miRTarBase - #MIRT154043 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RASSF2   
Synonyms CENP-34, RASFADIN
Description Ras association domain family member 2
Transcript NM_170774   
Other Transcripts NM_014737   
Expression
Putative miRNA Targets on RASSF2
3'UTR of RASSF2
(miRNA target sites are highlighted)
>RASSF2|NM_170774|3'UTR
   1 GCCATGAGAACGAGGGGATCTGGGCACCCCAGGAACCGCCATTGCCCATAAGACCCCCAGGAAGCTAGGCACTTTCTTTC
  81 CATGGAAACATTTAGACACAAACCTCCCCAGCTCCGGCCAAGCCATCATTTGCTACCTGGAGCTGGATGTAGAAGTCAGC
 161 AGACAGCTCCCTATCCCTGGACCCCTGCCCTCCTTTTTTCTGCTCACAAGGACTTTTGATTTTAGTTATAAGGAGGACCC
 241 AAAATGTGTGTGTGTACATGTGTGTGCACACATGGTACGTGTCCATGTGCCTACCTGATACTTTCACATGTAATTAAATT
 321 CCAGGCAACCAGCACAAGAGCCGTGAGCTTGGCACATGTGCTGCTCGTGAGCAGGAAAATCAGAGGAGCCACTGATCTGA
 401 GTGGTATTTAGGTTGAAGGAAAGATTTCTCCTCTCAAGTGCCAGGGAGCAGCCACACGTCTGTCTGTGTTTAGAGAGGGA
 481 AGAGGGTTCTCCAGGTTCACCATTTGGGTTGTTTATATGTTGGTAGAAATTCTCCCTGTATGCCTAGAAGGATCAGTGAA
 561 TGTAAGAGCCTTGGAAATTAACAAAATAACAGCCACATAACCTTGCGGCAAGTCTGATGGAAAGAAAAAGATAAACCATC
 641 CGTGGGGTAGATGCAATAAGCCCACGTATTTTTACACTGGAAACGTTGATTGTTTTAAATGACAAAGACATATGTGATGT
 721 TCTATGTGGAAACCTGTGAAGAGTGGATTCTGCCTCCATCTCTGCCTCCATGGCTACCTTTAGGAGACAGAGAAGATCCT
 801 GTGTGTTTCTCTGTACCCAGCTGACAGCCTGTCTCTATGGCGCTTCCTTGAGTGGAAGGAAATGTCTCAAGAAACAAAGA
 881 TCTCGCTGGTGCGTACACAGTGCTGACCAGCTAGTGTGGCCAGGGCCTGGTGGCCTGGTGGCCAGGAAGTTTCAGGTTGA
 961 AGGGAAATGTCGAGGCTACCTGCAGATATGACAGGTGCCTTGAACGCAGCCCATCTTCATGTCATCAAAGGTCTTCCTGC
1041 ACTTGAAGCTGGGGCGATGTTTGCAGTCAAGACCATTCTTTCCAACCTCTGGGTTCTTGCAAGTTGCCCTCACCTTGTGT
1121 GTGGAGATGCATTCCAAGAATGAAGCCTCATCTTGCTACTGAGTGTGGGGTTCAGGGAAGCTCTTTAGGCCACCTGGTGA
1201 AGGTGCATGGGGAGGATGGAGCTTCTCCTCAGCTCCTCTGAGCAGCCACCTATGTGATCTTTAAATCCAACCCCAATGGG
1281 AGAAAAGGGCAAGAACAGTCTGTGCCCTGGGACTCCTATCAGGAAGCTTGACAGGCAGCTGGGCATCAGTGCAGCTGATA
1361 TCGTTTGAGGAGGGAGACAGATGCTTGGACCTGGGTGCCTGGCTATGGAGATTGACCAAGCAAGATCAGGAGCTCCTGAT
1441 AGCAGGCGTCTTTGAGCCTAGCTGGGGTAGAGGCACTGCCCATCTCTTCTCCACCTTCTCTCCACAGAATGTTTGCAGAG
1521 CTGGGCAGTTGAGGAAAGGACAGCCCCTGGTTGGTGCCTCCAAAGGAAGGTGGACTTTTTTGGTGGAGACGTTTCTGCCC
1601 TGGGCACCCTCCTGCCCCCGATTCATACCTATGGCTTCTTGAGAAGGCTCACAGCTGTGGTCTTAACGTAGACTGCAGAA
1681 AGATGGCATGCGGCCCCTGGCATTTCGCCAAGGGTTTTATAGCAAGTCTCCTTCCTCCATAGGGACAGCAGCACCAGCCC
1761 TGTGGGGCATGGAGTGGAAGCCCAGAAGGGCTTCTGCAAGCTGCACAGAACTGGGGTAAGAAGACAAAGAGTAGCCACCG
1841 GGAGAGGCTTCCTTTGTTACAGCTGGGAAAGAACAGTTCTGTGAATGCAAACACCTCCTGAGTTTTGCAATTGAGAAAAT
1921 GATTTGGAGAACTTCTCTTCTGGTAATTTTTATTTTGAATGTTCAGGGCCTTAGTTGGCCCCAGTAATTCTCCTTGGAGG
2001 ACTTGGGAGAAGAATTTCCACAAAGCAAACTACTAACCACTAGCTCTTACTGGACAGCGATTTCTGGCTTATAAGAGTTC
2081 TCTTTGATTTGCACTAGCACTACGATAGTGTTAGATGGGGAAATACTGCAACATGTCCAGTTGGCCAGATCACTTTCCAA
2161 GGGAGCGATACTAAGGCAGACTCAGCTTTTTAAAGATGGGAGGTCAGGAGGTGGAAGTGAGAGGAGATCCCATCTCACAC
2241 AACACACTTCCACGTAATGCAGACCACACTTTTCCATTTTGTCCTGCCCTCTTGAGAGGTCATTTCTCACGTCCTAAGAA
2321 CCTGATCAGAAATTTTGGAAGGGTTCTTTGAAATAGCAGCAGTTGAAACAGAGACACTTTGCCACAGTGTGGAGCAGATT
2401 TTCTCACTGGTATCACATGGTCTTGCAGTTTTGAACTCTTCGACCGATTTGTGGGAGTTTATGTAATTGCGTGCAATGAA
2481 CCTGAAATTGTGTAAAGGACAAAAGACCAGTTTATAGGGTTGGGTTTTTTTTCCAACTTGTGAAAAGCAGTTTAGCTGCA
2561 TCTGTCTCCCCACCACCCCCACCCCGGGAGGGGCTTATGTTACAAGGTGATCAAGTGAAGGAAAAACCTGAGCCTATCTG
2641 GCTGGGATGGTGGAATTAAGCACAAGGTCACATTCTCTGTGATCACATGAGAGGGAAGGTGATGACTTAAATGGCAGGGG
2721 GTGGGGATTATCTTGGGGAGAGGCTGAAAAGCACAAAAGATAGTCTTCCCTGTACGTATTGGTGAAGAACGTGCACAAGG
2801 CTGGATGGACTTCAACTTGGAGTTGAGTTGAGGCAAGAGGATTTCTGGATATTAGTCACCCATCTGCAAGAAAAATGCTG
2881 AGGCCTCGGGTCAAGATTTTGATCTGAGACATGCTGATGCTTCAAGGAGAAATATTTTCACAATCCTCTCTTCCCTCACC
2961 AGAAGAGAACAGTACTCTCTCCTAGAAACCTCTAGGTAAACACATTTTATCCTAATATCGGTAGCATATAATGCCCCCCC
3041 CAAAATATCTGTTTTCCATGCAAAAAAGTCTCAACAAGAAGTCTGTGGAGTTGAGTGGTTACTTCAAAGTGTCAGGAGAG
3121 TGAAGAAATTGGCCACAGAAGAGCAAGAAGCTCTCTTAAGAAAAGGGAATTCTCTTTAAAGAAACCACCACCAACAACAA
3201 AACAACCAAAAACCATGTTTTATGTCAAAGCTCTGTAGCACAGAGAATGTGGTGTCACAGATACATCGCCGAGAGAGGTT
3281 TCTTTCTTTCTTTTTTTTTTTTTTGAGACAGAGTCTGGTTCTGTTTCCCAGGCTGGAGTGCAGTGGTGGGATCTCAGCTC
