miRTarBase - #MIRT109240 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF275   
Synonyms -
Description zinc finger protein 275
Transcript NM_001080485   
Expression
Putative miRNA Targets on ZNF275
3'UTR of ZNF275
(miRNA target sites are highlighted)
>ZNF275|NM_001080485|3'UTR
   1 CCTCATCAAGCACCGGCGCATCCACAGCGGACTGAAACCCTATGAGTGCGACAAATGCGGCAAGGCCTTCCGCCGGAGCT
  81 CCGGCCTCAGTCGCCACCGGCGGATCCACAGTGGGGCGCGGCGCTGCGAATGCAGCCAGTGTGGCCGCGTGTTCAAGAGG
 161 CGCTCGGCACTGCAGAAGCATCAGCCAACCCACCACGAGTAGAAACGCCCTGTGGTCCCGCGGGACAGGGACGGAGTCCC
 241 CAGAGGGGATGGCAGAGTCAAAGGAGATGAACAGTTTTGTAGCGCTTATATATTTTGTCTTCCAAAAGGTTGAGACCGAT
 321 TTATACTGCCACCAGCAATTTATAAGTGTTACGTTATGCCCATCAAGAGTAGCTTGTACCATTTAACTTAGTTTGGCTAG
 401 TTTAACTGGTAGGAAGTACCATCAAGGTATTTCAGTCCACATGCCTTGAATCCAAGAATGAGAGAGGACAAATCTGGATG
 481 TGGGGTAGGGAGGGGCTTAGAGGTCATCAACTCCAAGCTCCCCCCGCCCCAGAGAAACACACAGAGCTGTTCCACGATGG
 561 CGTCCTCATAATGTGATCCCAGCTTTCCTGAAGAGAACGTTGCCCTCATGATTTTTGGCCTACTTGAATTTATAAATTTT
 641 TAGGGATGTAAATAGAACACTCAAATGTCTTAAAATATTTAATTTATTAATTTAGTTATACATACATACTGTAAATCACA
 721 TATTATATAAAATAATATATTAATTTAGAAAATACCCCATTTTTGCCACCCTCCCTTTCACGAAATCATTTTACTCTGAC
 801 TCCTCACCGTCTTCACCAACATGGGAACCCTGTTTGAGTCATCAGACAGTTTCAAGACACACCCAGTCACTTCCATCCGA
 881 GCTCTGCACGGTCGCTCAGTGACGATCCCTTCATGAGGCTCTCATTAGAAATTTTCTCCCAAGCCATAAGACCATATTTG
 961 CAGAACATTAGGACGATTTCTCTTGTCGTTTTTTAATCTGTCCTGTGACTGTACAATATAACCACTTAAGGTCATACTTT
1041 TTCAAACAACCTTTAAACGTCTTTTCTTTTAAAGCACCCAAAATGTCATTGTGAGGCCAAACGCCTAGTAACAGTTACTG
1121 AATCTGGGTTAAATGTCGGTATCTTTTTTTCTTAAACCATTTCAATTTGGTGTCCCCTATACATATCCAAAACTAGCATC
1201 GATTGGGGTTGTTTTGAACTAATGGGTCTTGTCCTCAAGCAGCACTATTTTGTTCAAAATAAAATAGTTGAGAGCATGCC
1281 CCTAAGAAGAGATACATCTCAAGGACTCAAGTGCAGGGTGACGCCTCCTTTTGGAAATGAGCCTCTCCTGGTATCAGGCC
1361 TAGATGGTACTTCTCCAGCCTTCCGTTTCTTGTTCTATAAAACAGGGGTGATCACAGCACCTACCTCCGAAGGTTATCAC
1441 GAGGACTGCCATCGTGGCTGCAGAGTGCCAGGACCACCGGCCTGGTATGGAGGTACACACTCAGTGAAGGCCATCTGCTG
1521 TCATTGTCATTGTCATAGTTATTGCCGTCATTCTGTGGCTTGTCAATTCCAGAACTGGGGATAGACCCCAGGCCTCCTGA
1601 CCACCAGTCTCATCTTTCTCTTATGCGATGACTTAAATGGTGTTTCTGTTTTTTGCATGCAAATGGTCCGTTCATCTCCT
1681 TTGACTAGTTATCAACTTACCTTCGGATATATTAACTTTATGTAGCAGTTCTTTCTATATTGATGGTGATGTTCTCTTTT
1761 CCAATTTTATTGCTTTGCTTTTTGTAGCAGTTTTATTACGTTTTTGTTGTGAAAGCTTTTAATTTTTACATATCCAAGCA
1841 TTCATTTTTTGTCCACTCAGTCATAACTTTCATTGCTTCTGTAGCTAGATATGATGACATTTTCTCTAGAATTTTAATTA
1921 CAAACAAAAAGCTGCAACCCCAGCCCATCAGAAGGTGAGTACACCAGGTGGGCAGGCTGGATGGAAATGGGCCAGAGAAG
