361 TGCCTGTGCAGGGCTGCACAGGCATGATCTTATCAGGGTTCCAATCTGTTAGATTGCCTTTAAACAAAAAAAACAACAAA
9441 AAAATAAAATCCTGACGTTTCAACTGTCTCACACAAAATAATACCTCGAGGTACATTTCCCCCTGCAATGTAAACCCTTA
9521 ACTCCTCTCTCCTTTCTGACATCAGTGGATTATCCTTTTTAAAATATGAACATGTAAATAGCAGGATAACTTTAAAAAAC
9601 ATTTTCTTTGCTGTGAAAGTAACCCTAAAATATGTTTTCTTCTTTTGTATTTTTTTGGTTTTTGTTTTTAAGCCATCAGA
9681 AGTTTCAGATCTTTACTCTTTCATGTTTAAGAAGAAAGAGCAGAGGAGGTCGGGGGAGCCGGTTTGCATTTGTGTTGGAG
9761 GGGTGTTATCTCCATTGCCTCCCACACAGTGACAGCAGACCAGTATGTAAACCCTGTCTTGGCTGGGCGCGGTGGCTCAC
9841 ACCAGTAATCCCAGCACTTTGGGAGGCTGAGGCAGGCAGATCATCTGAGGTCAGGAGTTTAAGACCAGCCTGGCCAACAT
9921 GGTGAAACCCCGTCTCTACTAAAAAATTAGCCGGACGCAGTGGCGCGCGCCTGTGGTCCCAGCTGCTCGGGAGGCTAAGG
10001 CAGGAGAATTGCTTGAACCCGGGAGACGGAGGTTGCGGTGAGCCGAGATTGCACCACTGCACTCCAGTGTGGGCAACAGA
10081 GCAAGACTTCGACTCAAAAACATAAAATAAACAAAAGACACACACACACACAAAAACCCTGTCTTAAATAGCTGCCATCT
10161 CTTCCAGCAATCTAGTGCCAGGGTAAGAAGTGTCTGAATTTCTCTCTTCCAGCAGATCCATCCCCTGCAGGGACTCCAGA
10241 ATGTTCTCCACACAATACCTGGAGCTCTCAACCTTTCTTGGTTCAGACACACACATACACACCCCTTGAGTAACTCAGTA
10321 TCATTTTGTAGTTCACAGAAGGATGTAGTCCCTGGCATTTTGGTTTGCACTGTAGAATCCATAGCCTTGTCACTTTGTTA
10401 TGCTCTGGAAATGTACTGATTTCTTACTTGGGAGGAAACTTGTGTAAGGAGATGTGCAAACCACCCTGAAAGCCATGTGC
10481 ATCCTCACCTCTTCCATTACCCCCTCCATGAGCTCGAAGCGACATTAAGTAGAGGGAAATGCTTTTAACAAATGCTGCTC
10561 ATGTGGATCTGTCAGCTATTGCTTGCCTAGATTTGGGCACCCATGAAGCAGGGTTGGAATGGATCATTTTGAATTGCTTC
10641 TTTGCAGACACCCCCTTCGCCCCCATCTTTAAGATAAACCCTTTACTAGTCAAGAAGCCCTTTTCAGTTGGATCTCACTG
10721 ATCTTGTATAGTGACGACTTCCTTTGAAGGAAGAAGCTTGATTATAAGTGCATGCATATTATCCACCCACCTTCTGATTT
10801 GGGCACTGTTCACCTTGGAATTTTATTTATTTTGTTTATCTGGAGGCCCTTTTTCTATCAGTCTCTGATCCCTCATGGGT
10881 TCTGCCTGCCCTTGTATCTCTTGTACAATGCTCCCAAAGGGCTTTGCTGATCTCTGCACTTCTTTCCTGGGACACTCCCC
10961 CCACCACCACCCTTTGCACACACCAGTGACCAAAGTGTATGCAGTGATCTCACAGAAGACATCAAAAATGGTGCATGCAC
11041 CGTGAATGTGCTCACAGAGACACGTGCACAAGATTCTGCACCCTTGGCCTTAATCTCAGTATGACTTAAGGTGCAGGAAC
11121 ATTTTTAACAGGTTTTAAAAAAACAAAAAACCCTTCTGGGAGGAAAAAAATAAAAAGCAGATACAACAGCTCAACTGTTC
11201 CCACTCCTAACTCTCCACTATGTGCTTATAACTTCACATTCTATGCCCTCCCCGCCACCCACCTCATCCCTGTTCTGCGT
11281 AACCAAAAAACAGACAACAAAAGCAACCTGAGGAGAGGTTTCTGGACTATTTTATCTGTCTCCATTTAGATGGAGATATA
11361 AATGCTGCTTTGGGTTCCATAATCCTAGGGGGCTATGTTTACATAGTAAAATACATCCTACCAAATCAGGAAACAGTGAA
11441 TAATGGGAGTCACTTCACAGAGACGCAGGAGGACCTGGGGGGCGTAGCAGAGGAGGATAGGTAGAGAAGTACCATTTTAA
11521 TTATTTGTGACTTGTGGCTTCCTTCCTCCTCTCCTCCTCCCTCCACGTCTCTCTTTGCCCCCTTTAGACAGAAGGTGCAG
11601 AAAAGGGCATCAAAAAGAGGCTGGATTTTTTAAAAGGCAGCTTTCCAACTTTGCACACAAACAGGTAACAGGAAGGTACA
11681 GCAAAAATCCTCTCATCTGAAACACTGTCAGCAGAAACAAAACCTGTAAAAATGACTAATCAGCTGCACATATTGATGCT
11761 CTCTGCAAGTTACCTTTAAGTGTTTTTTTTTTCTTATACTTGAAGTTGCTTTTACGATATTATTTTGGTGGCTTTCTTTT
11841 CTCTCTTTGATGGGCAATAGAGGAAGTAGATAATGGGATTTAAGGACGCCTGGGGGAGAAAAGGGAGGATGTGGCATTGT
11921 CTTTTTTTTTTTTTTTTTTTTTTTTTTTAGCATAGAGGTTTAATCAAACTCCCATATGTTGAAATTGCTCCTCATATTAC
12001 TGGTTTTACATGGACACAGAAACTAGGCACTTTAGAGGTGCACTTGCATGGCAGGCTGGGCCCCCTTTTCTATATTTTAT
12081 TTTCCTTTTTAGTATAGTGGTACTTAAAATCACTGGTTCACTTAAAAAAACAAACAATAAAATGTTAAACTCTACTAATG
12161 TACAAATAAGCTGAAAAGTTGCATTTTATGTGTATTTTTTGCCATAGCAGGTACTGTATTTCTCATGCTGGATTTCAAAA
12241 AAAAAAAAAAAAGTATCAAAAACAAAAAAAACTAAAGGGTGGTGTTTTATTGGATTGTGACAGGTTGAGTAATAAGGAAT
12321 TAAGTCGTCGTCATTTCATTAAAACTGAGAGATGATGTAATGCATATATAAGAGTTTTCTGAAGGGTTTTTTTTGGGCTT
12401 TTAAACAGCTTATTTTTGTTTTTGTTTAGTTTTTTTATTTTATTTTATTTTGGAAAGATATGATTGTATTATGTGCAACT
12481 CAGTTGCTTACATTATAACTACAAAATATTTTTGGGTTCCTGGAAAAAAAAGAAAAAAGACTAATAAATGTGTTTGGCTG
12561 CTAAGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |::| |  ||||||| 
Target 5' tgtcctCTGTAACTTGCTGCTa 3'
1933 - 1954 148.00 -11.40
2
miRNA  3' guGUU--UGGUAA------UACACGACGAu 5'
            :||  :|::||      || ||||||| 
Target 5' ttTAATTGCTGTTTTGAAGATCTGCTGCTt 3'
3693 - 3722 148.00 -9.50
3
miRNA  3' guGUUUGGU--AAUAC-ACGACGAu 5'
            |||: ::  ||||| |||||:| 
Target 5' gtCAAGGTGGCTTATGATGCTGTTg 3'
7011 - 7035 146.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31574557 7 COSMIC
COSN30171003 10 COSMIC
COSN30481981 14 COSMIC
COSN30152400 21 COSMIC
COSN30507897 26 COSMIC
COSN13916766 47 COSMIC
COSN30463433 69 COSMIC
COSN27585931 80 COSMIC
COSN13916767 83 COSMIC
COSN10030680 88 COSMIC
COSN31491973 109 COSMIC
COSN18743800 134 COSMIC
COSN31484727 150 COSMIC
COSN31525560 195 COSMIC
COSN31547788 323 COSMIC
COSN31533769 325 COSMIC
COSN30173653 326 COSMIC
COSN28717285 484 COSMIC
COSN32064625 490 COSMIC