3361 ACTGCAACATCCGCCTCTGGGGTTCAAGTGATTCTCCTGTCTCAGCCTCCCAAGTAGCTGGAATTACAGGGACCCGCCAC
3441 CACGCCCGGCTAATTTTTTTGTGTGGTTTTAGTAGAGGTGGGGTTTCACCATCTTGGCCAGGCTGGTCTTGAACTCCTGA
3521 CCTCGTGATCCACCCGCCTAGGCCTCCCAAAGTGTTGGGATTACAGGCGTGAGCCACTGTGCCCAGCCAAAAGAGAAATT
3601 TCTACATGAACAAGGCAATTTCAGTGTCTTACAGCGGCCAAACCATGACGTGAAGAATGAGATAGGAGACAGGAGATCAC
3681 CATAAGCGTCCCTGATATAGCAGCACACATTTTCACGTTTCCACTTAAATCGTTTTGCACAAAGTCTTGCTTCGCTCAGA
3761 TGAGATGAGATATGATTTCCTAGAGATGTAAAAATAAGAATGAATGTGGCGCCCCCTTCTTCCAGATGTAATAGAAAGCT
3841 CTGCCCTATCACAAGGGGGGTGTTGAAGCGCCCCTTGTGTTTTAACTGTATTTAACTGAGCACAAGATGCACAAGCTGTG
3921 GTGGGAAACCCTCAGTTTACCTTTGGAGTCTTCCCTGCAGATCGCAGACCTGTTTCCAGGCTGATGTTTCTGGTGTGTAA
4001 TTGCTAGCGTTTCTGAAGGGTTTTCCCAATTGTTTTAGCCTTGTGAAGTATTCTTAATTATAACTTGCCTTTCAGCGATG
4081 GTACATGACTTGATTCAACGTTTGGTTCTGAACTTACACACTGATGCGTTTACTCATCTAACATAATCTGACAGGGCCTC
4161 AGCAAGGGAGCCATACATTTTTGTAACATTTTGATATGTTTTAATGCATCTGACTTAGATCTTACTGAAATAAAGCACTT
4241 TTCAAAGAGAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaaUACACGACGAu 5'
                     |||||||||| 
Target 5' gagcttggcacATGTGCTGCTc 3'
345 - 366 155.00 -14.80
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            |||:|||| || |||| |  
Target 5' gcCAAGCCATCATTTGCTACct 3'
117 - 138 128.00 -13.30
3
miRNA  3' guGUUU-GGUAAUACACGACGAu 5'
            ||||  || |||||| ||:| 
Target 5' gaCAAAGACA-TATGTGATGTTc 3'
701 - 722 123.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31539269 1 COSMIC
COSN30120975 8 COSMIC
COSN30524438 8 COSMIC
COSN30474830 12 COSMIC
COSN20072814 25 COSMIC
COSN23015551 26 COSMIC
COSN30117466 37 COSMIC
COSN31605360 38 COSMIC
COSN30182524 56 COSMIC
COSN30138480 60 COSMIC
COSN31540614 60 COSMIC
COSN30482655 61 COSMIC
COSN510337 65 COSMIC
COSN30467913 69 COSMIC
COSN30451586 80 COSMIC
COSN30468769 84 COSMIC
COSN31496687 84 COSMIC
COSN26723777 89 COSMIC
COSN13866659 95 COSMIC
COSN30182530 95 COSMIC
COSN30469445 115 COSMIC
COSN30531707 174 COSMIC
COSN29265806 205 COSMIC
COSN30135972 278 COSMIC
COSN1249996 290 COSMIC
COSN16727899 358 COSMIC
COSN24306981 641 COSMIC
COSN31582734 666 COSMIC
COSN31585401 680 COSMIC
COSN26482432 709 COSMIC
COSN31545608 726 COSMIC
COSN16131325 762 COSMIC
COSN15602960 776 COSMIC
COSN31565266 786 COSMIC
COSN23015550 916 COSMIC
COSN30329255 1538 COSMIC
COSN21539969 1833 COSMIC
COSN14466658 2029 COSMIC
COSN28734045 2050 COSMIC
COSN1249992 2525 COSMIC
COSN5972941 3032 COSMIC
COSN20116235 3033 COSMIC
COSN17657694 3060 COSMIC
COSN23071098 3150 COSMIC
COSN32056894 3155 COSMIC
COSN19388166 3279 COSMIC
COSN1874747 3354 COSMIC
COSN7095239 3373 COSMIC
COSN29591311 3587 COSMIC
COSN23157480 3795 COSMIC
COSN5445134 3841 COSMIC
COSN21852325 3907 COSMIC
COSN16583838 4128 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775024211 2 dbSNP
rs376464667 5 dbSNP
rs374564792 11 dbSNP
rs777275528 12 dbSNP
rs201647965 14 dbSNP
rs201312603 15 dbSNP
rs1257327254 16 dbSNP
rs1209190849 18 dbSNP
rs111947814 22 dbSNP
rs1486818585 22 dbSNP
rs771571161 23 dbSNP
rs747323191 24 dbSNP
rs778308724 26 dbSNP
rs1462250811 28 dbSNP
rs772300560 33 dbSNP
rs1216321393 36 dbSNP
rs748283406 37 dbSNP
rs779239522 38 dbSNP
rs41279438 40 dbSNP
rs757197801 45 dbSNP
rs555147553 46 dbSNP
rs564965781 49 dbSNP
rs920494941 56 dbSNP
rs1364080897 67 dbSNP
rs1037600793 68 dbSNP
rs1293290351 70 dbSNP
rs974331423 80 dbSNP
rs1233870419 82 dbSNP
rs963166645 85 dbSNP
rs943346229 97 dbSNP
rs1386933047 101 dbSNP
rs986067701 115 dbSNP
rs535584049 124 dbSNP
rs1360842663 125 dbSNP
rs1486538843 132 dbSNP
rs1184281435 133 dbSNP
rs144952251 143 dbSNP
rs149865608 154 dbSNP
rs987533005 162 dbSNP
rs139050897 164 dbSNP
rs867792299 169 dbSNP
rs73058454 171 dbSNP
rs1160047790 183 dbSNP
rs572622285 186 dbSNP
rs549320287 189 dbSNP
rs756447854 198 dbSNP
rs1176534366 200 dbSNP
rs1010825556 207 dbSNP
rs554346028 208 dbSNP
rs538815626 216 dbSNP
rs1295071450 230 dbSNP
rs1054958323 232 dbSNP