2001 CAGGCTCTTTCCTCATCCGAGATGCGGACTCCCTGTCTATCTGTGGGCACCACTTGACTATCCAACCTGACCACTGCGGC
2081 ACACTGGAGATGCTCCCATCATAGATTAGCCAGAACTCTGTGACTGCTCATCATTATAGACCCCGCCAGCAGCAGTGGGG
2161 CTTGGCCTCACCTAGATCAATGGAGTGGTCCAAACTTGGTCTGGGAGCAAGCAGCCCAGCCATCCTTTGAGCTCCTGGGA
2241 GCCTTGGCAATGCTCCGAGTGGATTCAGTGACTGAGCAGCAGATTCACCCAAGAAACATCTCCTTGGACACAAGAAGACT
2321 TGCCTAGACCACATCCTCCTTTCAGCCGGTGACTCTAGAACTAGAAAGAGATTGGTTCATAGGCTTCTGCTGTGGGCAGC
2401 TAGGGGAAAATTCACCCATGTGTTCTGGCATCACTTCCTATAGCCACACCTAAGTGAGGGCAACAGAGCAGAGGCTCGGA
2481 GAGGAACCCTGCCCCTCCGATGGCTTGTGCGTTATGCTGATAGAAGCTGGCAGCACTGCCCTGGGCTATGATTTGCAACA
2561 GCCATGCCCAGGAGGAGCACTAAAGCAAAGGTTTGGAGGGCAGTGGAACCCTTCTGAAAGCCTGTGTGGCATAGAAGTAG
2641 AAGCTGGTCCTCCTGGGTCTGAGCTACCATTTCCAGTGGGCTCCCCCAAGAGGAACAGCAGCAAGGGCTAGCGAGGAACC
2721 TGCCCCTCCAGTGGCCCACAGAAGCCACAGATAGAAGCCAGCCCCACCAGGGCTGTGCTGTGACTTCCCAGCAGCTGTGG
2801 CTGGGGACAGGGACACTAGGAGGGCCTGGCAAGGAAGTGTGCCCTTCTCGTGGGCCCACCAAGGCTGAGGCAGAGCTTCC
2881 TAGCAGACACAACTTGGAAGGGCTTCTCAGGCACCCATCCTGACCCCCAGGCTGGAGAGGAGCCAAAAGCACTTGTTACA
2961 TAGTGATTCCTTTTGCCCTGTGGGCCTCAGTTCTTGCAGTAGTTGTGAATCTGTGTCTGAAATCACTACTTTCTTCTCGG
3041 ATCCTTTTTCTCTTTTCGAGTTGTTAGGATGTGTTTTGTACAGCTGTCATTTGATAAAGAAGGTTGACCTCTACCAGGGG
3121 CAAGTCTGGCACCTTTACCTAGAAGTACTCTGCCATGTCTTGCCCGTTCATTTATCGTTTGTTGGGTTTCATGAGGGATC
3201 CCATTGAAGTAGATCCCTTTTATGAAGGGATCCCATTGAATGCAGCATTAACTCAGAACGTAGCATAAAGTCGTCACTGC
3281 TCCCAGCTGGGACGTGGTGTCTTGGCATCCCTTCCTGCCGTCCTTGACTCTTTCCCATCTTCAGTTCTATAATTTTCTCC
3361 CAAACAAATGCTCTTTTAGAGTTAACACTAAAGATCTGGTCTTTGCCGTCAAGGTTGACAGAACAGCTGTTCATGGTGTT
3441 TGCGGTGAAACCCGTGTTCTCTTTCAATGCAGTCTGTGGCTTTAACGTGTGTCCTGTAATTTCGCCAAGATCATTTCTTG
3521 CCTCTGGTAACTTGGGGGTGGATTTCCTTGGGCTCTCTAGGTGTACTGCTATGTCAGATGCAAAATGTCACCCAGCTTCC
3601 TGTCACATATCCTTGTCTGTGCATTCATGCATCTACCTCATTCCGGTTTTCTTTCTAATCTCATGTATTCCTGTTGTGAG
3681 GAAATGTGTTCTTTTCCCGATCCTTTTGTAGTTCATACACATGACAATTGGGTTTCCACGCACGTGCATGAGATGTTCCT
3761 CCTTCAAACCTTGTTACTATGTCAGCACATTAACTGCCTGGCATGGAAAAAGAAAAAAAAAAAAGAAATATGTTCTTTTC
3841 CTACCATTTGAAAAAAATCCTCCATTGCTTTTATTAGAGTTTTGAATACTTGTGAAAATTTTCAAAAGAAAGTAATTGAT
3921 TACCATTTTTGCTGCTTATTACGATGAGCTGTGTCCATTAGCTGTGTCACCCCACTCTTGCATTTCCAGAATAGTCCCTA
4001 CCCAATTGCAGCGGGCATGTTTTTGAGTGGTGTTGCATTCCATGTGCTTGATTTTGTCCTAGAACTGGCACAGCGCCTGC
4081 CCTACCTGCAGCCCTGGGTTGTGGCCCTGTTGCGTACCATGTGATTTGCCACCCCGCTTCTAGGCCATATTAATTCAGCC
4161 AGAACTGAACACCTGACCCAAGGGCAGCAAGCAATCATCAGAGCATAGAGCTGACAGAACATGATGGACCACGGACACCA