COSN31514666 569 COSMIC
COSN30173451 586 COSMIC
COSN1262157 652 COSMIC
COSN29574439 753 COSMIC
COSN30173460 879 COSMIC
COSN26583271 916 COSMIC
COSN29073013 927 COSMIC
COSN26601725 1050 COSMIC
COSN20117477 1065 COSMIC
COSN22024418 1177 COSMIC
COSN5455986 1348 COSMIC
COSN28801231 1460 COSMIC
COSN8612740 1461 COSMIC
COSN31572359 1462 COSMIC
COSN31489659 1609 COSMIC
COSN31540867 1986 COSMIC
COSN26583768 2023 COSMIC
COSN8018995 2111 COSMIC
COSN8018996 2150 COSMIC
COSN30169828 2189 COSMIC
COSN1262158 2415 COSMIC
COSN31481823 2435 COSMIC
COSN31548141 2516 COSMIC
COSN31779382 2529 COSMIC
COSN31540630 2572 COSMIC
COSN19566850 2657 COSMIC
COSN26642329 2751 COSMIC
COSN29952028 2797 COSMIC
COSN31545884 2811 COSMIC
COSN31551858 2879 COSMIC
COSN31567558 3008 COSMIC
COSN31520647 3054 COSMIC
COSN31554898 3077 COSMIC
COSN31579729 3125 COSMIC
COSN5992757 3342 COSMIC
COSN30158130 3407 COSMIC
COSN29554841 3454 COSMIC
COSN31533759 3604 COSMIC
COSN22083736 3630 COSMIC
COSN31517008 3707 COSMIC
COSN31562567 3859 COSMIC
COSN31593989 3879 COSMIC
COSN26637947 4005 COSMIC
COSN1899289 4100 COSMIC
COSN1899290 4102 COSMIC
COSN1899291 4376 COSMIC
COSN22507861 4496 COSMIC
COSN22222861 4595 COSMIC
COSN27204116 4620 COSMIC
COSN1262159 4977 COSMIC
COSN25371605 4984 COSMIC
COSN5992758 5042 COSMIC
COSN22742591 5170 COSMIC
COSN29388061 5265 COSMIC
COSN8010737 5277 COSMIC
COSN27210844 5302 COSMIC
COSN28975178 5302 COSMIC
COSN1899292 5560 COSMIC
COSN28978766 5775 COSMIC
COSN20117478 5791 COSMIC
COSN27513184 5791 COSMIC
COSN46363 5792 COSMIC
COSN25446232 5811 COSMIC
COSN5992759 6051 COSMIC
COSN27442317 6202 COSMIC
COSN16433209 6536 COSMIC
COSN32056178 6562 COSMIC
COSN32055812 6566 COSMIC
COSN9166207 6611 COSMIC
COSN17544649 6648 COSMIC
COSN27266365 6746 COSMIC
COSN24588989 7355 COSMIC
COSN28736226 7505 COSMIC
COSN22818952 7509 COSMIC
COSN8612741 7594 COSMIC
COSN16831206 7643 COSMIC
COSN26642851 7674 COSMIC
COSN31534777 7770 COSMIC
COSN31541612 7803 COSMIC
COSN10030681 7987 COSMIC
COSN26556717 7987 COSMIC
COSN30174405 8026 COSMIC
COSN8997426 8074 COSMIC
COSN1899293 8184 COSMIC
COSN31578859 8269 COSMIC
COSN31552628 8396 COSMIC
COSN26583884 8405 COSMIC
COSN28626121 8431 COSMIC
COSN31518596 8432 COSMIC
COSN24307419 8478 COSMIC
COSN24307352 8725 COSMIC
COSN31589486 8760 COSMIC
COSN28202196 8761 COSMIC
COSN26637948 8799 COSMIC
COSN9166208 8878 COSMIC
COSN31597021 8922 COSMIC
COSN31517557 8952 COSMIC
COSN31480675 9003 COSMIC
COSN1899294 9068 COSMIC
COSN26633697 9219 COSMIC
COSN15590858 9242 COSMIC
COSN26604199 9260 COSMIC
COSN31571561 9291 COSMIC
COSN20117481 9307 COSMIC
COSN31566594 9341 COSMIC
COSN31551980 9351 COSMIC
COSN5771338 9375 COSMIC
COSN31490204 9471 COSMIC
COSN15910852 9765 COSMIC
COSN26050693 9788 COSMIC
COSN17017466 9802 COSMIC
COSN28823072 10043 COSMIC
COSN31589202 10133 COSMIC
COSN16460636 10239 COSMIC
COSN30445720 10357 COSMIC
COSN19663855 10370 COSMIC
COSN31480984 10487 COSMIC
COSN31611340 10521 COSMIC
COSN8612742 10757 COSMIC
COSN19288562 10782 COSMIC
COSN31536645 10819 COSMIC
COSN26668153 10901 COSMIC
COSN8612743 10920 COSMIC
COSN8010738 10938 COSMIC
COSN32230334 11043 COSMIC
COSN23285445 11325 COSMIC
COSN23744525 11328 COSMIC
COSN28201779 11481 COSMIC
COSN28777418 11596 COSMIC
COSN31489223 11700 COSMIC
COSN31481064 11742 COSMIC
COSN1899295 11763 COSMIC
COSN5771339 11776 COSMIC
COSN27448072 11793 COSMIC
COSN22656373 11816 COSMIC
COSN30173525 11895 COSMIC
COSN28811165 11953 COSMIC
COSN26583641 12189 COSMIC
COSN29468562 12191 COSMIC
COSN31566567 12197 COSMIC
COSN26783305 12204 COSMIC
COSN26561639 12217 COSMIC
COSN20117483 12253 COSMIC
COSN26643931 12318 COSMIC
COSN31490721 12338 COSMIC
COSN30540237 12356 COSMIC
COSN31485125 12373 COSMIC
COSN28636242 12449 COSMIC
COSN8612744 12452 COSMIC
COSN20117486 12532 COSMIC
rs139919 6939 GWAS
rs139920 7505 GWAS
rs470113 10370 GWAS
rs11703324 11890 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747562865 2 dbSNP
rs1171894523 5 dbSNP
rs768994589 7 dbSNP
rs772806863 16 dbSNP
rs1276105552 26 dbSNP
rs762088147 26 dbSNP
rs762588590 27 dbSNP
rs1352985940 30 dbSNP
rs1368875414 30 dbSNP
rs774200912 32 dbSNP
rs1302482197 33 dbSNP
rs1333187265 36 dbSNP
rs759260430 39 dbSNP
rs1048740330 44 dbSNP
rs888781000 45 dbSNP
rs755964829 47 dbSNP
rs775092050 48 dbSNP
rs760686995 49 dbSNP
rs1387443598 62 dbSNP
rs1156550587 69 dbSNP
rs1007465363 70 dbSNP
rs1018871398 70 dbSNP
rs1401912912 70 dbSNP
rs879148974 71 dbSNP
rs778985843 75 dbSNP
