miRTarBase - #MIRT140820 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SMAD3   
Synonyms HSPC193, HsT17436, JV15-2, LDS1C, LDS3, MADH3
Description SMAD family member 3
Transcript NM_005902   
Other Transcripts NM_001145103 , NM_001145104 , NM_001145102   
Expression
Putative miRNA Targets on SMAD3
3'UTR of SMAD3
(miRNA target sites are highlighted)
>SMAD3|NM_005902|3'UTR
   1 AGACATCAAGTATGGTAGGGGAGGGCAGGCTTGGGGAAAATGGCCATGCAGGAGGTGGAGAAAATTGGAACTCTACTCAA
  81 CCCATTGTTGTCAAGGAAGAAGAAATCTTTCTCCCTCAACTGAAGGGGTGCACCCACCTGTTTTCTGAAACACACGAGCA
 161 AACCCAGAGGTGGATGTTATGAACAGCTGTGTCTGCCAAACACATTTACCCTTTGGCCCCACTTTGAAGGGCAAGAAATG
 241 GCGTCTGCTCTGGTGGCTTAAGTGAGCAGAACAGGTAGTATTACACCACCGGCCCCCTCCCCCCAGACTCTTTTTTTGAG
 321 TGACAGCTTTCTGGGATGTCACAGTCCAACCAGAAACACCCCTCTGTCTAGGACTGCAGTGTGGAGTTCACCTTGGAAGG
 401 GCGTTCTAGGTAGGAAGAGCCCGCAGGGCCATGCAGACCTCATGCCCAGCTCTCTGACGCTTGTGACAGTGCCTCTTCCA
 481 GTGAACATTCCCAGCCCAGCCCCGCCCCGCCCCGCCCCACCACTCCAGCAGACCTTGCCCCTTGTGAGCTGGATAGACTT
 561 GGGATGGGGAGGGAGGGAGTTTTGTCTGTCTCCCTCCCCTCTCAGAACATACTGATTGGGAGGTGCGTGTTCAGCAGAAC
 641 CTGCACACAGGACAGCGGGAAAAATCGATGAGCGCCACCTCTTTAAAAACTCACTTACGTTTGTCCTTTTTCACTTTGAA
 721 AAGTTGGAAGGATCTGCTGAGGCCCAGTGCATATGCAATGTATAGTGTCTATTATCACATTAATCTCAAAGAGATTCGAA
 801 TGACGGTAAGTGTTCTCATGAAGCAGGAGGCCCTTGTCGTGGGATGGCATTTGGTCTCAGGCAGCACCACACTGGGTGCG
 881 TCTCCAGTCATCTGTAAGAGCTTGCTCCAGATTCTGATGCATACGGCTATATTGGTTTATGTAGTCAGTTGCATTCATTA
 961 AATCAACTTTATCATATGCTCTTTTAAATGTTTGGTTTATATATTTTCTTTAAAAATCCTGGGCTGGCACATTGACTGGG
1041 AAACCTGAGTGAGACCCAGCAACTGCTTCTCTCCCTTCTCTCTCCTGAGGTGAAGCTTTTCCAGGTTTTGTTGAAGAGAT
1121 ACCTGCCAGCACTTCTGCAAGCTGAAATTTACAGAAGCAAATTCACCAGAAGGGAAACATCTCAGGCCAACATAGGCAAA
1201 TGAAAAGGGCTATTAAAATATTTTTACACCTTTGAAAATTGCAGGCTTGGTACAAAGAGGTCTGTCATCTTCCCCCTGGG
1281 ATATAAGATGATCTAGCTCCCGGTAGAGGATCACCGGTGACAACTATAGCAGTTGTATTGTGTAACAAGTACTGCTCCCA
1361 GCAGCAATTAGGGAGAAAACTAGTCTAAATTATTTCAACTGGAAAAAAGAAAAAAGAGTCCTCTTCTTTTCCCAGCCTTT
1441 TGCAGAACACAGTAGACAGAACTGCCACCTTCAATTGGTACTTTATTCTTTGCTGCTGTTTTTGTATAAAATGACCTATC
1521 CCACGTTTTTGCATGAATTTATAGCAGGAAAAATCAAGGGATTTCCTATGGAAGTCCTGCTTTATTCCAGGTGAAGGGAA
1601 GGAAGTGTATATACTTTTGGCAAGTCATACAGCTCAAATGTGATGAGATTTCTGATGTTAGAGGGAGATGGAGAGGCTTC
1681 CTGATGCCTCATCTGCAGGGTCCTGTGCCTCTGAAGTTCTAGCCATGAGGTTTCCAGGTAGGACAGCTGCTCCCCAAGCC
1761 TCCTGAGGACACAGGAAGAGACGGAAGGAGCACCTTGACAGACTTGTGTGAGTCTTCTCGAAGGAGGGTTGACTCAGAAC
1841 CCAGAGACAATACAAAACCCCTCACTTCCTCTGAGAGGGCCAAATGCTGTGAGTCTGAAGTATGTGCCTGGTGTGAAATG
1921 ATCTATGGCCTGTTTCTTACACAGGAAGCCCCCTGAACCTCCTGTACATGTGTTCATGTTCCCAGCCAGCTCTGAGACCC
2001 AGGAACCAAATATTCCATTTTGGCTTCTGCTAGAGCAGTCATGGTTCCTCTCCTAAAAGCCATGGGCAGCAGTTTCCGAG
2081 GGCCTGCATGATCCACCTGCTGCACGATCCTATGAGGGCTTCCTGTGGCACACAGCCCTCTGGGTGCTTGGGAACTAGCT
2161 TCAGGCACAGCCTGATTCTGGTGATCCAGTGATCTATGGAAGTCGTGTCTTACTCCAGGTGAAGGGGGAAAAAAAAAGCC
2241 TATACTTTGGCAGGTTATGAACTTTGAATGTGATGAAATGACACGTTTGGCTGCATTTGGATGGTGTCTTAGAACCCTCA
2321 TTGCTCAGACCTGAAGGCTACTTCTAGGAGCATGAAGTTTGAGTTTTGTGTTTTTCCAAAGGATACTTCCTTGGCCCTTT
2401 TTCTTTATTGACTAGACCACCAGAGGAGGATGTGTGGGATTGTAGGCAAACCCACCTGTGGCATCACTGAAAATAAATTT
2481 GATCATACCTAAGAGGTTAGGAAATGGTGCCATTCCCACCTTAGAGTGCTACATAGGTGCTTTGGGCGTATGTAACATTA
2561 GTGTCCTTCCTTGAAGCCACAAGCTAGTTTTCTTAGTTTTAAAATCCTGTTGTATGAATGGCATTTGTATATTAAAACAC
2641 TTTTTTAAAGGACAGTTGAAAAGGGCAAGAGGAAACCAGGGCAGTTCTAGAGGAGTGCTGGTGACTGGATAGCAGTTTTA
2721 AGTGGCGTTCACCTAGTCAACACGACCGCGTGTGTTGCCCCTGCCCTGGGCTCCCCGCCATGACATCTTCACCTTGCAGC
2801 TTGTGCTGAGACTGACCCAAGTGCAGCTAGCACTGGGACACAGATCCTTGTCTTCAGCACCTTCCAAGGAGCCAACTTTT
2881 ATTCCCTTTCCTCTCTCCCCTCCCCACCTCGCTTCTTCCCAATTTAGTAACTTAGATGCTTCCAGCACATACGTAGGTAG
2961 CTACCCCAGCCGGTTTGGATTACAGGCCTGTGCTGGAACATCATCTCAGTTGGCCACCTTCCTGGCAGGCTGTAGACCTG
3041 ACATTTTGAGACAAGCCTAGAGTCAGGAGCAGGGACTTTGACTCTTAGGAAGAGCACACATGAGGGCAAGGCTGCTGGCA
3121 GACGTCTCCATTGTCCTTATGTTGTCTGTGTTGTATTTTTTTTTTTTTATTGACCATGGTGATTATTTTTTTAAACCATC
3201 GTTAATATACTGAAGTGAGCTATAGCACATATCATGTGCTTAGTTTGTTTATTTTTCTCCATCTCCCCTTGGCTTCCTAG
3281 AGTTTGGACATATTCCAGGCTAAATGCTTTTACTCAAGACTACAGAAAGGTTTGAAGTAGTGTGTGCATGGCATGCACGT
3361 ATGTAAGTAATCTGGGGAAGAAGCAAAGATCTGTTTCATTCTTAGCCTCAGGCCTCATGAGGGTCTCCACAGGGCCGGAG
3441 CTCAGGTTACACCACTCCTTCGTCCTTACAGGAGATGTAGGGAGAAGAATCTGCAGGCTGCTTGTAGGACTGTTCACCAA
3521 GGGGGATACCAGCAGCAAGAGAGTGCACCCGTTTAGCCCTGGACCCTGTTTCTTACTGTGTGACTTGGCTAGAGTTGGGA
3601 GTTCCCCCAAAATAAACGTGTCCCCATTTTACCAGAACCAAACCTCAACACAGCGAAGCTGTACTGTCTTTGTGTGGCAA
3681 AGATGTTCCCTTGTAGGCCCCTTTCAGGTAACCGTCTTCACAATGTATTTTCATCACAGTTTAAGGAGCATCAGCCGCTT
3761 CTCAAGTGGGTAGGGAAAGCAGAAAAACGTACGCAAGAGGACATGGATCCAAAATGATGATGAAGCATCTCCCATGGGGA
3841 GGTGATGGTGGGGAGATGATGGGCTAAACAGGCAACTTTTCAAAAACACAGCTATCATAGAAAAGAAACTTGCCTCATGT
3921 AAACTGGATTGAGAAATTCTCAGTGATTCTGCAATGGATTTTTTTTTAATGCAGAAGTAATGTATACTCTAGTATTCTGG