rs1003813285 233 dbSNP
rs2422979 237 dbSNP
rs549857691 238 dbSNP
rs1259613609 239 dbSNP
rs1485720144 240 dbSNP
rs1489293047 241 dbSNP
rs537874837 253 dbSNP
rs567304044 256 dbSNP
rs548929990 257 dbSNP
rs878965249 257 dbSNP
rs1178115582 264 dbSNP
rs918595380 269 dbSNP
rs895544837 270 dbSNP
rs1158732039 272 dbSNP
rs1047493515 278 dbSNP
rs116054171 279 dbSNP
rs911492603 283 dbSNP
rs899017955 287 dbSNP
rs1375330140 290 dbSNP
rs3746674 290 dbSNP
rs943283176 293 dbSNP
rs1305859022 311 dbSNP
rs910507858 312 dbSNP
rs191221284 321 dbSNP
rs1275880175 325 dbSNP
rs1212424525 326 dbSNP
rs1277631652 333 dbSNP
rs1401497725 334 dbSNP
rs73058451 343 dbSNP
rs763627546 347 dbSNP
rs1468940332 348 dbSNP
rs113970684 352 dbSNP
rs988240241 353 dbSNP
rs1394153719 364 dbSNP
rs958162263 366 dbSNP
rs565002249 367 dbSNP
rs543528406 378 dbSNP
rs980977756 385 dbSNP
rs1011021996 395 dbSNP
rs762811562 400 dbSNP
rs533256319 415 dbSNP
rs1355989632 421 dbSNP
rs1461272409 430 dbSNP
rs1439790129 440 dbSNP
rs185441239 447 dbSNP
rs1034034246 453 dbSNP
rs150894957 458 dbSNP
rs906375825 460 dbSNP
rs1478936859 462 dbSNP
rs1045807852 473 dbSNP
rs1014318900 476 dbSNP
rs1215612328 481 dbSNP
rs959752871 485 dbSNP
rs1204299341 487 dbSNP
rs1025991426 498 dbSNP
rs765281684 504 dbSNP
rs1192063353 506 dbSNP
rs549204105 507 dbSNP
rs1038362258 513 dbSNP
rs941383698 515 dbSNP
rs1168382659 534 dbSNP
rs911455210 537 dbSNP
rs898963895 547 dbSNP
rs759249516 548 dbSNP
rs1050446156 564 dbSNP
rs560887552 565 dbSNP
rs1323498177 577 dbSNP
rs200932228 582 dbSNP
rs143832702 590 dbSNP
rs16990191 590 dbSNP
rs1201571683 602 dbSNP
rs572706976 606 dbSNP
rs554160823 607 dbSNP
rs3209758 624 dbSNP
rs966425293 641 dbSNP
rs539264420 642 dbSNP
rs1052484468 646 dbSNP
rs1252640823 650 dbSNP
rs1318168182 655 dbSNP
rs989139720 656 dbSNP
rs867443287 658 dbSNP
rs1240471516 661 dbSNP
rs1474382501 663 dbSNP
rs1241973313 665 dbSNP
rs190325842 666 dbSNP
rs1033571030 684 dbSNP
rs1162298870 685 dbSNP
rs925394765 687 dbSNP
rs1334701800 690 dbSNP
rs981337728 693 dbSNP
rs1003876902 694 dbSNP
rs556271047 703 dbSNP
rs1333134137 707 dbSNP
rs537963312 708 dbSNP
rs567377876 711 dbSNP
rs1162939716 714 dbSNP
rs1471833197 718 dbSNP
rs1265273995 719 dbSNP
rs992437174 724 dbSNP
rs762598578 725 dbSNP
rs1351634479 726 dbSNP
rs1207186960 727 dbSNP
rs1282228047 729 dbSNP
rs1488010682 770 dbSNP
rs1370300328 772 dbSNP
rs959940740 772 dbSNP
rs1188792456 781 dbSNP
rs1476037965 782 dbSNP
rs1439635523 783 dbSNP
rs1236655883 789 dbSNP
rs1025940512 797 dbSNP
rs1470308329 799 dbSNP
rs1160002922 812 dbSNP
rs1382055971 814 dbSNP
rs370046371 818 dbSNP
rs971742006 820 dbSNP
rs772159090 825 dbSNP
rs1207746126 838 dbSNP
rs529350146 839 dbSNP
rs1007784577 841 dbSNP
rs562978347 842 dbSNP
rs1336782460 850 dbSNP
rs1017452961 851 dbSNP
rs888972949 855 dbSNP
rs549428324 862 dbSNP
rs1239267345 863 dbSNP
rs1030634186 864 dbSNP
rs1374579592 866 dbSNP
rs1211714203 868 dbSNP
rs1282625520 881 dbSNP
rs185939822 884 dbSNP
rs533933323 885 dbSNP
rs892431192 888 dbSNP
rs116547053 893 dbSNP
rs1438198665 896 dbSNP
rs1183482437 904 dbSNP
rs547353558 910 dbSNP
rs1535381 916 dbSNP
rs1173677737 924 dbSNP
rs1187843748 926 dbSNP
rs1045173365 931 dbSNP
rs1433384965 935 dbSNP
rs901467079 944 dbSNP
rs1042520181 957 dbSNP
rs945570653 970 dbSNP
rs948193985 971 dbSNP
rs1376412583 972 dbSNP
rs914971397 987 dbSNP
rs543808995 992 dbSNP
rs918101954 998 dbSNP
rs1305719000 1005 dbSNP
rs992782182 1006 dbSNP
rs565093312 1008 dbSNP
rs3803969 1015 dbSNP
rs981809851 1019 dbSNP
rs918872464 1050 dbSNP
rs1197306873 1053 dbSNP
rs6139552 1055 dbSNP
rs1457038013 1056 dbSNP
rs768452338 1058 dbSNP
rs1193938197 1061 dbSNP
rs1254269873 1065 dbSNP
rs1026261926 1087 dbSNP
rs971867595 1093 dbSNP
rs1196251906 1094 dbSNP
rs41279436 1101 dbSNP
rs1374168308 1102 dbSNP
rs1166486444 1108 dbSNP
rs1016986632 1109 dbSNP
rs542648113 1113 dbSNP
rs1328193386 1119 dbSNP
rs1289890919 1124 dbSNP
rs1368798059 1140 dbSNP
rs1386303741 1142 dbSNP