4241 CCAGGCCTTCCAGATCTGAAATGCAAACAAGGAAACAGAAGCTTCTAGGCATCAGAAGGTGTGGGGAGCAGCACAGTACT
4321 CAGAGGAGTGAGGAGCGTGGCGCCTGCTGGGAGGAAGGCCTGGCCATGGTATGTTCTTGGATTTCTGGCAGCAGCCCTCA
4401 TTGGTCCACGTGCGTCCCCACTACAGACTCCTTGACTTGAGCCAGCTTGAGTGGGTCTCTACTCTTTTCTATTGTGTTTT
4481 GCCACTTGGCTGCTTCCTGGCCAAGTCGCACCTGACTGCATGAACACCTGTTCAAACGTGTGTTCTCTGTTCTCTAAGAT
4561 GGGTGAAAGTCGATGCCTTCTAGTCTCAGTGAATTTAACCTGTGATTTTATGTCTACGTATATTGTTCCTTTACTGAACC
4641 CACCACATGCGGGCCATAAAATGAGTGAAATCACAGTGCACCCTGTTCTCTTATTTTTGAAGTGTTTCACGATTTCCAGC
4721 ATGTCCATCAGATGGGGGGATTGCTAACTTCTCTCTTACTCATGTACTTACATTCTGTAGTTCTCATTGCATCACTTTGG
4801 ATGTTTACTTTGAAAAGCAGAAACTGTCTCTTTAAACTTGGCCCTCAATGTCATTTGCGTATCTCTGAGAACAATAGCTA
4881 TGTCCCACCCCAGTTTGTATTTCCGTTGGTTGTTGGCACTTTTTTCTCATTCCCCCATCTCATTACCTTGTCTGTTTTCT
4961 GGCACTCACTATAATCAGCCTTGCACTAGAGCTGTTTGTGGACTTGGCTTCACCCCCTCCTCCTCAGCCCTCCCCCACCC
5041 ATTAAATTGTGAGCTCTTAGAAGACAGGGGTGGCCTTTCATGTCTGATCCCCTACCAAATCTAGCACAGTGCCTTGCATC
5121 AAGTAGATTTCAATAAATATATGTTAAATGGCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |||||| | ||||||| 
Target 5' tgattACCATT-TTTGCTGCTt 3'
3917 - 3937 164.00 -15.80
2
miRNA  3' guGUUUGGUAAUACAC-GACGAu 5'
            ||:|  | | |||| ||||| 
Target 5' gcCAGA--ACTCTGTGACTGCTc 3'
2109 - 2129 128.00 -11.40
3
miRNA  3' guGU-UUGGUAAUACACGACGAu 5'
            || |||: | || |||| || 
Target 5' gtCATAACTTTCAT-TGCTTCTg 3'
1860 - 1881 127.00 -8.40
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781891177 15 dbSNP
rs782050572 19 dbSNP
rs1289971580 23 dbSNP
rs1453598265 24 dbSNP
rs376449618 29 dbSNP
rs781825600 30 dbSNP
rs782518422 39 dbSNP
rs1425341266 41 dbSNP
rs782635429 42 dbSNP
rs1181968774 44 dbSNP
rs1421909585 51 dbSNP
rs781894039 59 dbSNP
rs1039372982 60 dbSNP
rs782542192 63 dbSNP
rs782570695 72 dbSNP
rs782189447 73 dbSNP
rs1224134100 74 dbSNP
rs782365607 82 dbSNP
rs368558325 83 dbSNP
rs782626018 84 dbSNP
rs1309643418 89 dbSNP
rs372578911 90 dbSNP
rs782034883 91 dbSNP
rs782148285 93 dbSNP
rs782328688 94 dbSNP
rs781963435 96 dbSNP
rs782081441 99 dbSNP
rs782250806 100 dbSNP
rs781858126 102 dbSNP
rs782155372 103 dbSNP
rs782778619 118 dbSNP
rs376640954 119 dbSNP
rs781967936 121 dbSNP
rs1374607341 123 dbSNP
rs782631228 124 dbSNP
rs781827128 127 dbSNP
rs1427671314 128 dbSNP
rs782529078 129 dbSNP
rs782640712 136 dbSNP
rs782047830 137 dbSNP
rs1490371641 146 dbSNP
rs368716521 147 dbSNP
rs868943077 148 dbSNP
rs1207719754 150 dbSNP
rs1035104227 160 dbSNP