4001 TGTTTTTATATTTATGTAATAATTTCTTAAAACCATTCAGACAGATAACTATTTAATTTTTTTTAAGAAAGTTGGAAAGG
4081 TCTCTCCTCCCAAGGACAGTGGCTGGAAGAGTTGGGGCACAGCCAGTTCTGAATGTTGGTGGAGGGTGTAGTGGCTTTTT
4161 GGCTCAGCATCCAGAAACACCAAACCAGGCTGGCTAAACAAGTGGCCGCGTGTAAAAACAGACAGCTCTGAGTCAAATCT
4241 GGGCCCTTCCACAAGGGTCCTCTGAACCAAGCCCCACTCCCTTGCTAGGGGTGAAAGCATTACAGAGAGATGGAGCCATC
4321 TATCCAAGAAGCCTTCACTCACCTTCACTGCTGCTGTTGCAACTCGGCTGTTCTGGACTCTGATGTGTGTGGAGGGATGG
4401 GGAATAGAACATTGACTGTGTTGATTACCTTCACTATTCGGCCAGCCTGACCTTTTAATAACTTTGTAAAAAGCATGTAT
4481 GTATTTATAGTGTTTTAGATTTTTCTAACTTTTATATCTTAAAAGCAGAGCACCTGTTTAAGCATTGTACCCCTATTGTT
4561 AAAGATTTGTGTCCTCTCATTCCCTCTCTTCCTCTTGTAAGTGCCCTTCTAATAAACTTTTCATGGAAAAGCTCCTGTGC
4641 CAGGAGCTCAGTCTGAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ::||| | ||||||| 
Target 5' ggtactTTATTCTTTGCTGCTg 3'
1477 - 1498 156.00 -12.20
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||| ||   ||||||| 
Target 5' cactcACC-TTCACTGCTGCTg 3'
4336 - 4356 148.00 -15.60
3
miRNA  3' guGUUU----GGUAAUAC--ACGACGAu 5'
            ||||    ||||| ||  | ||||| 
Target 5' acCAAATATTCCATTTTGGCTTCTGCTa 3'
2005 - 2032 136.00 -14.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
477569 1 ClinVar
925592 5 ClinVar
925287 6 ClinVar
885694 31 ClinVar
316865 52 ClinVar
316866 196 ClinVar
316867 251 ClinVar
316868 292 ClinVar
316869 293 ClinVar
316870 302 ClinVar
316871 305 ClinVar
316872 319 ClinVar
316873 403 ClinVar
316874 420 ClinVar
316875 496 ClinVar
316876 553 ClinVar
316877 553 ClinVar
316878 574 ClinVar
316879 579 ClinVar
884817 595 ClinVar
316880 610 ClinVar
316881 627 ClinVar
316882 633 ClinVar
316883 655 ClinVar
316884 657 ClinVar
316885 666 ClinVar
316886 679 ClinVar
316887 790 ClinVar
316888 799 ClinVar
885747 805 ClinVar
885748 806 ClinVar
316889 844 ClinVar
316890 926 ClinVar
885749 938 ClinVar
316891 982 ClinVar
316892 1106 ClinVar
885750 1160 ClinVar
316893 1166 ClinVar
316894 1182 ClinVar
316895 1218 ClinVar
316896 1246 ClinVar
316897 1256 ClinVar
316898 1316 ClinVar
888024 1317 ClinVar
316899 1326 ClinVar
316900 1327 ClinVar
316901 1356 ClinVar
316902 1424 ClinVar
316903 1444 ClinVar
888025 1456 ClinVar
316904 1494 ClinVar
316905 1516 ClinVar
316906 1549 ClinVar
884897 1562 ClinVar
884898 1584 ClinVar
316907 1598 ClinVar
316908 1615 ClinVar
316909 1642 ClinVar
316910 1645 ClinVar
316911 1696 ClinVar
316912 1750 ClinVar
316913 1768 ClinVar
316914 1778 ClinVar
316915 1785 ClinVar
316916 1791 ClinVar
316917 1797 ClinVar
316918 1806 ClinVar
316919 1820 ClinVar
316920 1821 ClinVar
316921 1832 ClinVar
316922 1854 ClinVar
316923 1881 ClinVar
885819 1916 ClinVar
316924 2014 ClinVar
316925 2027 ClinVar
316926 2029 ClinVar
316927 2039 ClinVar
316928 2047 ClinVar
316929 2228 ClinVar
316930 2230 ClinVar
316931 2243 ClinVar
316932 2246 ClinVar
316933 2252 ClinVar
316934 2283 ClinVar
316935 2286 ClinVar
316936 2292 ClinVar
316937 2304 ClinVar
316938 2404 ClinVar
316939 2445 ClinVar
316940 2454 ClinVar
316941 2477 ClinVar
316942 2548 ClinVar
316943 2574 ClinVar
316944 2574 ClinVar
316945 2581 ClinVar
316946 2597 ClinVar
884972 2787 ClinVar
316947 2794 ClinVar
316948 2892 ClinVar
316949 2964 ClinVar
316950 2996 ClinVar
316951 3038 ClinVar
316952 3121 ClinVar
316953 3130 ClinVar
316954 3148 ClinVar
316955 3149 ClinVar
316956 3173 ClinVar
316957 3173 ClinVar
316958 3513 ClinVar
316959 3662 ClinVar
316960 3720 ClinVar
316961 3739 ClinVar
316962 4196 ClinVar
316963 4446 ClinVar
316964 4557 ClinVar
316965 4557 ClinVar
COSN31599250 37 COSMIC
COSN30526728 66 COSMIC
COSN30160939 93 COSMIC
COSN25111326 375 COSMIC
COSN8749860 447 COSMIC
COSN24860616 504 COSMIC
COSN26032434 1182 COSMIC
COSN1682737 1215 COSMIC
COSN23846613 1294 COSMIC
COSN31522457 1394 COSMIC
COSN15663338 1403 COSMIC
COSN31522074 1442 COSMIC
COSN30541884 1523 COSMIC
COSN8590273 1662 COSMIC
COSN15662347 1781 COSMIC
COSN1179303 2238 COSMIC
COSN21230938 2251 COSMIC
COSN16053798 2281 COSMIC
COSN5400108 2576 COSMIC
COSN7246885 2750 COSMIC
COSN31485143 2943 COSMIC
COSN6278500 2953 COSMIC
COSN31534655 2954 COSMIC
COSN31490464 3003 COSMIC
COSN22667664 3049 COSMIC
COSN20112198 3064 COSMIC
COSN20112204 3172 COSMIC
COSN27533936 3172 COSMIC
COSN31481121 3267 COSMIC
COSN22175536 3608 COSMIC
COSN25728158 3795 COSMIC
COSN6278501 4161 COSMIC
COSN27995854 4214 COSMIC
COSN29418396 4322 COSMIC
COSN26639055 4357 COSMIC
COSN21433084 4440 COSMIC
COSN31548044 4505 COSMIC
COSN22487727 4549 COSMIC
rs8025774 403 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1252748287 5 dbSNP
rs772778568 6 dbSNP
rs1432305602 11 dbSNP
rs1181485032 14 dbSNP
rs758196703 17 dbSNP
rs766151342 21 dbSNP
rs189249001 26 dbSNP
rs754534264 28 dbSNP
rs1395131111 29 dbSNP