rs985911584 1144 dbSNP
rs1350940744 1149 dbSNP
rs571000274 1152 dbSNP
rs998169449 1159 dbSNP
rs560865516 1163 dbSNP
rs1240825838 1165 dbSNP
rs1317081916 1167 dbSNP
rs1213853726 1178 dbSNP
rs1030166683 1193 dbSNP
rs1190102660 1203 dbSNP
rs1261868445 1207 dbSNP
rs1430806181 1212 dbSNP
rs1192201691 1214 dbSNP
rs1423292213 1222 dbSNP
rs1462300528 1230 dbSNP
rs181764890 1232 dbSNP
rs892375580 1233 dbSNP
rs1272872056 1244 dbSNP
rs577879377 1248 dbSNP
rs1289515985 1257 dbSNP
rs746184470 1268 dbSNP
rs1000844924 1276 dbSNP
rs937751967 1277 dbSNP
rs781638414 1280 dbSNP
rs903871546 1282 dbSNP
rs1045524216 1283 dbSNP
rs775448955 1287 dbSNP
rs1319519561 1293 dbSNP
rs1220458946 1298 dbSNP
rs756864609 1307 dbSNP
rs556358997 1310 dbSNP
rs896604091 1311 dbSNP
rs550991067 1313 dbSNP
rs544360765 1321 dbSNP
rs751218136 1330 dbSNP
rs1215005948 1334 dbSNP
rs1263145606 1342 dbSNP
rs949053076 1343 dbSNP
rs919147632 1348 dbSNP
rs1171192589 1358 dbSNP
rs1479247665 1361 dbSNP
rs530880057 1362 dbSNP
rs763536465 1363 dbSNP
rs562075033 1369 dbSNP
rs918818631 1371 dbSNP
rs73586971 1374 dbSNP
rs147560239 1382 dbSNP
rs375715444 1382 dbSNP
rs190316296 1391 dbSNP
rs8184646 1392 dbSNP
rs1038606328 1394 dbSNP
rs941670780 1396 dbSNP
rs1311536824 1398 dbSNP
rs1276496447 1403 dbSNP
rs1376778649 1406 dbSNP
rs1220723191 1416 dbSNP
rs908885176 1417 dbSNP
rs986244225 1440 dbSNP
rs953152722 1445 dbSNP
rs1318158757 1446 dbSNP
rs923043874 1447 dbSNP
rs954257114 1448 dbSNP
rs975895868 1455 dbSNP
rs1284121957 1466 dbSNP
rs45444400 1468 dbSNP
rs1236028675 1472 dbSNP
rs6139551 1481 dbSNP
rs1177955819 1482 dbSNP
rs1000795142 1484 dbSNP
rs1438120039 1486 dbSNP
rs1158094780 1488 dbSNP
rs765058262 1505 dbSNP
rs1435247100 1509 dbSNP
rs1023635046 1513 dbSNP
rs1357150361 1517 dbSNP
rs1009776389 1520 dbSNP
rs894093347 1528 dbSNP
rs1378612735 1529 dbSNP
rs1444207979 1536 dbSNP
rs1332836376 1538 dbSNP
rs41279434 1541 dbSNP
rs896554220 1544 dbSNP
rs1193932416 1556 dbSNP
rs1237058427 1558 dbSNP
rs571518702 1563 dbSNP
rs1311924191 1573 dbSNP
rs1169454513 1575 dbSNP
rs1235003513 1582 dbSNP
rs1456608155 1582 dbSNP
rs994270085 1583 dbSNP
rs1253642052 1584 dbSNP
rs776237684 1590 dbSNP
rs1038554805 1591 dbSNP
rs941618149 1597 dbSNP
rs6116509 1608 dbSNP
rs1212197674 1613 dbSNP
rs1402261681 1617 dbSNP
rs1444041626 1619 dbSNP
rs6116508 1620 dbSNP
rs1438015034 1628 dbSNP
rs931664588 1635 dbSNP
rs1257217655 1647 dbSNP
rs909159587 1657 dbSNP
rs556639573 1661 dbSNP
rs1215739929 1664 dbSNP
rs1218189299 1665 dbSNP
rs769056777 1667 dbSNP
rs953256433 1668 dbSNP
rs1274078452 1671 dbSNP
rs1469844626 1677 dbSNP
rs975843224 1678 dbSNP
rs956494134 1684 dbSNP
rs1196822639 1689 dbSNP
rs1246266312 1691 dbSNP
rs921317355 1692 dbSNP
rs1187049350 1695 dbSNP
rs976811060 1697 dbSNP
rs1280410211 1706 dbSNP
rs923774064 1707 dbSNP
rs979300407 1711 dbSNP
rs1020908081 1712 dbSNP
rs1321008655 1718 dbSNP
rs1009600703 1722 dbSNP
rs1378599997 1724 dbSNP
rs539032036 1734 dbSNP
rs1432038806 1737 dbSNP
rs185792415 1744 dbSNP
rs967985218 1751 dbSNP
rs1024001112 1757 dbSNP
rs1338852464 1762 dbSNP
rs41279432 1764 dbSNP
rs961007599 1767 dbSNP
rs1002757240 1771 dbSNP
rs1358703847 1774 dbSNP
rs527313728 1775 dbSNP
rs1289163228 1781 dbSNP
rs1447658413 1786 dbSNP
rs1035037347 1788 dbSNP
rs994220776 1790 dbSNP
rs2422978 1811 dbSNP
rs1192627828 1822 dbSNP
rs1464452248 1825 dbSNP
rs2422977 1826 dbSNP
rs1161112258 1828 dbSNP
rs1036016208 1829 dbSNP
rs1170765284 1829 dbSNP
rs751947423 1830 dbSNP
rs1422694090 1831 dbSNP
rs1359166234 1834 dbSNP
rs2422976 1835 dbSNP
rs1183480809 1836 dbSNP
rs1473095339 1839 dbSNP
rs1237274147 1840 dbSNP
rs1196525402 1842 dbSNP
rs562835242 1846 dbSNP
rs1283851389 1860 dbSNP
rs8184832 1861 dbSNP
rs1351430181 1864 dbSNP
rs1458970918 1871 dbSNP
rs1005708498 1874 dbSNP
rs1487265144 1879 dbSNP
rs909099091 1884 dbSNP
rs1256524692 1895 dbSNP
rs1050375197 1900 dbSNP
rs890026668 1902 dbSNP
rs1205540497 1910 dbSNP
rs756244431 1911 dbSNP