rs1185796085 76 dbSNP
rs1433159695 80 dbSNP
rs1462098853 81 dbSNP
rs1293225385 84 dbSNP
rs1306682058 87 dbSNP
rs1009423744 94 dbSNP
rs1213979521 96 dbSNP
rs745924667 102 dbSNP
rs758607021 103 dbSNP
rs1227816763 104 dbSNP
rs1354101732 107 dbSNP
rs758658538 112 dbSNP
rs766370279 115 dbSNP
rs1212533544 120 dbSNP
rs979491764 121 dbSNP
rs1466030039 122 dbSNP
rs1033717699 123 dbSNP
rs1261534022 125 dbSNP
rs959350160 127 dbSNP
rs944305557 133 dbSNP
rs1322253050 134 dbSNP
rs1403146827 138 dbSNP
rs1364220345 148 dbSNP
rs992531854 151 dbSNP
rs1445605506 153 dbSNP
rs780247953 157 dbSNP
rs901537164 164 dbSNP
rs1185144764 172 dbSNP
rs1476489267 176 dbSNP
rs1242934804 181 dbSNP
rs1461329773 195 dbSNP
rs1160076780 196 dbSNP
rs1390883733 201 dbSNP
rs1223063876 203 dbSNP
rs918177405 205 dbSNP
rs940242733 217 dbSNP
rs995781500 218 dbSNP
rs116400922 242 dbSNP
rs1216134285 249 dbSNP
rs1273920493 252 dbSNP
rs1433670108 255 dbSNP
rs1366960350 257 dbSNP
rs1028740548 261 dbSNP
rs972937617 262 dbSNP
rs1455886153 263 dbSNP
rs920079857 264 dbSNP
rs1288530012 267 dbSNP
rs1168713239 270 dbSNP
rs892894415 277 dbSNP
rs1011240189 289 dbSNP
rs764369121 296 dbSNP
rs1190894064 300 dbSNP
rs1479588739 307 dbSNP
rs550974427 309 dbSNP
rs755436177 309 dbSNP
rs1020552579 315 dbSNP
rs967207136 317 dbSNP
rs888831868 318 dbSNP
rs981794366 319 dbSNP
rs1307927294 327 dbSNP
rs1277462199 328 dbSNP
rs1040422987 329 dbSNP
rs901774052 334 dbSNP
rs1009886596 351 dbSNP
rs1035594385 352 dbSNP
rs1408708908 358 dbSNP
rs1314538852 359 dbSNP
rs1042246421 368 dbSNP
rs1444803377 372 dbSNP
rs1355424578 380 dbSNP
rs1175806739 381 dbSNP
rs903684948 383 dbSNP
rs1000983209 390 dbSNP
rs1468396952 390 dbSNP
rs1177217697 402 dbSNP
rs1033769913 417 dbSNP
rs1248324182 424 dbSNP
rs1178937918 434 dbSNP
rs1353548812 435 dbSNP
rs1236614284 438 dbSNP
rs1201567396 439 dbSNP
rs959405147 450 dbSNP
rs1232597354 460 dbSNP
rs879020602 472 dbSNP
rs1013605296 473 dbSNP
rs1025366102 474 dbSNP
rs1314681006 479 dbSNP
rs1308539610 480 dbSNP
rs1393581784 482 dbSNP
rs1330578588 483 dbSNP
rs1336432433 484 dbSNP
rs879191461 484 dbSNP
rs1450981645 486 dbSNP
rs879091013 490 dbSNP
rs1259815733 491 dbSNP
rs12485008 492 dbSNP
rs1183982063 493 dbSNP
rs1181499248 496 dbSNP
rs1255835754 497 dbSNP
rs1243369108 498 dbSNP
rs1207654086 500 dbSNP
rs1484693605 501 dbSNP
rs1261934046 503 dbSNP
rs1239168905 505 dbSNP
rs1475189388 505 dbSNP
rs973394489 506 dbSNP
rs1315018171 510 dbSNP
rs920128898 511 dbSNP
rs952890024 515 dbSNP
rs1316187111 517 dbSNP
rs1381796721 529 dbSNP
rs545620632 534 dbSNP
rs1414766285 537 dbSNP
rs1454415442 537 dbSNP
rs368241667 544 dbSNP
rs1263472799 546 dbSNP
rs1349195749 546 dbSNP
rs1426318440 546 dbSNP
rs398061938 546 dbSNP
rs552611800 546 dbSNP
rs778819893 546 dbSNP
rs1205174413 547 dbSNP
rs1487912321 554 dbSNP
rs1417432451 559 dbSNP
rs566859164 565 dbSNP
rs958733312 567 dbSNP
rs1362227636 578 dbSNP
rs991478805 583 dbSNP
rs1227181342 586 dbSNP
rs1359977365 587 dbSNP
rs1324885007 599 dbSNP
rs1298047420 601 dbSNP
rs1382840258 604 dbSNP
rs919892239 612 dbSNP
rs931388863 614 dbSNP
rs1040070263 623 dbSNP
rs982841464 627 dbSNP
rs908717837 632 dbSNP
rs945351835 633 dbSNP
rs1042688492 648 dbSNP
rs184244462 650 dbSNP
rs1374433169 652 dbSNP
rs1414146595 653 dbSNP
rs778034508 655 dbSNP
rs1432249130 658 dbSNP
rs944209348 659 dbSNP
rs1200996120 661 dbSNP
rs1041720850 662 dbSNP
rs769074140 668 dbSNP
rs931684565 670 dbSNP
rs558746275 671 dbSNP
rs1253276051 672 dbSNP
rs1228350733 673 dbSNP
rs1312472693 677 dbSNP
rs1211797654 679 dbSNP
rs892778807 686 dbSNP
rs1011292553 689 dbSNP
rs1346039609 691 dbSNP
rs961669469 691 dbSNP
rs577098746 695 dbSNP
rs1027197234 699 dbSNP
rs1168286588 703 dbSNP
rs151192037 705 dbSNP
rs985609064 707 dbSNP
rs1469002133 710 dbSNP
rs1176746732 718 dbSNP
rs911379932 721 dbSNP
rs1270224775 747 dbSNP
rs748715705 751 dbSNP
rs1253057903 752 dbSNP
rs770182366 755 dbSNP
rs772892082 756 dbSNP
rs1225425988 757 dbSNP
rs1036049539 760 dbSNP
rs958617720 764 dbSNP
rs991365852 770 dbSNP
rs1042033574 782 dbSNP
rs11912126 783 dbSNP
rs952662442 787 dbSNP
rs750297169 798 dbSNP
rs983303058 798 dbSNP
rs1451708178 803 dbSNP
rs868668887 803 dbSNP
rs1372350513 811 dbSNP
rs1403402637 813 dbSNP
rs1054992385 819 dbSNP
rs894952923 830 dbSNP
rs188992532 832 dbSNP
rs944244512 833 dbSNP
rs1469013693 847 dbSNP
rs976940682 853 dbSNP
rs897199259 862 dbSNP
rs1461200991 866 dbSNP
rs994594633 870 dbSNP
rs1026916428 874 dbSNP