rs780848724 30 dbSNP
rs201206131 31 dbSNP
rs779372678 34 dbSNP
rs1392220076 36 dbSNP
rs1309390875 38 dbSNP
rs746421127 43 dbSNP
rs772481721 47 dbSNP
rs775658712 48 dbSNP
rs762375788 51 dbSNP
rs368655036 52 dbSNP
rs535477771 54 dbSNP
rs1369192062 59 dbSNP
rs1018020140 61 dbSNP
rs182280596 66 dbSNP
rs1396411390 70 dbSNP
rs1011730589 72 dbSNP
rs1432305540 75 dbSNP
rs1020465959 78 dbSNP
rs1380862743 86 dbSNP
rs1421393378 103 dbSNP
rs1481964508 106 dbSNP
rs1171561074 119 dbSNP
rs1211562305 121 dbSNP
rs1257898497 125 dbSNP
rs565727784 125 dbSNP
rs563970330 127 dbSNP
rs777850257 133 dbSNP
rs1432832925 148 dbSNP
rs534838557 156 dbSNP
rs958733373 157 dbSNP
rs111695641 166 dbSNP
rs1020372057 169 dbSNP
rs1309284311 171 dbSNP
rs1378319549 181 dbSNP
rs1242895045 185 dbSNP
rs1307934147 190 dbSNP
rs886051381 196 dbSNP
rs1301745038 203 dbSNP
rs1311950535 205 dbSNP
rs576999514 216 dbSNP
rs1376739943 223 dbSNP
rs942103876 231 dbSNP
rs79827660 236 dbSNP
rs1345366719 239 dbSNP
rs1465122232 239 dbSNP
rs986801638 240 dbSNP
rs56036573 243 dbSNP
rs115213021 244 dbSNP
rs754034578 251 dbSNP
rs1188556483 261 dbSNP
rs1476106159 268 dbSNP
rs1051057461 271 dbSNP
rs1198749569 274 dbSNP
rs1482983689 275 dbSNP
rs1441513082 278 dbSNP
rs1210875022 281 dbSNP
rs920110262 291 dbSNP
rs146287966 292 dbSNP
rs886051382 293 dbSNP
rs942394268 294 dbSNP
rs1039416327 295 dbSNP
rs1177884298 296 dbSNP
rs1370995648 297 dbSNP
rs72661159 302 dbSNP
rs917671015 304 dbSNP
rs565932125 305 dbSNP
rs1449711406 307 dbSNP
rs1020837184 308 dbSNP
rs1455372673 308 dbSNP
rs561705330 309 dbSNP
rs1367439621 311 dbSNP
rs1165459042 313 dbSNP
rs949107841 314 dbSNP
rs79368607 319 dbSNP
rs746763813 325 dbSNP
rs1423345231 328 dbSNP
rs936608963 336 dbSNP
rs1053697016 337 dbSNP
rs1262447798 339 dbSNP
rs1218215495 359 dbSNP
rs892337846 364 dbSNP
rs1035968653 367 dbSNP
rs1358869737 376 dbSNP
rs1264232262 380 dbSNP
rs1009399756 381 dbSNP
rs958681165 392 dbSNP
rs991457482 400 dbSNP
rs1051556350 401 dbSNP
rs8025774 403 dbSNP
rs1008285515 404 dbSNP
rs562488816 415 dbSNP
rs78329172 420 dbSNP
rs781146835 423 dbSNP
rs996186820 424 dbSNP
rs1246058244 425 dbSNP
rs1488732359 426 dbSNP
rs1374721238 448 dbSNP
rs1192728107 454 dbSNP
rs1417075046 459 dbSNP
rs1194457093 460 dbSNP
rs972184125 468 dbSNP
rs1170914555 473 dbSNP
rs556033972 474 dbSNP
rs929866938 481 dbSNP
rs1027237373 483 dbSNP
rs1340760846 485 dbSNP
rs1459408147 490 dbSNP
rs886051383 496 dbSNP
rs1225604265 499 dbSNP
rs533376218 499 dbSNP
rs987105992 499 dbSNP
rs369493674 504 dbSNP
rs1163396641 505 dbSNP
rs1372382309 508 dbSNP
rs1306072417 509 dbSNP
rs55978804 510 dbSNP
rs765527642 510 dbSNP
rs982922530 514 dbSNP
rs529503181 515 dbSNP
rs1360288448 518 dbSNP
rs1399691941 519 dbSNP
rs1279076459 520 dbSNP
rs1320188213 521 dbSNP
rs1438724558 522 dbSNP
rs1231541507 523 dbSNP
rs1289177241 525 dbSNP
rs1322287979 528 dbSNP
rs1223631127 529 dbSNP
rs748060441 533 dbSNP
rs1487829957 535 dbSNP
rs918058947 539 dbSNP
rs530801416 543 dbSNP
rs769408016 553 dbSNP
rs1273857352 554 dbSNP
rs1473995304 560 dbSNP
rs886051384 574 dbSNP
rs550707472 579 dbSNP
rs549263304 585 dbSNP
rs565764510 597 dbSNP
rs903331256 600 dbSNP
rs1413853463 603 dbSNP
rs564556206 610 dbSNP
rs1167512505 616 dbSNP
rs1416225156 624 dbSNP
rs557988479 626 dbSNP
rs886051385 627 dbSNP
rs1473138170 628 dbSNP
rs886051386 633 dbSNP
rs926311474 638 dbSNP
rs936343740 652 dbSNP
rs571689385 655 dbSNP
rs886051387 657 dbSNP
rs1016241219 658 dbSNP
rs1211679246 661 dbSNP
rs186841203 666 dbSNP
rs945241221 669 dbSNP
rs1000812684 671 dbSNP
rs1051608526 672 dbSNP
rs890267235 673 dbSNP
rs1008751347 674 dbSNP
rs1039775805 675 dbSNP
rs963410451 675 dbSNP
rs1283714996 676 dbSNP
rs886051388 679 dbSNP
rs1379953736 681 dbSNP
rs1356071213 698 dbSNP
rs556286103 699 dbSNP
rs995523806 700 dbSNP
rs1333773359 704 dbSNP
rs1457907171 705 dbSNP
rs762690517 706 dbSNP
rs951277317 709 dbSNP
rs986623400 710 dbSNP
rs1415206407 716 dbSNP
rs1184067048 721 dbSNP
rs1027369834 722 dbSNP
rs1236322008 725 dbSNP
rs951646902 730 dbSNP
rs1004398812 737 dbSNP
rs1466026104 745 dbSNP
rs1265830252 749 dbSNP
rs1207928362 757 dbSNP
rs1335196276 759 dbSNP
rs1291971144 760 dbSNP
rs1226481007 764 dbSNP
rs1025122117 776 dbSNP
rs78383292 779 dbSNP
rs191679355 790 dbSNP
rs1435891314 798 dbSNP
rs138327222 799 dbSNP
rs1217099486 805 dbSNP
rs770764038 806 dbSNP
rs1033431705 807 dbSNP
rs1404024585 807 dbSNP
rs1413695648 810 dbSNP
rs1168738123 813 dbSNP
rs555675656 816 dbSNP
rs572102859 818 dbSNP
rs1484510892 826 dbSNP
rs540986513 827 dbSNP
rs1488694020 837 dbSNP
rs957986481 839 dbSNP
rs1041844857 840 dbSNP
rs55970514 844 dbSNP
rs913541184 854 dbSNP
rs1229281078 859 dbSNP
rs945292232 863 dbSNP
rs1057278921 865 dbSNP