rs1050451050 1913 dbSNP
rs1159903745 1926 dbSNP
rs1378022423 1931 dbSNP
rs1419565659 1948 dbSNP
rs544453040 1952 dbSNP
rs1230458960 1953 dbSNP
rs1394673377 1960 dbSNP
rs1384177167 1963 dbSNP
rs1336545247 1966 dbSNP
rs1449363600 1975 dbSNP
rs1309246162 1978 dbSNP
rs1353095673 1979 dbSNP
rs111336022 1984 dbSNP
rs1444994986 1991 dbSNP
rs1379623062 1994 dbSNP
rs931638009 1998 dbSNP
rs1256548636 2003 dbSNP
rs573875223 2006 dbSNP
rs1346559951 2007 dbSNP
rs1255268645 2018 dbSNP
rs965421675 2019 dbSNP
rs140116871 2024 dbSNP
rs1040110688 2033 dbSNP
rs555866498 2038 dbSNP
rs540389128 2042 dbSNP
rs771299826 2043 dbSNP
rs2422975 2050 dbSNP
rs979244687 2054 dbSNP
rs557872743 2057 dbSNP
rs539801155 2059 dbSNP
rs916475405 2061 dbSNP
rs1465017138 2071 dbSNP
rs146136495 2080 dbSNP
rs556491739 2087 dbSNP
rs142968461 2091 dbSNP
rs1251012410 2099 dbSNP
rs981050181 2102 dbSNP
rs1376203611 2103 dbSNP
rs1034986663 2104 dbSNP
rs567333525 2107 dbSNP
rs972747119 2108 dbSNP
rs1231069776 2118 dbSNP
rs1332729749 2118 dbSNP
rs1255186900 2121 dbSNP
rs969668974 2124 dbSNP
rs961432320 2143 dbSNP
rs758090897 2146 dbSNP
rs1255781079 2147 dbSNP
rs1005696267 2156 dbSNP
rs549127079 2162 dbSNP
rs2422974 2183 dbSNP
rs1028541273 2185 dbSNP
rs764750435 2188 dbSNP
rs998849470 2193 dbSNP
rs1014694290 2200 dbSNP
rs1356234875 2201 dbSNP
rs901466057 2207 dbSNP
rs71333973 2214 dbSNP
rs2422973 2218 dbSNP
rs1399811778 2219 dbSNP
rs1462204302 2222 dbSNP
rs1295360959 2224 dbSNP
rs1385812694 2228 dbSNP
rs148101869 2240 dbSNP
rs935014967 2241 dbSNP
rs1384936293 2251 dbSNP
rs754828677 2253 dbSNP
rs1405007828 2254 dbSNP
rs1359390725 2256 dbSNP
rs1340841332 2269 dbSNP
rs1043512401 2271 dbSNP
rs1156724615 2286 dbSNP
rs1276113106 2287 dbSNP
rs180841344 2294 dbSNP
rs931914228 2298 dbSNP
rs562871201 2310 dbSNP
rs1487222067 2311 dbSNP
rs1040167036 2320 dbSNP
rs753815318 2321 dbSNP
rs939262163 2333 dbSNP
rs1423439451 2336 dbSNP
rs3746673 2342 dbSNP
rs189614758 2346 dbSNP
rs763624603 2352 dbSNP
rs936629898 2354 dbSNP
rs1298930310 2357 dbSNP
rs1361051624 2369 dbSNP
rs1401838100 2375 dbSNP
rs1215018970 2377 dbSNP
rs1296101390 2378 dbSNP
rs1487142166 2381 dbSNP
rs1339609496 2387 dbSNP
rs760514642 2402 dbSNP
rs1228471096 2403 dbSNP
rs925306390 2412 dbSNP
rs1261896307 2422 dbSNP
rs1319354492 2427 dbSNP
rs1243407684 2438 dbSNP
rs961377637 2441 dbSNP
rs1016946857 2442 dbSNP
rs1489556311 2442 dbSNP
rs1262854685 2445 dbSNP
rs1483798988 2447 dbSNP
rs562167635 2467 dbSNP
rs954200524 2469 dbSNP
rs1025253082 2470 dbSNP
rs144745509 2471 dbSNP
rs1382307240 2476 dbSNP
rs1295814696 2478 dbSNP
rs1401380695 2482 dbSNP
rs1385561343 2488 dbSNP
rs962217787 2488 dbSNP
rs1448512639 2511 dbSNP
rs1304424071 2514 dbSNP
rs1302242015 2516 dbSNP
rs1395163997 2518 dbSNP
rs1015054161 2520 dbSNP
rs764378815 2524 dbSNP
rs1238530524 2525 dbSNP
rs1005971315 2533 dbSNP
rs965608078 2537 dbSNP
rs887561985 2543 dbSNP
rs1313343613 2549 dbSNP
rs573264372 2558 dbSNP
rs564593221 2561 dbSNP
rs542527816 2564 dbSNP
rs546264113 2571 dbSNP
rs1179511923 2577 dbSNP
rs1043448057 2582 dbSNP
rs1011074420 2584 dbSNP
rs1191597013 2586 dbSNP
rs894934244 2587 dbSNP
rs1176650144 2589 dbSNP
rs901745348 2590 dbSNP
rs1055357702 2591 dbSNP
rs149341930 2592 dbSNP
rs1263021563 2593 dbSNP
rs1357276153 2599 dbSNP
rs556532423 2620 dbSNP
rs538153356 2623 dbSNP
rs1331620773 2641 dbSNP
rs939227855 2643 dbSNP
rs1378406837 2645 dbSNP
rs1443904538 2647 dbSNP
rs1278480687 2652 dbSNP
rs927862117 2659 dbSNP
rs1368908053 2662 dbSNP
rs1221487565 2671 dbSNP
rs1040281779 2672 dbSNP
rs1311978078 2674 dbSNP
rs1036923607 2676 dbSNP
rs376453867 2682 dbSNP
rs536809509 2689 dbSNP
rs1054738216 2699 dbSNP
rs939990854 2704 dbSNP
rs909889337 2706 dbSNP
rs1478311631 2710 dbSNP
rs1316917998 2711 dbSNP
rs374442529 2719 dbSNP
rs1422722132 2720 dbSNP
rs1219910068 2722 dbSNP
rs1437210223 2726 dbSNP
rs1402000158 2734 dbSNP
rs1463789862 2736 dbSNP
rs1326541703 2737 dbSNP
rs954265359 2742 dbSNP