rs782334444 162 dbSNP
rs782000537 167 dbSNP
rs1316436325 172 dbSNP
rs782116543 175 dbSNP
rs782413122 178 dbSNP
rs1224593688 187 dbSNP
rs1321617710 196 dbSNP
rs782010019 207 dbSNP
rs3788754 208 dbSNP
rs782058402 213 dbSNP
rs918460761 217 dbSNP
rs782332156 221 dbSNP
rs1421119562 222 dbSNP
rs781973123 223 dbSNP
rs782085263 229 dbSNP
rs1178515615 233 dbSNP
rs782333939 234 dbSNP
rs781861700 237 dbSNP
rs782555517 240 dbSNP
rs1376601550 244 dbSNP
rs912342840 266 dbSNP
rs1439018386 270 dbSNP
rs1250871635 284 dbSNP
rs942407602 285 dbSNP
rs1456724030 304 dbSNP
rs1039448401 309 dbSNP
rs1204888482 318 dbSNP
rs1323402101 319 dbSNP
rs1273553831 334 dbSNP
rs1241337074 336 dbSNP
rs1336420980 337 dbSNP
rs782025912 343 dbSNP
rs1444762851 354 dbSNP
rs1338405723 362 dbSNP
rs371557125 365 dbSNP
rs1401464721 373 dbSNP
rs947006430 377 dbSNP
rs781926725 381 dbSNP
rs1470917832 393 dbSNP
rs782785370 419 dbSNP
rs1363805251 427 dbSNP
rs1177644761 430 dbSNP
rs1437385324 434 dbSNP
rs782047779 441 dbSNP
rs1204759269 454 dbSNP
rs1442186879 460 dbSNP
rs1277199899 470 dbSNP
rs1207340516 471 dbSNP
rs1557508 472 dbSNP
rs782083032 489 dbSNP
rs1260168048 490 dbSNP
rs1238282056 504 dbSNP
rs999680257 509 dbSNP
rs1315965441 510 dbSNP
rs1453173679 516 dbSNP
rs1339652441 520 dbSNP
rs782739837 520 dbSNP
rs370007881 524 dbSNP
rs1402319422 525 dbSNP
rs1035134871 526 dbSNP
rs1417287065 538 dbSNP
rs781847437 541 dbSNP
rs1183809800 543 dbSNP
rs1472675894 544 dbSNP
rs1236028492 554 dbSNP
rs1195980631 555 dbSNP
rs1448041830 558 dbSNP
rs896637869 563 dbSNP
rs1214601857 564 dbSNP
rs1012300150 565 dbSNP
rs1292860521 568 dbSNP
rs1024107063 569 dbSNP
rs1355398264 590 dbSNP
rs962745851 591 dbSNP
rs4828611 596 dbSNP
rs1432845075 600 dbSNP
rs1326996932 605 dbSNP
rs1297482215 606 dbSNP
rs1397661646 629 dbSNP
rs1025594615 634 dbSNP
rs1366818980 646 dbSNP
rs1163843293 657 dbSNP
rs1404341931 659 dbSNP
rs782532679 677 dbSNP
rs1412118188 680 dbSNP
rs1475931330 686 dbSNP
rs1263169308 687 dbSNP
rs1192118515 690 dbSNP
rs951361149 691 dbSNP
rs1269628447 698 dbSNP
rs986654988 706 dbSNP
rs912417693 707 dbSNP
rs1275342837 720 dbSNP
rs782681400 720 dbSNP
rs1318322149 721 dbSNP
rs1277566187 733 dbSNP
rs1216659407 738 dbSNP
rs1346871797 741 dbSNP
rs1303189114 767 dbSNP
rs1435088411 772 dbSNP
rs1347804023 776 dbSNP
rs1330455613 783 dbSNP
rs375208073 790 dbSNP
rs781858030 810 dbSNP
rs1169183664 825 dbSNP
rs963841941 834 dbSNP
rs1430115018 842 dbSNP