rs894652144 868 dbSNP
rs1013168738 873 dbSNP
rs532996307 875 dbSNP
rs543663488 880 dbSNP
rs759877290 881 dbSNP
rs1349854436 884 dbSNP
rs1309132112 885 dbSNP
rs943207614 885 dbSNP
rs1387728566 893 dbSNP
rs1167579200 897 dbSNP
rs1433481701 898 dbSNP
rs181289276 918 dbSNP
rs751729329 925 dbSNP
rs886051389 926 dbSNP
rs899144169 929 dbSNP
rs993543225 931 dbSNP
rs1207150016 933 dbSNP
rs1484083962 937 dbSNP
rs1272484755 938 dbSNP
rs1159661151 943 dbSNP
rs1039242021 955 dbSNP
rs1203903230 956 dbSNP
rs1313056687 974 dbSNP
rs186538259 975 dbSNP
rs899924192 980 dbSNP
rs1413029737 981 dbSNP
rs886051390 982 dbSNP
rs1367287606 991 dbSNP
rs190014997 995 dbSNP
rs1289543268 1001 dbSNP
rs1412151547 1002 dbSNP
rs1333733465 1011 dbSNP
rs931363295 1013 dbSNP
rs142827677 1019 dbSNP
rs887092369 1022 dbSNP
rs1306936935 1036 dbSNP
rs1466086791 1041 dbSNP
rs1450299083 1046 dbSNP
rs1173471028 1051 dbSNP
rs1307118098 1059 dbSNP
rs1412361198 1061 dbSNP
rs1004451151 1075 dbSNP
rs528490702 1081 dbSNP
rs1471607007 1085 dbSNP
rs1250967038 1089 dbSNP
rs1176736424 1091 dbSNP
rs1483599572 1103 dbSNP
rs1376112007 1104 dbSNP
rs8031440 1106 dbSNP
rs571662141 1111 dbSNP
rs537594091 1117 dbSNP
rs1323284986 1121 dbSNP
rs906735286 1132 dbSNP
rs1230612083 1133 dbSNP
rs1349236237 1148 dbSNP
rs550791512 1150 dbSNP
rs1002378365 1160 dbSNP
rs567052377 1166 dbSNP
rs914518570 1168 dbSNP
rs1199590186 1172 dbSNP
rs957824976 1178 dbSNP
rs72661160 1182 dbSNP
rs1020653442 1184 dbSNP
rs764124750 1186 dbSNP
rs1300728138 1192 dbSNP
rs1465174163 1193 dbSNP
rs1201850004 1194 dbSNP
rs142609762 1197 dbSNP
rs1161172385 1198 dbSNP
rs924273601 1205 dbSNP
rs938408080 1207 dbSNP
rs992614229 1209 dbSNP
rs1424490943 1213 dbSNP
rs1258276095 1214 dbSNP
rs150600147 1218 dbSNP
rs911816181 1219 dbSNP
rs943247487 1226 dbSNP
rs948891063 1228 dbSNP
rs112747060 1231 dbSNP
rs1327474750 1240 dbSNP
rs1260676538 1241 dbSNP
rs8031627 1246 dbSNP
rs1310038478 1247 dbSNP
rs1451259597 1248 dbSNP
rs757346607 1250 dbSNP
rs569581429 1256 dbSNP
rs1432668529 1257 dbSNP
rs577556064 1261 dbSNP
rs1163779895 1265 dbSNP
rs1061341 1267 dbSNP
rs1048450925 1272 dbSNP
rs887144695 1276 dbSNP
rs537802993 1287 dbSNP
rs890460961 1294 dbSNP
rs1389914140 1295 dbSNP
rs1329443279 1296 dbSNP
rs1399618709 1298 dbSNP
rs1008934157 1302 dbSNP
rs940023434 1303 dbSNP
rs1046342498 1314 dbSNP
rs886051391 1316 dbSNP
rs996604810 1317 dbSNP
rs139620908 1326 dbSNP
rs886051392 1327 dbSNP
rs1033870230 1328 dbSNP
rs1210802040 1330 dbSNP
rs1275172824 1337 dbSNP
rs893945387 1342 dbSNP
rs182242274 1350 dbSNP
rs886051393 1356 dbSNP
rs1020707349 1360 dbSNP
rs1346719868 1387 dbSNP
rs1264178168 1389 dbSNP
rs1244650254 1394 dbSNP
rs1216378984 1399 dbSNP
rs752492048 1402 dbSNP
rs1457811853 1403 dbSNP
rs750644411 1404 dbSNP
rs1299388466 1405 dbSNP
rs966404405 1406 dbSNP
rs1325487009 1409 dbSNP
rs968624366 1410 dbSNP
rs977747246 1410 dbSNP
rs1199892684 1411 dbSNP
rs1302427969 1415 dbSNP
rs1008576954 1417 dbSNP
rs1240574502 1419 dbSNP
rs1371182366 1421 dbSNP
rs1450328511 1421 dbSNP
rs1031326147 1422 dbSNP
rs372217473 1422 dbSNP
rs2278670 1424 dbSNP
rs992562365 1426 dbSNP
rs886051394 1444 dbSNP
rs1479158835 1456 dbSNP
rs1435243567 1460 dbSNP
rs1168782189 1473 dbSNP
rs542786788 1478 dbSNP
rs1423091058 1479 dbSNP
rs886051395 1494 dbSNP
rs1466213488 1497 dbSNP
rs1483102977 1497 dbSNP
rs1172836847 1506 dbSNP
rs964679949 1512 dbSNP
rs559626107 1514 dbSNP
rs886051396 1516 dbSNP
rs975050197 1525 dbSNP
rs778591910 1526 dbSNP
rs28363812 1543 dbSNP
rs886051397 1549 dbSNP
rs1275046716 1562 dbSNP
rs948465931 1569 dbSNP
rs1324010211 1570 dbSNP
rs577631492 1584 dbSNP
rs1397813147 1587 dbSNP
rs748088336 1588 dbSNP
rs886051398 1598 dbSNP
rs777408805 1607 dbSNP
rs886051399 1615 dbSNP
rs908636623 1625 dbSNP
rs528721359 1627 dbSNP
rs1309996810 1631 dbSNP
rs1277170426 1636 dbSNP
rs920764310 1639 dbSNP
rs1396091966 1641 dbSNP
rs886051400 1642 dbSNP
rs886051401 1645 dbSNP
rs1173332341 1651 dbSNP
rs551779423 1655 dbSNP
rs1219945914 1658 dbSNP
rs1376222522 1660 dbSNP
rs1263110510 1662 dbSNP
rs1354914675 1686 dbSNP
rs886051402 1696 dbSNP
rs188001329 1700 dbSNP
rs1254571065 1703 dbSNP
rs1179445653 1706 dbSNP
rs1436683905 1718 dbSNP
rs940074144 1719 dbSNP
rs1278921925 1726 dbSNP
rs1209746861 1731 dbSNP
rs1046394441 1740 dbSNP
rs886051403 1750 dbSNP
rs1201760611 1752 dbSNP
rs927930948 1753 dbSNP
rs938300056 1754 dbSNP
rs929540904 1756 dbSNP
rs1055769288 1762 dbSNP
rs1191870146 1765 dbSNP
rs533635017 1768 dbSNP
rs1286346481 1773 dbSNP
rs1262759674 1774 dbSNP
rs369386357 1778 dbSNP
rs1335117334 1781 dbSNP
rs748749707 1783 dbSNP
rs890443089 1784 dbSNP
rs886051404 1785 dbSNP
rs1011074834 1787 dbSNP
rs530788405 1791 dbSNP
rs1414883291 1796 dbSNP