rs1327600480 2746 dbSNP
rs573850615 2751 dbSNP
rs1349967113 2752 dbSNP
rs138739946 2756 dbSNP
rs1439153700 2757 dbSNP
rs1311866213 2760 dbSNP
rs925390158 2765 dbSNP
rs921389067 2767 dbSNP
rs980777027 2768 dbSNP
rs1316279111 2771 dbSNP
rs1218321589 2772 dbSNP
rs948052886 2775 dbSNP
rs184005546 2776 dbSNP
rs977308714 2780 dbSNP
rs918143167 2781 dbSNP
rs1399822804 2790 dbSNP
rs992415755 2791 dbSNP
rs1476415648 2792 dbSNP
rs529214035 2797 dbSNP
rs1187397264 2817 dbSNP
rs1031897892 2827 dbSNP
rs1422597862 2840 dbSNP
rs999114088 2846 dbSNP
rs551041242 2860 dbSNP
rs908032483 2873 dbSNP
rs41279430 2887 dbSNP
rs775394785 2888 dbSNP
rs1401205280 2893 dbSNP
rs1300428315 2894 dbSNP
rs1338903619 2916 dbSNP
rs1197212308 2917 dbSNP
rs1010604855 2926 dbSNP
rs1430203432 2928 dbSNP
rs1029178392 2932 dbSNP
rs894872926 2942 dbSNP
rs1291208906 2946 dbSNP
rs1054904654 2950 dbSNP
rs568530971 2958 dbSNP
rs965691316 2961 dbSNP
rs1018778882 2962 dbSNP
rs1191977596 2965 dbSNP
rs572658259 2972 dbSNP
rs1473602877 2978 dbSNP
rs891743549 2983 dbSNP
rs1054284277 2988 dbSNP
rs1000462931 2994 dbSNP
rs1036869929 3004 dbSNP
rs1357369458 3005 dbSNP
rs939938493 3019 dbSNP
rs759903085 3020 dbSNP
rs869059792 3033 dbSNP
rs397762014 3035 dbSNP
rs909837161 3037 dbSNP
rs114647812 3039 dbSNP
rs1491305436 3039 dbSNP
rs115130093 3040 dbSNP
rs567929456 3040 dbSNP
rs868022877 3040 dbSNP
rs548157766 3041 dbSNP
rs921326563 3041 dbSNP
rs200913049 3042 dbSNP
rs3833324 3042 dbSNP
rs397827942 3042 dbSNP
rs534946136 3042 dbSNP
rs1445749290 3043 dbSNP
rs1439794033 3046 dbSNP
rs566738740 3046 dbSNP
rs1181003979 3049 dbSNP
rs1329515780 3053 dbSNP
rs1378967511 3057 dbSNP
rs1411888351 3058 dbSNP
rs1453754037 3068 dbSNP
rs777183842 3074 dbSNP
rs569279161 3075 dbSNP
rs1404809746 3078 dbSNP
rs1397234310 3084 dbSNP
rs1412928085 3085 dbSNP
rs924774329 3094 dbSNP
rs1336350094 3105 dbSNP
rs1401075825 3106 dbSNP
rs977625055 3117 dbSNP
rs968951309 3122 dbSNP
rs1333894116 3125 dbSNP
rs1021906006 3130 dbSNP
rs1275151216 3136 dbSNP
rs989531809 3141 dbSNP
rs1201329753 3150 dbSNP
rs1387606485 3157 dbSNP
rs959084094 3172 dbSNP
rs1033813542 3185 dbSNP
rs560073427 3186 dbSNP
rs984955279 3188 dbSNP
rs1236750615 3191 dbSNP
rs952327333 3192 dbSNP
rs1379686425 3194 dbSNP
rs150370844 3194 dbSNP
rs1176211876 3198 dbSNP
rs1401275099 3199 dbSNP
rs1467433483 3200 dbSNP
rs1329390669 3202 dbSNP
rs974466866 3206 dbSNP
rs1015375596 3207 dbSNP
rs778162197 3216 dbSNP
rs1390690223 3226 dbSNP
rs888344403 3230 dbSNP
rs965809097 3236 dbSNP
rs761065858 3243 dbSNP
rs1266319172 3251 dbSNP
rs1207539533 3252 dbSNP
rs1318159929 3253 dbSNP
rs1220098657 3263 dbSNP
rs1048327090 3267 dbSNP
rs932614374 3268 dbSNP
rs1249054919 3270 dbSNP
rs899838067 3271 dbSNP
rs1210918438 3274 dbSNP
rs1351173015 3277 dbSNP
rs1041109055 3278 dbSNP
rs564596749 3280 dbSNP
rs955965694 3282 dbSNP
rs546300872 3283 dbSNP
rs199941751 3290 dbSNP
rs924723743 3292 dbSNP
rs1478886634 3293 dbSNP
rs750853077 3293 dbSNP
rs35316224 3294 dbSNP
rs547013941 3294 dbSNP
rs977572820 3294 dbSNP
rs1385122501 3295 dbSNP
rs1367561745 3296 dbSNP
rs1033360134 3298 dbSNP
rs1000001972 3299 dbSNP
rs1302235147 3305 dbSNP
rs1306603603 3305 dbSNP
rs1441891526 3305 dbSNP
rs540709164 3305 dbSNP
rs1164716608 3306 dbSNP
rs1244855547 3307 dbSNP
rs1419635707 3310 dbSNP
rs1378778176 3312 dbSNP
rs1266758963 3313 dbSNP
rs191791421 3317 dbSNP
rs1222406357 3321 dbSNP
rs1264273187 3327 dbSNP
rs1489487678 3330 dbSNP
rs563694631 3333 dbSNP
rs914784511 3339 dbSNP
rs56361284 3341 dbSNP
rs1376697205 3354 dbSNP
rs1166979673 3356 dbSNP
rs1383471903 3363 dbSNP
rs959260362 3367 dbSNP
rs1162877829 3368 dbSNP
rs576595054 3372 dbSNP
rs1269005068 3373 dbSNP
rs138818921 3375 dbSNP
rs1487271621 3384 dbSNP
rs145913015 3385 dbSNP
rs1396317892 3388 dbSNP
rs1224106682 3395 dbSNP
rs1344083993 3397 dbSNP
rs1056464969 3402 dbSNP
rs1015323352 3413 dbSNP
rs769567527 3415 dbSNP
rs908091056 3416 dbSNP
rs1221932685 3421 dbSNP
rs1003979827 3433 dbSNP