rs782603405 843 dbSNP
rs1477069316 846 dbSNP
rs1234874013 864 dbSNP
rs975166102 879 dbSNP
rs1205483680 880 dbSNP
rs1458055283 883 dbSNP
rs1257136130 886 dbSNP
rs1196705213 890 dbSNP
rs369418308 891 dbSNP
rs1218187594 896 dbSNP
rs1364866540 928 dbSNP
rs1280928934 940 dbSNP
rs868993873 945 dbSNP
rs782130491 947 dbSNP
rs1400059428 962 dbSNP
rs1329684493 964 dbSNP
rs1471145354 981 dbSNP
rs947110557 984 dbSNP
rs1175961571 988 dbSNP
rs1412907068 989 dbSNP
rs782775625 996 dbSNP
rs1410171315 1011 dbSNP
rs1178018251 1018 dbSNP
rs1041765925 1026 dbSNP
rs183833511 1033 dbSNP
rs1462476796 1035 dbSNP
rs1209253283 1036 dbSNP
rs782220333 1036 dbSNP
rs1285691195 1055 dbSNP
rs1240464605 1065 dbSNP
rs935605249 1067 dbSNP
rs1375746479 1079 dbSNP
rs1306601595 1082 dbSNP
rs1454973583 1090 dbSNP
rs1380349011 1091 dbSNP
rs1056614585 1099 dbSNP
rs896667632 1104 dbSNP
rs1012331106 1108 dbSNP
rs1045191839 1138 dbSNP
rs548598746 1139 dbSNP
rs995549735 1159 dbSNP
rs1026046573 1160 dbSNP
rs1419142919 1168 dbSNP
rs1378762843 1173 dbSNP
rs1165697894 1177 dbSNP
rs201800463 1178 dbSNP
rs951336775 1185 dbSNP
rs1256521128 1189 dbSNP
rs1181234847 1201 dbSNP
rs1482213290 1202 dbSNP
rs1008159855 1203 dbSNP
rs1216765819 1211 dbSNP
rs1352319557 1220 dbSNP
rs782301163 1227 dbSNP
rs1247636110 1231 dbSNP
rs1322713780 1236 dbSNP
rs1312402668 1242 dbSNP
rs1394617368 1260 dbSNP
rs1364755405 1261 dbSNP
rs963873889 1268 dbSNP
rs975239601 1270 dbSNP
rs1358629919 1274 dbSNP
rs1305201398 1279 dbSNP
rs914359234 1294 dbSNP
rs1163861722 1299 dbSNP
rs782707785 1310 dbSNP
rs1421811788 1317 dbSNP
rs782581625 1323 dbSNP
rs977176815 1336 dbSNP
rs1487680459 1340 dbSNP
rs1260336619 1349 dbSNP
rs781794857 1361 dbSNP
rs938317302 1366 dbSNP
rs1264468330 1385 dbSNP
rs1243139181 1386 dbSNP
rs1309627709 1399 dbSNP
rs1218499901 1404 dbSNP
rs1279390797 1404 dbSNP
rs1338546134 1405 dbSNP
rs189667426 1407 dbSNP
rs918167086 1408 dbSNP
rs948257334 1411 dbSNP
rs1291988257 1416 dbSNP
rs1045628852 1430 dbSNP
rs1477428145 1441 dbSNP
rs782428495 1455 dbSNP
rs1201015265 1456 dbSNP
rs1433246794 1468 dbSNP
rs1266310984 1472 dbSNP
rs1207631563 1473 dbSNP
rs996014486 1479 dbSNP
rs781995459 1480 dbSNP
rs1047111397 1482 dbSNP
rs1316641553 1503 dbSNP
rs1285727923 1511 dbSNP
rs782422942 1519 dbSNP
rs1330594116 1523 dbSNP
rs1299476723 1525 dbSNP
rs1393306557 1530 dbSNP
rs144180418 1543 dbSNP
rs1331833635 1546 dbSNP
rs1008192204 1547 dbSNP