rs141408841 1797 dbSNP
rs886051405 1797 dbSNP
rs1163755294 1798 dbSNP
rs1392693699 1803 dbSNP
rs191114875 1806 dbSNP
rs1297290532 1807 dbSNP
rs1189015795 1810 dbSNP
rs1340765320 1813 dbSNP
rs902278667 1815 dbSNP
rs886051406 1820 dbSNP
rs886051407 1821 dbSNP
rs1310020071 1824 dbSNP
rs1242115894 1825 dbSNP
rs1209165713 1827 dbSNP
rs770567861 1829 dbSNP
rs1330899230 1830 dbSNP
rs1339353473 1831 dbSNP
rs886051408 1832 dbSNP
rs964719315 1836 dbSNP
rs996143513 1850 dbSNP
rs1450272919 1853 dbSNP
rs886051409 1854 dbSNP
rs1380912581 1867 dbSNP
rs760948248 1868 dbSNP
rs1027983795 1870 dbSNP
rs144205938 1881 dbSNP
rs998781913 1884 dbSNP
rs1391219415 1890 dbSNP
rs983254925 1891 dbSNP
rs1032032182 1896 dbSNP
rs1285311129 1897 dbSNP
rs745490452 1903 dbSNP
rs1362150283 1904 dbSNP
rs907683935 1904 dbSNP
rs1415140376 1910 dbSNP
rs1214941312 1914 dbSNP
rs961459942 1916 dbSNP
rs759130087 1929 dbSNP
rs959682599 1930 dbSNP
rs1188741775 1932 dbSNP
rs1466095589 1939 dbSNP
rs1245892086 1951 dbSNP
rs1214797088 1963 dbSNP
rs772457638 1964 dbSNP
rs771658087 1970 dbSNP
rs1291902520 1975 dbSNP
rs1230135269 1979 dbSNP
rs1285710130 2004 dbSNP
rs1357316265 2010 dbSNP
rs183913368 2014 dbSNP
rs777061255 2018 dbSNP
rs1229329165 2025 dbSNP
rs886051410 2027 dbSNP
rs549152312 2029 dbSNP
rs938000581 2034 dbSNP
rs886051411 2039 dbSNP
rs1268849731 2042 dbSNP
rs368370773 2043 dbSNP
rs1351014883 2045 dbSNP
rs761162475 2047 dbSNP
rs1422237900 2054 dbSNP
rs879249256 2071 dbSNP
rs1364339330 2072 dbSNP
rs113309733 2078 dbSNP
rs147761102 2079 dbSNP
rs1437692286 2083 dbSNP
rs1042599418 2089 dbSNP
rs1248410634 2094 dbSNP
rs1220087248 2097 dbSNP
rs1489881858 2102 dbSNP
rs557746378 2106 dbSNP
rs983708301 2107 dbSNP
rs115307123 2113 dbSNP
rs944469895 2117 dbSNP
rs1040519684 2119 dbSNP
rs944978027 2123 dbSNP
rs536610569 2125 dbSNP
rs1277129259 2130 dbSNP
rs900205473 2131 dbSNP
rs1421204393 2135 dbSNP
rs996248664 2138 dbSNP
rs1300711535 2144 dbSNP
rs1400963496 2163 dbSNP
rs1431074161 2173 dbSNP
rs556660083 2183 dbSNP
rs1396124799 2186 dbSNP
rs1314190806 2188 dbSNP
rs1027289671 2191 dbSNP
rs1169255181 2192 dbSNP
rs1385665921 2193 dbSNP
rs1426924445 2195 dbSNP
rs777131267 2197 dbSNP
rs1309049359 2198 dbSNP
rs1480102998 2202 dbSNP
rs921942418 2205 dbSNP
rs573356440 2206 dbSNP
rs556655485 2210 dbSNP
rs1004732930 2213 dbSNP
rs1481634627 2218 dbSNP
rs1249856273 2222 dbSNP
rs1204023289 2224 dbSNP
rs1254484783 2227 dbSNP
rs11638476 2228 dbSNP
rs1222049808 2229 dbSNP
rs1289484336 2229 dbSNP
rs573496525 2229 dbSNP
rs762028441 2229 dbSNP
rs188412401 2230 dbSNP
rs982250236 2231 dbSNP
rs1245000661 2238 dbSNP
rs1448388293 2239 dbSNP
rs117707762 2243 dbSNP
rs959443817 2244 dbSNP
rs886051412 2246 dbSNP
rs991243308 2248 dbSNP
rs886051413 2252 dbSNP
rs1380755438 2254 dbSNP
rs1412658174 2255 dbSNP
rs1161221782 2265 dbSNP
rs915223832 2271 dbSNP
rs1248421524 2278 dbSNP
rs1022603608 2279 dbSNP
rs12595334 2283 dbSNP
rs139575773 2285 dbSNP
rs62014609 2286 dbSNP
rs886051414 2292 dbSNP
rs565420956 2294 dbSNP
rs1466198660 2303 dbSNP
rs1323217582 2304 dbSNP
rs886051415 2304 dbSNP
rs1269340502 2307 dbSNP
rs767340373 2309 dbSNP
rs950508018 2326 dbSNP
rs984002362 2329 dbSNP
rs1304121042 2330 dbSNP
rs555997375 2331 dbSNP
rs1380944498 2342 dbSNP
rs1397469636 2352 dbSNP
rs1334239734 2358 dbSNP
rs193013035 2360 dbSNP
rs1040506824 2364 dbSNP
rs1445287333 2384 dbSNP
rs752493489 2387 dbSNP
rs900258244 2388 dbSNP
rs750918524 2389 dbSNP
rs931719758 2393 dbSNP
rs1424437839 2400 dbSNP
rs755985886 2404 dbSNP
rs974997524 2407 dbSNP
rs777786341 2414 dbSNP
rs921932682 2417 dbSNP
rs1249106432 2418 dbSNP
rs1207247824 2441 dbSNP
rs145102966 2445 dbSNP
rs1260619610 2446 dbSNP
rs372633359 2452 dbSNP
rs561370577 2453 dbSNP
rs886051416 2454 dbSNP
rs886051417 2477 dbSNP
rs1043806470 2478 dbSNP
rs530174899 2480 dbSNP
rs935450104 2485 dbSNP
rs80226876 2490 dbSNP
rs1244697127 2492 dbSNP
rs565929299 2496 dbSNP
rs1365468716 2520 dbSNP
rs1297529370 2523 dbSNP
rs1380289624 2531 dbSNP
rs895659471 2544 dbSNP
rs1293993544 2547 dbSNP
rs72661161 2548 dbSNP
rs186967388 2549 dbSNP
rs1481549777 2550 dbSNP
rs1391000160 2552 dbSNP
rs1195836518 2558 dbSNP
rs571423885 2561 dbSNP
rs905513018 2564 dbSNP
rs1034151307 2568 dbSNP
rs959740369 2572 dbSNP
rs886051418 2574 dbSNP
rs1490697405 2575 dbSNP
rs990903901 2577 dbSNP
rs1433462543 2578 dbSNP
rs886051419 2581 dbSNP
rs1342493005 2583 dbSNP
rs1252668167 2589 dbSNP
rs886051420 2597 dbSNP
rs1225005736 2610 dbSNP
rs1022336726 2630 dbSNP
rs1301902781 2641 dbSNP
rs950479899 2645 dbSNP
rs1343556017 2654 dbSNP
rs1004641833 2666 dbSNP
rs1397525007 2672 dbSNP
rs968034930 2685 dbSNP
rs966219771 2689 dbSNP
rs974945344 2691 dbSNP
rs978378935 2696 dbSNP
rs1200016304 2701 dbSNP