rs888301417 3434 dbSNP
rs1027281965 3435 dbSNP
rs922101534 3436 dbSNP
rs188936775 3442 dbSNP
rs747863370 3443 dbSNP
rs1420868366 3444 dbSNP
rs549367133 3444 dbSNP
rs911668214 3445 dbSNP
rs184474447 3447 dbSNP
rs11905174 3448 dbSNP
rs1338318100 3452 dbSNP
rs1032892465 3455 dbSNP
rs903249128 3461 dbSNP
rs979086482 3463 dbSNP
rs1041841600 3470 dbSNP
rs550172212 3478 dbSNP
rs1306670712 3480 dbSNP
rs1313181044 3483 dbSNP
rs1212464538 3490 dbSNP
rs1170396766 3493 dbSNP
rs970038970 3498 dbSNP
rs555819636 3500 dbSNP
rs1199337621 3505 dbSNP
rs1429299142 3531 dbSNP
rs992106458 3534 dbSNP
rs754525372 3535 dbSNP
rs1433587362 3536 dbSNP
rs1476582203 3550 dbSNP
rs928921624 3552 dbSNP
rs1469019296 3559 dbSNP
rs981726041 3569 dbSNP
rs1014124866 3573 dbSNP
rs896552362 3574 dbSNP
rs1035117962 3575 dbSNP
rs1243743890 3576 dbSNP
rs970388413 3585 dbSNP
rs1004852797 3587 dbSNP
rs1225712737 3588 dbSNP
rs150949939 3589 dbSNP
rs767803497 3589 dbSNP
rs982502159 3591 dbSNP
rs952612023 3601 dbSNP
rs1260011542 3604 dbSNP
rs747441901 3605 dbSNP
rs1276257429 3608 dbSNP
rs1201928577 3615 dbSNP
rs1325919363 3623 dbSNP
rs1039161962 3625 dbSNP
rs944896248 3629 dbSNP
rs911611259 3632 dbSNP
rs997116595 3635 dbSNP
rs193183611 3636 dbSNP
rs1019566140 3638 dbSNP
rs1350961724 3639 dbSNP
rs1407369825 3640 dbSNP
rs1301609077 3647 dbSNP
rs1345289781 3648 dbSNP
rs1008208671 3649 dbSNP
rs528710656 3650 dbSNP
rs978484404 3655 dbSNP
rs6052870 3657 dbSNP
rs1022911094 3661 dbSNP
rs1358891954 3670 dbSNP
rs1041784553 3671 dbSNP
rs1335147596 3678 dbSNP
rs1322247300 3682 dbSNP
rs1471200702 3687 dbSNP
rs1011659013 3688 dbSNP
rs780134205 3698 dbSNP
rs1266450823 3714 dbSNP
rs893245157 3716 dbSNP
rs34694789 3717 dbSNP
rs1421051282 3726 dbSNP
rs959870351 3728 dbSNP
rs1185428191 3732 dbSNP
rs758989541 3737 dbSNP
rs1035064166 3744 dbSNP
rs1427043908 3749 dbSNP
rs1005375878 3750 dbSNP
rs886560245 3753 dbSNP
rs1028059082 3754 dbSNP
rs750219493 3772 dbSNP
rs1320747595 3773 dbSNP
rs928869190 3797 dbSNP
rs994874383 3798 dbSNP
rs1461643789 3800 dbSNP
rs1045978633 3805 dbSNP
rs900741284 3810 dbSNP
rs1248033130 3811 dbSNP
rs1039277037 3817 dbSNP
rs1358708246 3817 dbSNP
rs796687735 3822 dbSNP
rs1286167148 3823 dbSNP
rs188768663 3828 dbSNP
rs1305793400 3844 dbSNP
rs1214653237 3847 dbSNP
rs890624490 3848 dbSNP
rs1053328055 3855 dbSNP
rs982891829 3855 dbSNP
rs184222073 3856 dbSNP
rs192179682 3857 dbSNP
rs1440910088 3858 dbSNP
rs78776699 3860 dbSNP
rs1383262753 3861 dbSNP
rs1400280334 3861 dbSNP
rs948385860 3861 dbSNP
rs919698064 3869 dbSNP
rs41279428 3870 dbSNP
rs1314533449 3875 dbSNP
rs963890475 3881 dbSNP
rs1381941780 3888 dbSNP
rs1239687002 3890 dbSNP
rs1281015866 3891 dbSNP
rs1348307878 3894 dbSNP
rs1222808575 3895 dbSNP
rs1263342650 3899 dbSNP
rs1384028992 3913 dbSNP
rs1019513857 3915 dbSNP
rs1201215052 3916 dbSNP
rs1008151503 3923 dbSNP
rs1330209994 3928 dbSNP
rs1184615001 3929 dbSNP
rs967327303 3931 dbSNP
rs1362371197 3944 dbSNP
rs1355702761 3952 dbSNP
rs1173580424 3953 dbSNP
rs1431705250 3954 dbSNP
rs1468499113 3955 dbSNP
rs1336088538 3963 dbSNP
rs1020290315 3964 dbSNP
rs530084399 3968 dbSNP
rs992748444 3976 dbSNP
rs778322018 3981 dbSNP
rs1391849685 3984 dbSNP
rs1330850432 3986 dbSNP
rs893203454 4008 dbSNP
rs374521497 4009 dbSNP
rs186673243 4020 dbSNP
rs950845738 4023 dbSNP
rs765435703 4037 dbSNP
rs756834723 4045 dbSNP
rs1221303854 4047 dbSNP
rs907391099 4048 dbSNP
rs1261900087 4056 dbSNP
rs377760918 4061 dbSNP
rs1198029020 4064 dbSNP
rs759657397 4076 dbSNP
rs868337745 4077 dbSNP
rs908166655 4079 dbSNP
rs1046712722 4083 dbSNP
rs1200598625 4083 dbSNP
rs930996108 4084 dbSNP
rs919661504 4092 dbSNP
rs374321310 4098 dbSNP
rs557535333 4099 dbSNP
rs182424560 4100 dbSNP
rs369768379 4119 dbSNP
rs1237371589 4122 dbSNP
rs1178201757 4123 dbSNP
rs575038008 4127 dbSNP
rs1390816904 4128 dbSNP
rs1303458207 4132 dbSNP
rs1347172422 4133 dbSNP
rs370989019 4134 dbSNP
rs1234882093 4143 dbSNP
rs1205294191 4145 dbSNP