rs921391574 877 dbSNP
rs747102102 895 dbSNP
rs1283601846 912 dbSNP
rs1053932238 913 dbSNP
rs1407256441 915 dbSNP
rs1280105327 920 dbSNP
rs914265542 921 dbSNP
rs541464590 924 dbSNP
rs1300842267 925 dbSNP
rs757393173 929 dbSNP
rs1316903576 930 dbSNP
rs1452823735 934 dbSNP
rs1041896905 940 dbSNP
rs1346614843 945 dbSNP
rs560153868 947 dbSNP
rs902924602 948 dbSNP
rs965919786 951 dbSNP
rs1401980867 962 dbSNP
rs202078369 967 dbSNP
rs1277195215 969 dbSNP
rs1436644358 970 dbSNP
rs1204400968 975 dbSNP
rs1247418103 981 dbSNP
rs1159846651 982 dbSNP
rs976911221 986 dbSNP
rs1185845957 990 dbSNP
rs1383699962 990 dbSNP
rs1030495211 992 dbSNP
rs966460446 996 dbSNP
rs1191071659 1014 dbSNP
rs977765657 1015 dbSNP
rs1489519846 1018 dbSNP
rs1221572878 1019 dbSNP
rs924928094 1027 dbSNP
rs527412074 1035 dbSNP
rs1252616640 1038 dbSNP
rs780174750 1040 dbSNP
rs1003001505 1042 dbSNP
rs978373473 1044 dbSNP
rs1268124923 1050 dbSNP
rs1353992949 1050 dbSNP
rs1491223645 1050 dbSNP
rs544455383 1050 dbSNP
rs71722737 1050 dbSNP
rs75472094 1051 dbSNP
rs894290428 1052 dbSNP
rs1419066683 1054 dbSNP
rs1012851935 1055 dbSNP
rs59918211 1065 dbSNP
rs79845308 1065 dbSNP
rs1169681077 1066 dbSNP
rs77234504 1067 dbSNP
rs1442465161 1068 dbSNP
rs1323234574 1072 dbSNP
rs1048407503 1078 dbSNP
rs1026891698 1081 dbSNP
rs888446567 1086 dbSNP
rs952716043 1087 dbSNP
rs1222029769 1093 dbSNP
rs781202983 1093 dbSNP
rs1435355985 1095 dbSNP
rs1306766746 1101 dbSNP
rs1004216550 1102 dbSNP
rs1007131633 1113 dbSNP
rs1215893720 1115 dbSNP
rs1339698901 1122 dbSNP
rs372002280 1123 dbSNP
rs545993412 1137 dbSNP
rs1305559135 1141 dbSNP
rs1337827123 1142 dbSNP
rs1354248449 1146 dbSNP
rs1168775648 1147 dbSNP
rs1214304842 1157 dbSNP
rs543861070 1160 dbSNP
rs1020422053 1163 dbSNP
rs977217161 1164 dbSNP
rs1479537239 1165 dbSNP
rs1323960986 1171 dbSNP
rs966891119 1173 dbSNP
rs1191647160 1177 dbSNP
rs977817828 1178 dbSNP
rs921444042 1180 dbSNP
rs1032049785 1185 dbSNP
rs572654453 1189 dbSNP
rs563637679 1192 dbSNP
rs1457917450 1193 dbSNP
rs1262162441 1222 dbSNP
rs954196551 1224 dbSNP
rs1325139380 1226 dbSNP
rs989712133 1228 dbSNP
rs1220247707 1235 dbSNP
rs915490421 1237 dbSNP
rs947075123 1238 dbSNP
rs1373287315 1248 dbSNP
rs531623118 1252 dbSNP
rs924231417 1253 dbSNP
rs550142557 1264 dbSNP
rs916503917 1269 dbSNP
rs949303092 1273 dbSNP
rs1336393625 1274 dbSNP
rs1468446748 1277 dbSNP
rs938464447 1281 dbSNP
rs1057256466 1289 dbSNP
rs1431456139 1294 dbSNP
rs1176922442 1297 dbSNP
rs1190723447 1302 dbSNP
rs1405764715 1303 dbSNP
rs1243685302 1306 dbSNP
rs774161914 1322 dbSNP
rs759044220 1338 dbSNP
rs918411218 1347 dbSNP
rs1256028590 1351 dbSNP
rs118015030 1358 dbSNP
rs1316818621 1362 dbSNP
rs767376879 1365 dbSNP
rs375404667 1366 dbSNP
rs1048457569 1372 dbSNP
rs1314806382 1375 dbSNP
rs909933968 1377 dbSNP
rs1048384270 1382 dbSNP
rs1462936327 1383 dbSNP
rs888359314 1385 dbSNP
rs1162252085 1387 dbSNP
rs1393055399 1388 dbSNP
rs942705291 1390 dbSNP
rs1039682413 1397 dbSNP
rs1384303037 1398 dbSNP
rs1319906611 1400 dbSNP
rs1181551821 1402 dbSNP
rs901432492 1406 dbSNP
rs1256476949 1410 dbSNP
rs368813194 1421 dbSNP
rs548305196 1431 dbSNP
rs1042301822 1432 dbSNP
rs1324281576 1436 dbSNP
rs1430467934 1448 dbSNP
rs999308687 1450 dbSNP
rs1342455990 1452 dbSNP
rs1015611798 1453 dbSNP
rs41281265 1460 dbSNP
rs957752097 1462 dbSNP
rs1359884300 1468 dbSNP
rs534054514 1472 dbSNP
rs1231997202 1473 dbSNP
rs1420186477 1475 dbSNP
rs998307356 1476 dbSNP
rs1364905659 1477 dbSNP
rs1028344515 1479 dbSNP
rs561615440 1483 dbSNP
rs971077477 1490 dbSNP
rs552335464 1493 dbSNP
rs1263176201 1494 dbSNP
rs570750732 1499 dbSNP
rs918451427 1502 dbSNP
rs1488891365 1508 dbSNP
rs915374522 1516 dbSNP
rs758224009 1519 dbSNP
rs951226991 1521 dbSNP
rs966988680 1523 dbSNP
rs983877964 1532 dbSNP
rs978726603 1533 dbSNP
rs1306013821 1541 dbSNP
rs1214875805 1542 dbSNP
rs1400739188 1544 dbSNP
rs1344766477 1550 dbSNP
rs763987253 1553 dbSNP
rs942756662 1562 dbSNP
rs753763070 1563 dbSNP
rs1391102901 1574 dbSNP
rs924315779 1578 dbSNP
rs750566165 1582 dbSNP
rs939152390 1583 dbSNP
rs538146202 1586 dbSNP
rs879077582 1587 dbSNP
rs922609680 1592 dbSNP
rs1237832608 1593 dbSNP
rs1476169691 1597 dbSNP
rs1479863690 1606 dbSNP
rs992601817 1609 dbSNP
rs915663421 1610 dbSNP
rs1453837931 1611 dbSNP
rs948571557 1617 dbSNP
rs903397541 1619 dbSNP
rs1195606094 1621 dbSNP
rs1479765759 1621 dbSNP
rs1000385120 1622 dbSNP
rs1054599666 1622 dbSNP
rs1281465576 1622 dbSNP