rs1420921923 2707 dbSNP
rs924192818 2717 dbSNP
rs191410394 2727 dbSNP
rs976671419 2728 dbSNP
rs1483073333 2729 dbSNP
rs1252250015 2732 dbSNP
rs1193651796 2733 dbSNP
rs1401690442 2738 dbSNP
rs979821128 2744 dbSNP
rs1444940967 2745 dbSNP
rs112868185 2748 dbSNP
rs1282519600 2750 dbSNP
rs1404439168 2750 dbSNP
rs566917040 2751 dbSNP
rs771684858 2753 dbSNP
rs1396020248 2756 dbSNP
rs1177663733 2758 dbSNP
rs1471142700 2761 dbSNP
rs931747660 2763 dbSNP
rs1176273805 2765 dbSNP
rs963948489 2773 dbSNP
rs1472636883 2775 dbSNP
rs1048784762 2777 dbSNP
rs935380489 2778 dbSNP
rs775905689 2787 dbSNP
rs1218120242 2793 dbSNP
rs3743342 2794 dbSNP
rs949888952 2810 dbSNP
rs922424357 2817 dbSNP
rs1468450742 2818 dbSNP
rs552626399 2821 dbSNP
rs1219256387 2846 dbSNP
rs1264696653 2855 dbSNP
rs907134432 2860 dbSNP
rs573415984 2868 dbSNP
rs1488680716 2875 dbSNP
rs1201224974 2880 dbSNP
rs149202238 2891 dbSNP
rs886051421 2892 dbSNP
rs765590258 2895 dbSNP
rs1056059329 2898 dbSNP
rs1477262889 2901 dbSNP
rs1336482850 2902 dbSNP
rs1401855339 2908 dbSNP
rs1193792198 2909 dbSNP
rs894297790 2912 dbSNP
rs1012781168 2915 dbSNP
rs1420987120 2916 dbSNP
rs1156348168 2923 dbSNP
rs1469149789 2929 dbSNP
rs769044614 2945 dbSNP
rs1184993510 2948 dbSNP
rs183703685 2949 dbSNP
rs1242366435 2950 dbSNP
rs1209104257 2951 dbSNP
rs777076242 2953 dbSNP
rs1349982234 2954 dbSNP
rs1316008268 2957 dbSNP
rs143339480 2958 dbSNP
rs151326457 2961 dbSNP
rs188022958 2963 dbSNP
rs886051422 2964 dbSNP
rs1157912881 2966 dbSNP
rs28613415 2969 dbSNP
rs1347499620 2972 dbSNP
rs751685913 2973 dbSNP
rs1358904167 2974 dbSNP
rs1365583982 2980 dbSNP
rs902005297 2987 dbSNP
rs996274017 2988 dbSNP
rs1186928444 2996 dbSNP
rs140694679 2996 dbSNP
rs1476247973 3011 dbSNP
rs1364159452 3019 dbSNP
rs1192307512 3023 dbSNP
rs145645018 3038 dbSNP
rs953564323 3043 dbSNP
rs984542040 3047 dbSNP
rs1031412239 3048 dbSNP
rs956770953 3050 dbSNP
rs908968872 3055 dbSNP
rs111386789 3057 dbSNP
rs1364456886 3059 dbSNP
rs560350281 3059 dbSNP
rs3833027 3060 dbSNP
rs397772980 3060 dbSNP
rs76820462 3063 dbSNP
rs1430724164 3072 dbSNP
rs1346678768 3079 dbSNP
rs940410047 3083 dbSNP
rs1035999019 3090 dbSNP
rs1283567816 3091 dbSNP
rs1487780769 3103 dbSNP
rs979892479 3105 dbSNP
rs928304019 3108 dbSNP
rs1216856487 3111 dbSNP
rs1167095530 3114 dbSNP
rs938627021 3116 dbSNP
rs1201724213 3119 dbSNP
rs886051423 3121 dbSNP
rs62014610 3127 dbSNP
rs138185890 3128 dbSNP
rs886051424 3130 dbSNP
rs1309476243 3134 dbSNP
rs1271394154 3139 dbSNP
rs1214323523 3141 dbSNP
rs1011413992 3143 dbSNP
rs886051425 3148 dbSNP
rs886051426 3149 dbSNP
rs1285702793 3150 dbSNP
rs1413732267 3153 dbSNP
rs1445725999 3157 dbSNP
rs1049008337 3159 dbSNP
rs1444002544 3159 dbSNP
rs747191952 3159 dbSNP
rs878890006 3159 dbSNP
rs1352381954 3160 dbSNP
rs1327981912 3161 dbSNP
rs1042879716 3164 dbSNP
rs940395721 3167 dbSNP
rs1304633375 3169 dbSNP
rs1479501827 3169 dbSNP
rs1165912893 3170 dbSNP
rs551241364 3172 dbSNP
rs1419394289 3173 dbSNP
rs886051427 3173 dbSNP
rs886051428 3173 dbSNP
rs1198443667 3176 dbSNP
rs1462007585 3177 dbSNP
rs571529451 3180 dbSNP
rs1347114356 3184 dbSNP
rs1312117567 3189 dbSNP
rs1307148130 3191 dbSNP
rs1445925481 3196 dbSNP
rs142744440 3204 dbSNP
rs11556089 3205 dbSNP
rs1297199256 3209 dbSNP
rs966056839 3213 dbSNP
rs1453123782 3214 dbSNP
rs1029085746 3225 dbSNP
rs182172002 3226 dbSNP
rs1469277663 3227 dbSNP
rs1001522141 3233 dbSNP
rs1345689050 3235 dbSNP
rs1159971334 3237 dbSNP
rs1420912190 3240 dbSNP
rs751100931 3246 dbSNP
rs1178197701 3249 dbSNP
rs1445622655 3252 dbSNP
rs763223581 3282 dbSNP
rs185512187 3283 dbSNP
rs956908821 3284 dbSNP
rs1483233180 3289 dbSNP
rs1013568622 3297 dbSNP
rs1285931870 3302 dbSNP
rs1440292215 3304 dbSNP
rs1208855954 3305 dbSNP
rs1217342406 3308 dbSNP
rs1314557326 3311 dbSNP
rs1308090601 3313 dbSNP
rs375106285 3319 dbSNP
rs543558759 3319 dbSNP
rs1384530719 3320 dbSNP
rs969427614 3322 dbSNP
rs1451602909 3326 dbSNP
rs1362606156 3328 dbSNP
rs1290505537 3329 dbSNP
rs1455422771 3343 dbSNP
rs1158117448 3344 dbSNP
rs1185952732 3344 dbSNP
rs953717952 3345 dbSNP
rs1387280555 3348 dbSNP
rs531928122 3362 dbSNP
rs909355856 3363 dbSNP
rs77620237 3366 dbSNP
rs566415298 3367 dbSNP
rs1284765433 3371 dbSNP
rs1222552289 3376 dbSNP
rs138798418 3388 dbSNP
rs766453915 3390 dbSNP
rs1289087039 3394 dbSNP
rs1243819764 3403 dbSNP
rs938358883 3405 dbSNP
rs1412939920 3408 dbSNP
rs1297640823 3409 dbSNP
rs1175500358 3410 dbSNP
rs991526014 3421 dbSNP
rs915840831 3426 dbSNP
rs1237424358 3427 dbSNP
rs558843294 3431 dbSNP
rs751835194 3440 dbSNP
rs1297703477 3441 dbSNP
rs985098578 3445 dbSNP
rs1042930125 3448 dbSNP
rs574634185 3456 dbSNP
rs190177128 3458 dbSNP
rs544968102 3460 dbSNP
rs754298690 3465 dbSNP
rs181812913 3466 dbSNP