rs1321250528 4148 dbSNP
rs986666318 4149 dbSNP
rs967276271 4150 dbSNP
rs1020645583 4151 dbSNP
rs377294747 4163 dbSNP
rs957615870 4174 dbSNP
rs556633268 4176 dbSNP
rs535131677 4177 dbSNP
rs904246359 4181 dbSNP
rs1360542660 4182 dbSNP
rs1294342452 4189 dbSNP
rs1308990585 4190 dbSNP
rs568030215 4194 dbSNP
rs776736201 4197 dbSNP
rs1262667237 4238 dbSNP
rs1430577635 4250 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC-D2
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1133252. RNA binding protein: AGO2. Condition:Untreated ...

- Majoros WH; Lekprasert P; Mukherjee N; et al., 2013, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaaUACACGACgau 5'
                     ||||||||   
Target 5' ----uuggcacAUGUGCUG--- 3'
1 - 15
Article - Majoros WH; Lekprasert P; Mukherjee N; et al.
- Nature methods, 2013
High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.
LinkOut: [PMID: 23708386]
CLIP-seq Support 1 for dataset GSM1133252
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC-D2 / Untreated
Location of target site ENST00000379400.3 | 3UTR | UUGGCACAUGUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23708386 / GSE46611
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer -0.375 3.3e-4 -0.415 7.2e-5 79 Click to see details
GSE19783 ER+ ER+ breast cancer 0.658 8.1e-4 0.672 5.9e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.512 4.4e-3 0.428 1.6e-2 25 Click to see details
GSE19536 Breast cancer -0.25 6.1e-3 -0.241 7.9e-3 100 Click to see details
GSE38226 Liver fibrosis -0.513 8.7e-3 -0.302 9.2e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.426 1.9e-2 0.362 4.1e-2 24 Click to see details
GSE17306 Multiple myeloma -0.282 2.5e-2 -0.324 1.2e-2 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.348 4.4e-2 -0.147 2.4e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.291 8.9e-2 -0.320 6.8e-2 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.293 1.0e-1 0.068 3.9e-1 20 Click to see details
GSE14794 Lymphoblastoid cells 0.129 1.1e-1 0.039 3.6e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.358 1.1e-1 -0.203 2.5e-1 13 Click to see details
GSE21687 Ependynoma primary tumors 0.127 1.6e-1 0.165 9.6e-2 64 Click to see details
GSE17498 Multiple myeloma -0.095 2.8e-1 -0.010 4.8e-1 40 Click to see details
GSE32688 Pancreatic cancer 0.098 3.0e-1 0.118 2.6e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.144 3.3e-1 0.238 2.3e-1 12 Click to see details
GSE21032 Prostate cancer 0.039 3.6e-1 0.006 4.8e-1 83 Click to see details
GSE21849 B cell lymphoma -0.064 3.7e-1 -0.103 3.0e-1 29 Click to see details
GSE28544 Breast cancer 0.028 4.5e-1 -0.207 1.7e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.012 4.8e-1 -0.129 3.2e-1 16 Click to see details
GSE27834 Pluripotent stem cells 0.012 4.8e-1 -0.129 3.2e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.449 0 0.427 0 68 Click to see details
PRAD -0.335 0.01 -0.284 0.02 50 Click to see details
KICH 0.453 0.01 0.376 0.03 25 Click to see details
THCA 0.275 0.02 0.293 0.01 59 Click to see details
BRCA 0.183 0.05 0.220 0.02 84 Click to see details
STAD -0.271 0.07 -0.308 0.04 32 Click to see details
BLCA -0.214 0.2 -0.160 0.26 18 Click to see details
LUAD 0.194 0.27 0.357 0.13 12 Click to see details
LIHC 0.08 0.29 -0.075 0.3 49 Click to see details
CESC 0.526 0.32 0.500 0.33 3 Click to see details
KIRP 0.08 0.33 0.081 0.33 32 Click to see details
PAAD 0.295 0.35 -0.200 0.4 4 Click to see details
CHOL -0.115 0.38 -0.133 0.37 9 Click to see details
COAD -0.123 0.39 -0.405 0.16 8 Click to see details
ESCA 0.082 0.41 0.164 0.31 11 Click to see details
HNSC 0.036 0.41 0.031 0.42 42 Click to see details
LUSC 0.029 0.43 0.091 0.29 38 Click to see details
UCEC 0.023 0.46 0.049 0.42 19 Click to see details
PCPG -0.02 0.49 -0.500 0.33 3 Click to see details
PCPG -0.02 0.49 -0.500 0.33 3 Click to see details
PCPG -0.02 0.49 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 <