rs78110525 1622 dbSNP
rs1235275368 1623 dbSNP
rs1331637145 1626 dbSNP
rs1048267021 1628 dbSNP
rs1305996657 1629 dbSNP
rs893589355 1636 dbSNP
rs1402019357 1640 dbSNP
rs376654746 1641 dbSNP
rs1011981538 1646 dbSNP
rs1159730197 1654 dbSNP
rs573887988 1664 dbSNP
rs556768935 1665 dbSNP
rs888239946 1670 dbSNP
rs1399743562 1676 dbSNP
rs1233228347 1677 dbSNP
rs939964888 1678 dbSNP
rs1335359113 1679 dbSNP
rs1181492926 1685 dbSNP
rs1417771003 1687 dbSNP
rs1037342469 1689 dbSNP
rs1199436258 1695 dbSNP
rs901194804 1696 dbSNP
rs1377623612 1702 dbSNP
rs79037955 1709 dbSNP
rs1261287651 1712 dbSNP
rs1293240441 1714 dbSNP
rs1003588915 1716 dbSNP
rs1025516880 1717 dbSNP
rs535395744 1718 dbSNP
rs139915 1719 dbSNP
rs889876004 1733 dbSNP
rs1309718184 1734 dbSNP
rs1241288205 1735 dbSNP
rs1451410032 1742 dbSNP
rs751807606 1745 dbSNP
rs1335589398 1747 dbSNP
rs1350316551 1749 dbSNP
rs1022436712 1753 dbSNP
rs909704277 1756 dbSNP
rs967252368 1761 dbSNP
rs964119794 1763 dbSNP
rs978397501 1768 dbSNP
rs1179685993 1776 dbSNP
rs1035663294 1779 dbSNP
rs562791843 1780 dbSNP
rs992488915 1786 dbSNP
rs1443136818 1789 dbSNP
rs1183432270 1790 dbSNP
rs915547437 1791 dbSNP
rs1283670849 1793 dbSNP
rs948455947 1794 dbSNP
rs1286404670 1796 dbSNP
rs181643253 1797 dbSNP
rs371941036 1799 dbSNP
rs909744099 1802 dbSNP
rs1396462519 1811 dbSNP
rs545956631 1812 dbSNP
rs1036987825 1813 dbSNP
rs901077342 1817 dbSNP
rs139916 1818 dbSNP
rs1411882577 1823 dbSNP
rs1165162607 1827 dbSNP
rs1473250167 1830 dbSNP
rs1054652421 1831 dbSNP
rs184648722 1849 dbSNP
rs1191620892 1867 dbSNP
rs781660359 1874 dbSNP
rs1489215332 1883 dbSNP
rs894646964 1888 dbSNP
rs748432777 1889 dbSNP
rs1319764528 1893 dbSNP
rs1291777592 1895 dbSNP
rs1335223738 1901 dbSNP
rs770835070 1906 dbSNP
rs867420491 1907 dbSNP
rs1010959073 1909 dbSNP
rs1022790281 1932 dbSNP
rs770401480 1933 dbSNP
rs1219979430 1937 dbSNP
rs140341933 1944 dbSNP
rs1000099690 1952 dbSNP
rs190020388 1955 dbSNP
rs1305936274 1966 dbSNP
rs1342938163 1968 dbSNP
rs1299408053 1985 dbSNP
rs1035315453 1986 dbSNP
rs961259203 1987 dbSNP
rs1231827959 2002 dbSNP
rs1406116445 2006 dbSNP
rs1419132523 2007 dbSNP
rs778413022 2008 dbSNP
rs1478881702 2010 dbSNP
rs1279327566 2013 dbSNP
rs749755713 2014 dbSNP
rs529193285 2015 dbSNP
rs1424232023 2017 dbSNP
rs906237977 2019 dbSNP
rs1487483976 2021 dbSNP
rs1197455955 2027 dbSNP
rs1248193016 2030 dbSNP
rs1222093921 2031 dbSNP
rs1436832790 2036 dbSNP
rs1255839926 2043 dbSNP
rs1199974271 2044 dbSNP
rs1022657623 2048 dbSNP
rs369631567 2050 dbSNP
rs1282097931 2054 dbSNP
rs1247870464 2056 dbSNP
rs1003227183 2060 dbSNP
rs548539141 2063 dbSNP
rs1437675746 2070 dbSNP
rs969698355 2078 dbSNP
rs373174513 2080 dbSNP
rs1354155520 2084 dbSNP
rs1198908091 2087 dbSNP
rs887052343 2094 dbSNP
rs1254504087 2095 dbSNP
rs377488788 2097 dbSNP
rs1401034879 2102 dbSNP
rs150375767 2110 dbSNP
rs1391136552 2123 dbSNP
rs1427233115 2137 dbSNP
rs1270506296 2142 dbSNP
rs1464023163 2148 dbSNP
rs909618792 2150 dbSNP
rs1469494416 2159 dbSNP
rs963903646 2160 dbSNP
rs975616556 2169 dbSNP
rs961267108 2171 dbSNP
rs1396354188 2173 dbSNP
rs1029766308 2177 dbSNP
rs778346353 2178 dbSNP
rs551545420 2192 dbSNP
rs1310923088 2206 dbSNP
rs1327943585 2206 dbSNP
rs922421403 2208 dbSNP
rs113661163 2211 dbSNP
rs1369126234 2213 dbSNP
rs369970422 2221 dbSNP
rs933926934 2222 dbSNP
rs936279515 2223 dbSNP
rs1377991499 2225 dbSNP
rs1336127267 2226 dbSNP
rs1464667032 2228 dbSNP
rs552298618 2230 dbSNP
rs1176634428 2231 dbSNP
rs1400048384 2242 dbSNP
rs1049602858 2246 dbSNP
rs911251992 2250 dbSNP
rs1439895901 2252 dbSNP
rs1242186073 2254 dbSNP
rs990395499 2255 dbSNP
rs1483980434 2260 dbSNP
rs1237561688 2276 dbSNP
rs56223130 2283 dbSNP
rs560588419 2284 dbSNP
rs902588597 2286 dbSNP
rs1249580780 2287 dbSNP
rs999584678 2291 dbSNP
rs550122876 2292 dbSNP
rs1213832441 2297 dbSNP
rs1354680191 2297 dbSNP
rs1394527536 2297 dbSNP
rs1274497128 2300 dbSNP
rs896634072 2312 dbSNP
rs1303533279 2316 dbSNP
rs1429882647 2326 dbSNP
rs113031857 2335 dbSNP
rs527850904 2343 dbSNP
rs1023872847 2344 dbSNP
rs939083487 2347 dbSNP
rs969747789 2348 dbSNP
rs1162192483 2350 dbSNP
rs1256190726 2353 dbSNP
rs1005212023 2355 dbSNP
rs41281267 2357 dbSNP
rs961421262 2359 dbSNP
rs1016813013 2360 dbSNP
rs1488790919 2364 dbSNP
rs972485711 2368 dbSNP
rs772948730 2377 dbSNP
rs1242834947 2379 dbSNP
rs1458856519 2389 dbSNP
rs922440496 2391 dbSNP
rs996705017 2394 dbSNP
rs372470680 2397 dbSNP
rs1338326718 2398 dbSNP
rs143378412 2403 dbSNP