rs1375986852 3473 dbSNP
rs1427313927 3473 dbSNP
rs1263057130 3484 dbSNP
rs940632540 3491 dbSNP
rs1490682558 3501 dbSNP
rs1442691837 3509 dbSNP
rs11556090 3510 dbSNP
rs886051429 3513 dbSNP
rs922950003 3514 dbSNP
rs1252914379 3516 dbSNP
rs1224937250 3524 dbSNP
rs1342490187 3529 dbSNP
rs1317253786 3533 dbSNP
rs1283794057 3536 dbSNP
rs931725333 3538 dbSNP
rs1347401300 3541 dbSNP
rs185838563 3545 dbSNP
rs1029374202 3546 dbSNP
rs1386483953 3552 dbSNP
rs61740807 3554 dbSNP
rs190155838 3555 dbSNP
rs745696109 3560 dbSNP
rs1236898093 3561 dbSNP
rs1016417054 3569 dbSNP
rs754727381 3569 dbSNP
rs892679239 3570 dbSNP
rs1481133768 3571 dbSNP
rs1426676088 3576 dbSNP
rs546271180 3578 dbSNP
rs1183017830 3592 dbSNP
rs971827185 3593 dbSNP
rs879409176 3594 dbSNP
rs757298218 3595 dbSNP
rs1477190941 3600 dbSNP
rs1035447445 3621 dbSNP
rs373340382 3622 dbSNP
rs1205561102 3630 dbSNP
rs1263686153 3630 dbSNP
rs1430153944 3637 dbSNP
rs991185519 3639 dbSNP
rs915540397 3647 dbSNP
rs530600662 3655 dbSNP
rs1232587453 3656 dbSNP
rs550493563 3658 dbSNP
rs143991135 3659 dbSNP
rs886051430 3662 dbSNP
rs924471952 3663 dbSNP
rs1027098247 3667 dbSNP
rs952918887 3669 dbSNP
rs529661153 3670 dbSNP
rs984618642 3674 dbSNP
rs1400663666 3680 dbSNP
rs1330706207 3688 dbSNP
rs1289637854 3693 dbSNP
rs1171526816 3694 dbSNP
rs1470156249 3697 dbSNP
rs907705911 3702 dbSNP
rs12900401 3717 dbSNP
rs1041235805 3718 dbSNP
rs1243593325 3719 dbSNP
rs886051431 3720 dbSNP
rs901934210 3727 dbSNP
rs933372220 3729 dbSNP
rs886051432 3739 dbSNP
rs1277786052 3742 dbSNP
rs757935047 3744 dbSNP
rs931673111 3746 dbSNP
rs1262715089 3747 dbSNP
rs140620343 3761 dbSNP
rs1006464223 3772 dbSNP
rs1316230137 3789 dbSNP
rs1454887246 3791 dbSNP
rs779537026 3792 dbSNP
rs1334019641 3793 dbSNP
rs1216276818 3796 dbSNP
rs528457487 3797 dbSNP
rs925028877 3797 dbSNP
rs993637234 3800 dbSNP
rs1052581069 3802 dbSNP
rs1036241281 3803 dbSNP
rs746688800 3807 dbSNP
rs747987943 3817 dbSNP
rs959837459 3825 dbSNP
rs1196863453 3829 dbSNP
rs991630343 3833 dbSNP
rs1450230973 3839 dbSNP
rs1022656756 3844 dbSNP
rs1198517744 3847 dbSNP
rs1353311150 3848 dbSNP
rs1269899501 3850 dbSNP
rs538394494 3859 dbSNP
rs1271389530 3862 dbSNP
rs567028715 3863 dbSNP
rs905179239 3868 dbSNP
rs1248642670 3869 dbSNP
rs1002179074 3876 dbSNP
rs968364254 3877 dbSNP
rs1432185393 3885 dbSNP
rs978712317 3887 dbSNP
rs888499921 3896 dbSNP
rs1004714434 3898 dbSNP
rs1365837284 3900 dbSNP
rs1398810575 3900 dbSNP
rs3743343 3902 dbSNP
rs1403393756 3906 dbSNP
rs1412881754 3908 dbSNP
rs1168266977 3928 dbSNP
rs1475736209 3929 dbSNP
rs955908103 3933 dbSNP
rs1388407403 3942 dbSNP
rs142857253 3956 dbSNP
rs1303477189 3958 dbSNP
rs975954141 3962 dbSNP
rs922403222 3965 dbSNP
rs1052488 3974 dbSNP
rs1289679304 3976 dbSNP
rs1277072711 3986 dbSNP
rs563622482 3988 dbSNP
rs1276808827 3990 dbSNP
rs1228874549 3992 dbSNP
rs529386438 3993 dbSNP
rs1272433144 3995 dbSNP
rs1217492445 3996 dbSNP
rs28473647 4001 dbSNP
rs1354804529 4019 dbSNP
rs1050933205 4020 dbSNP
rs1304424375 4025 dbSNP
rs910592766 4028 dbSNP
rs748650960 4039 dbSNP
rs1222258995 4046 dbSNP
rs1433919996 4046 dbSNP
rs1292922361 4050 dbSNP
rs985773635 4051 dbSNP
rs544954467 4053 dbSNP
rs936425659 4053 dbSNP
rs1169790689 4060 dbSNP
rs1480720744 4060 dbSNP
rs1490916426 4060 dbSNP
rs988336120 4068 dbSNP
rs1192971513 4069 dbSNP
rs1037631991 4073 dbSNP
rs1246307505 4074 dbSNP
rs1205692869 4078 dbSNP
rs898098540 4088 dbSNP
rs1046612981 4091 dbSNP
rs905419640 4105 dbSNP
rs1262656799 4107 dbSNP
rs1324871646 4110 dbSNP
rs200460714 4111 dbSNP
rs1216938793 4112 dbSNP
rs994134300 4116 dbSNP
rs1057325655 4120 dbSNP
rs1279720000 4121 dbSNP
rs938266972 4127 dbSNP
rs1397930496 4131 dbSNP
rs1048357982 4134 dbSNP
rs1366664584 4138 dbSNP
rs555324405 4139 dbSNP
rs1164019119 4140 dbSNP
rs1178366002 4150 dbSNP
rs925951237 4151 dbSNP
rs199952886 4165 dbSNP
rs1012700847 4169 dbSNP
rs1177927921 4170 dbSNP
rs1441768769 4176 dbSNP
rs1236790937 4190 dbSNP
rs886051433 4196 dbSNP
rs770243847 4210 dbSNP
rs181158603 4211 dbSNP
rs534195237 4212 dbSNP
rs529870126 4213 dbSNP
rs1383427865 4214 dbSNP
rs955958298 4217 dbSNP
rs763293444 4223 dbSNP
rs1284341232 4229 dbSNP
rs1225175995 4230 dbSNP
rs1374174218 4232 dbSNP
rs1308314908 4238 dbSNP
rs1030140933 4243 dbSNP
rs1339268135 4244 dbSNP
rs577168621 4247 dbSNP
rs922488595 4260 dbSNP
rs986486703 4264 dbSNP
rs1358719568 4275 dbSNP
rs1316243723 4276 dbSNP
rs1421801139 4278 dbSNP
rs1378663292 4281 dbSNP
rs954011804 4282 dbSNP
rs1032003329 4283 dbSNP
rs1445564564 4289 dbSNP
rs1258888846 4292 dbSNP
rs766854989 4301 dbSNP
rs1362038326 4302 dbSNP
rs985272871 4306 dbSNP
rs1242245760 4307 dbSNP
rs1260380733 4309 dbSNP
rs910643643 4327 dbSNP
rs763963889 4328 dbSNP