rs1398093644 1553 dbSNP
rs782673263 1554 dbSNP
rs899740843 1582 dbSNP
rs1466107747 1589 dbSNP
rs1376516538 1621 dbSNP
rs996717942 1627 dbSNP
rs1021898396 1628 dbSNP
rs181353320 1630 dbSNP
rs1178466307 1633 dbSNP
rs781972683 1640 dbSNP
rs186844271 1664 dbSNP
rs1031344675 1669 dbSNP
rs1344421368 1670 dbSNP
rs959739011 1671 dbSNP
rs782455150 1696 dbSNP
rs1241489015 1700 dbSNP
rs1377985913 1703 dbSNP
rs992445977 1706 dbSNP
rs1445853643 1710 dbSNP
rs918198152 1719 dbSNP
rs1374292866 1721 dbSNP
rs948287964 1723 dbSNP
rs375769875 1740 dbSNP
rs981022698 1743 dbSNP
rs1170338264 1761 dbSNP
rs782792499 1770 dbSNP
rs931464232 1776 dbSNP
rs1380593096 1784 dbSNP
rs1157670456 1785 dbSNP
rs782033249 1794 dbSNP
rs191734703 1800 dbSNP
rs782780005 1801 dbSNP
rs181816143 1817 dbSNP
rs1254654047 1818 dbSNP
rs899812729 1857 dbSNP
rs1354493381 1859 dbSNP
rs1285580710 1889 dbSNP
rs1238171201 1897 dbSNP
rs782491703 1898 dbSNP
rs144519696 1913 dbSNP
rs1285691172 1914 dbSNP
rs1245206004 1941 dbSNP
rs1339856448 1949 dbSNP
rs1332102533 1955 dbSNP
rs1401380882 1964 dbSNP
rs717303 1970 dbSNP
rs1360533384 1975 dbSNP
rs1021509868 1992 dbSNP
rs1417433350 1993 dbSNP
rs904359189 2001 dbSNP
rs1164243329 2008 dbSNP
rs781799037 2015 dbSNP
rs148426956 2019 dbSNP
rs782688521 2020 dbSNP
rs992477119 2024 dbSNP
rs1022604605 2026 dbSNP
rs572620335 2027 dbSNP
rs782256066 2029 dbSNP
rs1214761221 2033 dbSNP
rs1453578152 2033 dbSNP
rs1290829722 2036 dbSNP
rs1228732115 2040 dbSNP
rs531587901 2047 dbSNP
rs1282360794 2058 dbSNP
rs782184576 2061 dbSNP
rs1340624631 2066 dbSNP
rs1276978210 2076 dbSNP
rs782299349 2078 dbSNP
rs569929141 2079 dbSNP
rs1323800841 2099 dbSNP
rs1405141081 2120 dbSNP
rs1388948492 2121 dbSNP
rs931510730 2139 dbSNP
rs1478411940 2143 dbSNP
rs782602541 2145 dbSNP
rs1191656618 2146 dbSNP
rs1247580465 2150 dbSNP
rs1221022851 2151 dbSNP
rs782031644 2161 dbSNP
rs1270989811 2162 dbSNP
rs782276997 2175 dbSNP
rs1318573411 2217 dbSNP
rs908653784 2225 dbSNP
rs944124605 2242 dbSNP
rs1369010264 2249 dbSNP
rs1275083014 2253 dbSNP
rs375822855 2257 dbSNP
rs782313012 2258 dbSNP
rs899843622 2265 dbSNP
rs781937562 2272 dbSNP
rs1400284745 2281 dbSNP
rs1169162210 2322 dbSNP
rs782286535 2348 dbSNP
rs1425890981 2349 dbSNP
rs1043406830 2368 dbSNP
rs1477142185 2393 dbSNP
rs904432551 2407 dbSNP
rs1180331937 2424 dbSNP
rs1458038932 2427 dbSNP
rs1237495373 2441 dbSNP
rs1202282862 2455 dbSNP
rs781985486 2459 dbSNP
rs1278663999 2464 dbSNP