rs368451474 2404 dbSNP
rs911135733 2407 dbSNP
rs1459075999 2408 dbSNP
rs1321497833 2409 dbSNP
rs1169131656 2413 dbSNP
rs1476588000 2416 dbSNP
rs1196392317 2417 dbSNP
rs1364301780 2431 dbSNP
rs998938998 2434 dbSNP
rs567936361 2435 dbSNP
rs1031713433 2440 dbSNP
rs1489569090 2450 dbSNP
rs1293158727 2451 dbSNP
rs1266326683 2453 dbSNP
rs1325851306 2454 dbSNP
rs1198068819 2457 dbSNP
rs771600855 2463 dbSNP
rs1316077236 2465 dbSNP
rs1280175858 2490 dbSNP
rs1219121071 2493 dbSNP
rs957366932 2501 dbSNP
rs1298891397 2505 dbSNP
rs1038366074 2515 dbSNP
rs990113051 2516 dbSNP
rs1044126016 2517 dbSNP
rs1233787697 2524 dbSNP
rs898457906 2529 dbSNP
rs572028507 2530 dbSNP
rs539540195 2532 dbSNP
rs557928725 2540 dbSNP
rs576192850 2541 dbSNP
rs928776697 2549 dbSNP
rs1260951306 2550 dbSNP
rs1435335454 2556 dbSNP
rs939152684 2557 dbSNP
rs1203815448 2560 dbSNP
rs1046790786 2568 dbSNP
rs1261465679 2577 dbSNP
rs908266595 2584 dbSNP
rs1344215527 2587 dbSNP
rs896678059 2591 dbSNP
rs1235344981 2593 dbSNP
rs1331405193 2596 dbSNP
rs1190671062 2598 dbSNP
rs1416270204 2599 dbSNP
rs1474941654 2610 dbSNP
rs1012417001 2613 dbSNP
rs1331403131 2629 dbSNP
rs1413476041 2634 dbSNP
rs1045373003 2641 dbSNP
rs538203010 2644 dbSNP
rs1286939982 2656 dbSNP
rs760381211 2661 dbSNP
rs1468030998 2666 dbSNP
rs1006433673 2667 dbSNP
rs1158443651 2669 dbSNP
rs1383937468 2670 dbSNP
rs1017028176 2679 dbSNP
rs1240304128 2681 dbSNP
rs1037972872 2692 dbSNP
rs1441857890 2693 dbSNP
rs899777471 2697 dbSNP
rs961042821 2699 dbSNP
rs1202072930 2700 dbSNP
rs1345664263 2714 dbSNP
rs1285020443 2717 dbSNP
rs997150881 2718 dbSNP
rs745443699 2722 dbSNP
rs1314683300 2724 dbSNP
rs1446847954 2739 dbSNP
rs567420151 2739 dbSNP
rs994351078 2745 dbSNP
rs550540360 2746 dbSNP
rs1398254713 2752 dbSNP
rs998656239 2769 dbSNP
rs1297937066 2770 dbSNP
rs1418319214 2776 dbSNP
rs1031765914 2779 dbSNP
rs1159297309 2782 dbSNP
rs1232164202 2783 dbSNP
rs957420728 2783 dbSNP
rs955247303 2784 dbSNP
rs1023371396 2787 dbSNP
rs1227341912 2787 dbSNP
rs1286471278 2787 dbSNP
rs555546831 2787 dbSNP
rs982096884 2787 dbSNP
rs1018029055 2788 dbSNP
rs950892276 2794 dbSNP
rs78977308 2797 dbSNP
rs983544128 2807 dbSNP
rs1260558187 2809 dbSNP
rs908317217 2810 dbSNP
rs967943344 2810 dbSNP
rs1404968699 2811 dbSNP
rs941102015 2811 dbSNP
rs979351954 2811 dbSNP
rs561706869 2813 dbSNP
rs923953115 2814 dbSNP
rs935325898 2819 dbSNP
rs1475608184 2832 dbSNP
rs35031751 2856 dbSNP
rs1423019445 2859 dbSNP
rs1038063989 2869 dbSNP
rs1213420256 2876 dbSNP
rs1478778534 2877 dbSNP
rs1256034115 2880 dbSNP
rs1485600448 2884 dbSNP
rs1177919437 2886 dbSNP
rs1242435285 2898 dbSNP
rs1220613940 2899 dbSNP
rs1449484086 2904 dbSNP
rs920927465 2910 dbSNP
rs1210077653 2912 dbSNP
rs1316676241 2920 dbSNP
rs1275794616 2923 dbSNP
rs573897243 2925 dbSNP
rs992688940 2928 dbSNP
rs1410206956 2938 dbSNP
rs1217288045 2946 dbSNP
rs540929594 2951 dbSNP
rs1342992426 2952 dbSNP
rs917997890 2959 dbSNP
rs753784721 2978 dbSNP
rs948083640 2979 dbSNP
rs1436298005 2987 dbSNP
rs1045260423 2989 dbSNP
rs1417606305 2995 dbSNP
rs932619918 2998 dbSNP
rs1462163307 3000 dbSNP
rs887920674 3004 dbSNP
rs1168647297 3006 dbSNP
rs1158680060 3018 dbSNP
rs1420186191 3021 dbSNP
rs1190405065 3026 dbSNP
rs942290127 3036 dbSNP
rs1395875612 3046 dbSNP
rs1435109583 3049 dbSNP
rs1314421263 3052 dbSNP
rs1373622685 3068 dbSNP
rs1051463621 3070 dbSNP
rs891007385 3070 dbSNP
rs1036603056 3071 dbSNP
rs1200031143 3077 dbSNP
rs1374849895 3081 dbSNP
rs1309782918 3086 dbSNP
rs1389129324 3088 dbSNP
rs998708695 3100 dbSNP
rs1365844472 3102 dbSNP
rs1277002942 3103 dbSNP
rs896838076 3114 dbSNP
rs1376501905 3115 dbSNP
rs993846004 3117 dbSNP
rs536065716 3119 dbSNP
rs1355024535 3126 dbSNP
rs1011646942 3137 dbSNP
rs1348077352 3137 dbSNP
rs1023003545 3138 dbSNP
rs560542545 3142 dbSNP
rs1278622728 3145 dbSNP
rs1174083732 3152 dbSNP
rs1006557361 3153 dbSNP
rs1205806062 3169 dbSNP
rs1179963215 3170 dbSNP
rs1018083047 3173 dbSNP
rs1480642699 3177 dbSNP
rs1236386658 3188 dbSNP
rs1209976605 3192 dbSNP
rs1310975919 3203 dbSNP
rs1235053088 3207 dbSNP
rs1282883416 3213 dbSNP
rs1479716024 3229 dbSNP
rs186120645 3231 dbSNP
rs1176623205 3232 dbSNP
rs117644986 3239 dbSNP
rs1225696500 3244 dbSNP
rs375613510 3251 dbSNP
rs552143301 3253 dbSNP
rs1302359554 3261 dbSNP
rs979788700 3266 dbSNP
rs1030912944 3273 dbSNP
rs1313260712 3274 dbSNP
rs1418934158 3279 dbSNP
rs564274756 3285 dbSNP
rs1378269392 3299 dbSNP
rs531670940 3300 dbSNP