rs1284809281 4330 dbSNP
rs1486286627 4332 dbSNP
rs75971163 4336 dbSNP
rs934673970 4340 dbSNP
rs1310302156 4342 dbSNP
rs562987448 4347 dbSNP
rs987893015 4352 dbSNP
rs774655154 4356 dbSNP
rs1460851013 4359 dbSNP
rs1037685997 4366 dbSNP
rs919242460 4370 dbSNP
rs929604750 4371 dbSNP
rs1057502329 4378 dbSNP
rs982235376 4383 dbSNP
rs896023271 4388 dbSNP
rs1013502683 4390 dbSNP
rs926786884 4391 dbSNP
rs1370620459 4394 dbSNP
rs72661162 4402 dbSNP
rs185374880 4406 dbSNP
rs543972601 4408 dbSNP
rs1420799281 4409 dbSNP
rs1195237866 4411 dbSNP
rs762874455 4414 dbSNP
rs560849755 4416 dbSNP
rs1454993860 4417 dbSNP
rs1222849527 4428 dbSNP
rs1170350786 4429 dbSNP
rs1400855570 4432 dbSNP
rs1263511940 4435 dbSNP
rs904286627 4438 dbSNP
rs189685754 4443 dbSNP
rs577952011 4444 dbSNP
rs886051434 4446 dbSNP
rs1385546438 4450 dbSNP
rs757151117 4451 dbSNP
rs955884600 4452 dbSNP
rs1292176920 4453 dbSNP
rs546862904 4459 dbSNP
rs559937993 4462 dbSNP
rs749273217 4462 dbSNP
rs1306683332 4478 dbSNP
rs1457675050 4478 dbSNP
rs1317782017 4484 dbSNP
rs998153451 4487 dbSNP
rs1355635051 4491 dbSNP
rs1173367012 4493 dbSNP
rs1029997681 4500 dbSNP
rs1477123533 4503 dbSNP
rs1241423882 4505 dbSNP
rs1199486711 4508 dbSNP
rs183877342 4508 dbSNP
rs1264781998 4510 dbSNP
rs1434589712 4510 dbSNP
rs953954306 4511 dbSNP
rs985273746 4518 dbSNP
rs1480804162 4519 dbSNP
rs548861227 4519 dbSNP
rs1196743643 4530 dbSNP
rs1317201174 4535 dbSNP
rs1016702046 4541 dbSNP
rs1234007270 4549 dbSNP
rs774665276 4554 dbSNP
rs886051435 4557 dbSNP
rs1264943046 4559 dbSNP
rs973447838 4559 dbSNP
rs1378195476 4565 dbSNP
rs1333765830 4567 dbSNP
rs759884384 4573 dbSNP
rs1456347203 4574 dbSNP
rs919295164 4578 dbSNP
rs1464568670 4583 dbSNP
rs929294503 4586 dbSNP
rs1400175383 4600 dbSNP
rs1176567575 4601 dbSNP
rs1467089012 4607 dbSNP
rs1375587469 4608 dbSNP
rs1176447797 4612 dbSNP
rs1419298209 4621 dbSNP
rs1239830309 4624 dbSNP
rs1176511192 4628 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer 0.309 2.8e-3 0.361 5.4e-4 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.575 4.0e-3 -0.669 6.3e-4 20 Click to see details
GSE19536 Breast cancer 0.257 4.9e-3 0.309 8.8e-4 100 Click to see details
GSE14794 Lymphoblastoid cells 0.186 4.0e-2 0.207 2.5e-2 90 Click to see details
GSE32688 Pancreatic cancer 0.308 4.3e-2 0.187 1.5e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.322 5.8e-2 -0.262 1.0e-1 25 Click to see details
GSE21032 Prostate cancer 0.151 8.6e-2 0.145 9.5e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.281 8.7e-2 -0.199 1.7e-1 25 Click to see details
GSE38226 Liver fibrosis -0.278 1.1e-1 -0.253 1.3e-1 21 Click to see details
GSE21849 B cell lymphoma 0.195 1.6e-1 0.521 1.9e-3 29 Click to see details
GSE28260 Renal cortex and medulla -0.187 2.7e-1 -0.038 4.5e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.069 2.9e-1 -0.083 2.6e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.103 3.2e-1 0.087 3.4e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.105 3.2e-1 0.078 3.6e-1 23 Click to see details
GSE27834 Pluripotent stem cells -0.097 3.6e-1 -0.162 2.7e-1 16 Click to see details
GSE17306 Multiple myeloma 0.044 3.8e-1 0.043 3.8e-1 49 Click to see details
GSE28544 Breast cancer 0.055 4.0e-1 0.492 7.3e-3 24 Click to see details
GSE17498 Multiple myeloma -0.041 4.0e-1 0.119 2.3e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.043 4.5e-1 -0.238 2.3e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.02 4.7e-1 0.044 4.3e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.02 4.7e-1 0.044 4.3e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.367 0.02 0.360 0.02 32 Click to see details
KIRP -0.333 0.03 -0.190 0.15 32 Click to see details
PRAD -0.218 0.06 -0.153 0.14 50 Click to see details
BLCA 0.335 0.09 0.309 0.11 18 Click to see details
ESCA -0.384 0.12 -0.573 0.03 11 Click to see details
HNSC 0.173 0.14 0.172 0.14 42 Click to see details
PCPG -0.875 0.16 -1.000 0.5 3 Click to see details
THCA -0.13 0.16 -0.174 0.09 59 Click to see details
CHOL 0.368 0.16 0.483 0.09 9 Click to see details
LUAD 0.308 0.17 0.224 0.24 12 Click to see details
KIRC 0.106 0.19 0.121 0.16 68 Click to see details
LIHC 0.108 0.23 0.081 0.29 49 Click to see details
BRCA 0.078 0.24 0.025 0.41 84 Click to see details
UCEC 0.165 0.25 0.228 0.17 19 Click to see details
PAAD 0.495 0.25 0.400 0.3 4 Click to see details
CESC -0.567 0.31 -0.500 0.33 3 Click to see details
KICH 0.069 0.37 0.058 0.39 25 Click to see details
LUSC -0.028 0.43 -0.070 0.34 38 Click to see details
LUSC -0.028 0.43 -0.070 0.34 38 Click to see details
COAD 0 0.5 -0.167 0.35 8 Click to see details
COAD 0 0.5 -0.167 0.35 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1