rs962475919 3306 dbSNP
rs1412379577 3307 dbSNP
rs1455735549 3314 dbSNP
rs372345954 3322 dbSNP
rs1482544359 3326 dbSNP
rs1260310123 3327 dbSNP
rs974222522 3327 dbSNP
rs761669346 3342 dbSNP
rs1488134471 3347 dbSNP
rs1393004130 3354 dbSNP
rs1241392444 3357 dbSNP
rs920991435 3357 dbSNP
rs1312057247 3366 dbSNP
rs1226750851 3368 dbSNP
rs1357277350 3376 dbSNP
rs190843530 3379 dbSNP
rs956953699 3380 dbSNP
rs992178723 3385 dbSNP
rs917882782 3387 dbSNP
rs1358344393 3388 dbSNP
rs1299826158 3399 dbSNP
rs912498033 3401 dbSNP
rs1171088698 3402 dbSNP
rs1348981801 3408 dbSNP
rs771662101 3408 dbSNP
rs1425096948 3419 dbSNP
rs1417967375 3420 dbSNP
rs1052961516 3423 dbSNP
rs766473079 3424 dbSNP
rs1189185997 3429 dbSNP
rs892969835 3431 dbSNP
rs1207304951 3435 dbSNP
rs1261453862 3435 dbSNP
rs980822091 3436 dbSNP
rs1486315123 3444 dbSNP
rs1265143897 3445 dbSNP
rs909409064 3446 dbSNP
rs1297055218 3447 dbSNP
rs1371358602 3452 dbSNP
rs568717558 3460 dbSNP
rs568524503 3461 dbSNP
rs755272275 3471 dbSNP
rs529598758 3479 dbSNP
rs181982707 3485 dbSNP
rs1003304666 3492 dbSNP
rs868218453 3497 dbSNP
rs4821943 3501 dbSNP
rs1203985507 3502 dbSNP
rs1050721176 3503 dbSNP
rs890769443 3505 dbSNP
rs1394514813 3506 dbSNP
rs1169401411 3509 dbSNP
rs1470025777 3509 dbSNP
rs557404438 3520 dbSNP
rs1422194308 3525 dbSNP
rs1195765509 3526 dbSNP
rs539477447 3529 dbSNP
rs1252557859 3532 dbSNP
rs186548735 3541 dbSNP
rs1189658516 3545 dbSNP
rs903722011 3547 dbSNP
rs1470007583 3551 dbSNP
rs373878141 3553 dbSNP
rs1273862773 3561 dbSNP
rs747395190 3562 dbSNP
rs1000695241 3565 dbSNP
rs73420592 3567 dbSNP
rs1228080518 3570 dbSNP
rs1311324329 3571 dbSNP
rs956651029 3575 dbSNP
rs778218651 3576 dbSNP
rs1371332569 3580 dbSNP
rs1330089636 3587 dbSNP
rs1444014460 3592 dbSNP
rs1398029749 3595 dbSNP
rs749845371 3598 dbSNP
rs1394539889 3603 dbSNP
rs145785758 3604 dbSNP
rs1174453235 3613 dbSNP
rs1455719900 3615 dbSNP
rs912211263 3618 dbSNP
rs934601134 3626 dbSNP
rs1323514571 3630 dbSNP
rs1252760704 3634 dbSNP
rs988717820 3638 dbSNP
rs1482914240 3651 dbSNP
rs914456397 3653 dbSNP
rs947210915 3656 dbSNP
rs1348141133 3660 dbSNP
rs1044212979 3661 dbSNP
rs969364147 3664 dbSNP
rs980874985 3665 dbSNP
rs938761479 3670 dbSNP
rs1392454156 3673 dbSNP
rs1402165267 3676 dbSNP
rs1272274447 3677 dbSNP
rs190554544 3678 dbSNP
rs1214464826 3680 dbSNP
rs1396081498 3686 dbSNP
rs555548451 3690 dbSNP
rs778534895 3691 dbSNP
rs1294036808 3692 dbSNP
rs886435498 3699 dbSNP
rs972267449 3701 dbSNP
rs1182673067 3703 dbSNP
rs919381087 3710 dbSNP
rs1337073504 3720 dbSNP
rs1004806722 3731 dbSNP
rs933608628 3734 dbSNP
rs760940365 3744 dbSNP
rs745338874 3745 dbSNP
rs1352464612 3746 dbSNP
rs912261306 3751 dbSNP
rs1272793207 3758 dbSNP
rs771822357 3769 dbSNP
rs1039460205 3773 dbSNP
rs183848948 3789 dbSNP
rs1417164740 3792 dbSNP
rs751832252 3795 dbSNP
rs1376402910 3804 dbSNP
rs1399144052 3805 dbSNP
rs899402754 3809 dbSNP
rs903607212 3812 dbSNP
rs1000982666 3813 dbSNP
rs1029151608 3814 dbSNP
rs1189932750 3818 dbSNP
rs1475509403 3824 dbSNP
rs1052292761 3825 dbSNP
rs953950507 3832 dbSNP
rs1192878403 3844 dbSNP
rs1448362470 3845 dbSNP
rs892264697 3856 dbSNP
rs1475903374 3860 dbSNP
rs1013537490 3864 dbSNP
rs1024879287 3866 dbSNP
rs1353563151 3867 dbSNP
rs376533816 3874 dbSNP
rs1047740739 3883 dbSNP
rs969416309 3885 dbSNP
rs187943942 3887 dbSNP
rs552890226 3888 dbSNP
rs963498006 3900 dbSNP
rs533723526 3911 dbSNP
rs760314948 3914 dbSNP
rs1392312277 3916 dbSNP
rs1167245159 3918 dbSNP
rs7511403 3919 dbSNP
rs1461862713 3921 dbSNP
rs1320737965 3922 dbSNP
rs1422919077 3924 dbSNP
rs1165930149 3928 dbSNP
rs1476239613 3930 dbSNP
rs191469987 3938 dbSNP
rs374412296 3951 dbSNP
rs927146586 3952 dbSNP
rs1466877319 3959 dbSNP
rs1254309408 3962 dbSNP
rs1213845547 3964 dbSNP
rs1429133626 3968 dbSNP
rs938799776 3970 dbSNP
rs1257911802 3971 dbSNP
rs1213328039 3977 dbSNP
rs1057153566 3978 dbSNP
rs1271158765 3980 dbSNP
rs768441167 3985 dbSNP
rs545820259 3986 dbSNP
rs761792167 3988 dbSNP
rs899443235 3989 dbSNP
rs140994992 3990 dbSNP
rs1491417755 3990 dbSNP
rs564110784 3990 dbSNP
rs60738963 3990 dbSNP
rs766965928 3999 dbSNP
rs954864143 4010 dbSNP
rs1171834897 4016 dbSNP
rs1452152980 4019 dbSNP
rs1009033324 4030 dbSNP
rs765131645 4034 dbSNP
rs910794008 4038 dbSNP
rs1456880688 4046 dbSNP
rs1282359300 4049 dbSNP
rs531706626 4052 dbSNP
rs774560049 4061 dbSNP
rs1039372567 4071 dbSNP
rs139917 4076 dbSNP
rs1274110545 4081 dbSNP
rs1234099691 4084 dbSNP
rs1345981910 4086 dbSNP
rs1305832325 4093 dbSNP
rs759976879 4101 dbSNP
rs936446764 4101 dbSNP
rs1052599584 4109 dbSNP
rs117233552 4110 dbSNP
rs1355083384 4111 dbSNP
rs372091848 4112 dbSNP
rs1486602991 4126 dbSNP
rs1432568885 4131 dbSNP
rs1377051986 4136 dbSNP
rs980036717 4138 dbSNP
rs927170559 4139 dbSNP
rs1236352347 4141 dbSNP
rs767577369 4142 dbSNP
rs1046381196 4143 dbSNP
rs1178470013 4163 dbSNP
rs992598259 4166 dbSNP
rs907980750 4170 dbSNP
rs1159963034 4171 dbSNP
rs1210819736 4176 dbSNP
rs555171651 4187 dbSNP
rs905118454 4195 dbSNP
rs1037692351 4196 dbSNP
rs752867745 4199 dbSNP
rs781312602 4201 dbSNP
rs1316606366 4203 dbSNP
rs1304924244 4205 dbSNP
rs1419488669 4207 dbSNP
rs1016286031 4213 dbSNP
rs1225605168 4244 dbSNP
rs920602103 4247 dbSNP
rs1412889869 4266 dbSNP
rs1174595924 4267 dbSNP
rs932257905 4272 dbSNP
rs1313309599 4274 dbSNP
rs1418681300 4275 dbSNP
rs1343136458 4290 dbSNP
rs182370818 4294 dbSNP
rs899134341 4295 dbSNP
rs1413473050 4302 dbSNP
rs993626806 4303 dbSNP
rs1187814931 4311 dbSNP
rs1336449083 4312 dbSNP
rs1474527039 4322 dbSNP
rs1260024588 4325 dbSNP
rs1189146822 4328 dbSNP
rs1050706979 4331 dbSNP
rs1259124459 4335 dbSNP
rs138706712 4342 dbSNP
rs1317549650 4349 dbSNP
rs1272648824 4350 dbSNP
rs944873781 4362 dbSNP
rs1444411615 4366 dbSNP
rs1357329111 4368 dbSNP
rs186739256 4372 dbSNP
rs770317624 4373 dbSNP
rs1239228263 4382 dbSNP
rs1290201840 4385 dbSNP
rs1431055735 4387 dbSNP
rs764575231 4391 dbSNP
rs1162233926 4395 dbSNP
rs1350013003 4397 dbSNP
rs1208611551 4402 dbSNP
rs1460310973 4416 dbSNP
rs1017685715 4423 dbSNP
rs1166088956 4424 dbSNP
rs566407554 4426 dbSNP
rs1428219843 4427 dbSNP
rs533641880 4438 dbSNP
rs1009971565 4441 dbSNP
rs754232453 4446 dbSNP
rs964947971 4449 dbSNP
rs1021743069 4450 dbSNP
rs1230836336 4464 dbSNP
rs139918 4465 dbSNP
rs569630794 4474 dbSNP
rs1226614974 4476 dbSNP
rs1305513893 4477 dbSNP
rs779282989 4479 dbSNP
rs1397241625 4483 dbSNP
rs8142529 4498 dbSNP
rs987946949 4502 dbSNP
rs913645932 4515 dbSNP
rs1397750366 4520 dbSNP
rs1394584192 4526 dbSNP
rs1294589646 4528 dbSNP
rs537154479 4529 dbSNP
rs949082474 4531 dbSNP
rs1046267240 4532 dbSNP
rs3804095 4535 dbSNP
rs1376524553 4538 dbSNP
rs1173038452 4542 dbSNP
rs757857112 4556 dbSNP
rs192367023 4559 dbSNP
rs1191997232 4565 dbSNP
rs1372940490 4566 dbSNP
rs1038010910 4569 dbSNP
rs899190438 4574 dbSNP
rs993905228 4581 dbSNP
rs1252823288 4585 dbSNP
rs1339932513 4588 dbSNP
rs1300733734 4591 dbSNP
rs1026435485 4595 dbSNP
rs1197099396 4598 dbSNP
rs878937391 4608 dbSNP
rs879449844 4608 dbSNP
rs199665035 4609 dbSNP
rs932002487 4612 dbSNP
rs1430732284 4618 dbSNP
rs1375222987 4619 dbSNP
rs986512780 4620 dbSNP
rs1457076381 4621 dbSNP
rs1213911455 4622 dbSNP
rs1254443497 4623 dbSNP
rs1452964173 4625 dbSNP
rs912159552 4636 dbSNP
rs1181234046 4639 dbSNP
rs1417235303 4641 dbSNP
rs1252656307 4645 dbSNP
rs142740135 4646 dbSNP
rs1052627472 4649 dbSNP
rs1374205908 4653 dbSNP
rs892635959 4657 dbSNP
rs1476671115 4659 dbSNP
rs1277951858 4660 dbSNP
rs779546836 4667 dbSNP
rs184640228 4668 dbSNP
rs144512467 4676 dbSNP
rs904249405 4679 dbSNP
rs1309697960 4685 dbSNP
rs535302057 4697 dbSNP
rs1436786706 4704 dbSNP
rs1403264443 4706 dbSNP
rs1158056080 4707 dbSNP
rs1328211320 4708 dbSNP
rs895763496 4711 dbSNP
rs1182752944 4716 dbSNP
rs187859490 4721 dbSNP
rs979060441 4722 dbSNP
rs1384877066 4727 dbSNP
rs1014742480 4729 dbSNP
rs1189884850 4732 dbSNP
rs1033676139 4737 dbSNP
rs1300319017 4743 dbSNP
rs1327024888 4744 dbSNP
rs1352159732 4746 dbSNP
rs957761241 4748 dbSNP
rs1260829717 4754 dbSNP
rs1229529898 4756 dbSNP
rs988221570 4761 dbSNP
rs1229482498 4763 dbSNP
rs1275814985 4777 dbSNP
rs913531513 4780 dbSNP
rs557738868 4793 dbSNP
rs367615087 4814 dbSNP
rs1341460552 4817 dbSNP
rs949134568 4822 dbSNP
rs1380766356 4840 dbSNP
rs1274674425 4852 dbSNP
rs981829680 4857 dbSNP
rs911862282 4865 dbSNP
rs944979427 4881 dbSNP
rs1415654744 4885 dbSNP
rs1167024122 4891 dbSNP
rs1487291930 4898 dbSNP
rs371661432 4899 dbSNP
rs1190521077 4906 dbSNP
rs376002649 4913 dbSNP
rs369418042 4915 dbSNP
rs1212599797 4916 dbSNP
rs946887354 4920 dbSNP
rs1449280701 4930 dbSNP
rs1271761130 4935 dbSNP
rs1235683154 4942 dbSNP
rs543794387 4943 dbSNP
rs925756026 4944 dbSNP
rs1225475005 4947 dbSNP
rs937069547 4965 dbSNP
rs1321283433 4969 dbSNP
rs1037665812 4972 dbSNP
rs1440186850 4975 dbSNP
rs562079297 4976 dbSNP
rs1327790384 4977 dbSNP
rs895481226 4980 dbSNP
rs1167125354 4981 dbSNP
rs929197393 4986 dbSNP