rs1218097616 2478 dbSNP
rs1345355492 2479 dbSNP
rs782371912 2494 dbSNP
rs895628723 2499 dbSNP
rs1013971691 2500 dbSNP
rs1329926997 2507 dbSNP
rs781997811 2510 dbSNP
rs1359851420 2511 dbSNP
rs1022634203 2512 dbSNP
rs1412814760 2515 dbSNP
rs970129757 2523 dbSNP
rs782098830 2537 dbSNP
rs1159403963 2540 dbSNP
rs1440088067 2559 dbSNP
rs994508845 2565 dbSNP
rs1237286996 2569 dbSNP
rs1175441153 2590 dbSNP
rs782723162 2603 dbSNP
rs1237960707 2606 dbSNP
rs142622936 2630 dbSNP
rs1484401622 2649 dbSNP
rs36021644 2655 dbSNP
rs782739356 2664 dbSNP
rs908726711 2670 dbSNP
rs1353469505 2677 dbSNP
rs1230359639 2696 dbSNP
rs1380593966 2711 dbSNP
rs537425851 2713 dbSNP
rs781941918 2714 dbSNP
rs1362471197 2716 dbSNP
rs1299051232 2724 dbSNP
rs1419283592 2737 dbSNP
rs1378664380 2755 dbSNP
rs1156726724 2764 dbSNP
rs782058221 2767 dbSNP
rs1414530014 2770 dbSNP
rs1181145192 2773 dbSNP
rs782803692 2781 dbSNP
rs1216928628 2793 dbSNP
rs1487782690 2798 dbSNP
rs932679115 2807 dbSNP
rs370733795 2810 dbSNP
rs782050140 2813 dbSNP
rs1224320852 2816 dbSNP
rs1322697643 2817 dbSNP
rs1231940297 2831 dbSNP
rs1342483597 2835 dbSNP
rs1278959515 2841 dbSNP
rs782510786 2850 dbSNP
rs56076412 2851 dbSNP
rs782027998 2859 dbSNP
rs1350193672 2862 dbSNP
rs1164023610 2866 dbSNP
rs1474163047 2868 dbSNP
rs781830920 2881 dbSNP
rs925886367 2889 dbSNP
rs1477203769 2890 dbSNP
rs1259316227 2896 dbSNP
rs1192505598 2932 dbSNP
rs782490154 2933 dbSNP
rs1265182944 2961 dbSNP
rs1212174492 2962 dbSNP
rs1052938200 2967 dbSNP
rs895661286 2971 dbSNP
rs1259248439 2976 dbSNP
rs1218165603 3012 dbSNP
rs1324692435 3029 dbSNP
rs1303696819 3030 dbSNP
rs7050212 3031 dbSNP
rs1044162831 3032 dbSNP
rs782196668 3039 dbSNP
rs782526453 3059 dbSNP
rs1402449413 3068 dbSNP
rs1171298940 3070 dbSNP
rs1461051572 3072 dbSNP
rs1370789331 3082 dbSNP
rs1177825989 3087 dbSNP
rs1433448689 3104 dbSNP
rs1266200286 3111 dbSNP
rs1192214699 3119 dbSNP
rs55805469 3148 dbSNP
rs1459364589 3151 dbSNP
rs782639363 3156 dbSNP
rs1027301371 3166 dbSNP
rs782255418 3167 dbSNP
rs1257794333 3175 dbSNP
rs1004479348 3177 dbSNP
rs1234021953 3178 dbSNP
rs782771697 3189 dbSNP
rs72616429 3200 dbSNP
rs782611792 3203 dbSNP
rs1301513172 3206 dbSNP
rs561798605 3223 dbSNP
rs1438531768 3230 dbSNP
rs114305195 3260 dbSNP
rs1390706700 3261 dbSNP
rs921378875 3274 dbSNP
rs1173868297 3276 dbSNP
rs954137229 3293 dbSNP
rs782321079 3295 dbSNP
rs1394169767 3296 dbSNP
rs1171286039 3313 dbSNP
rs782554222 3320 dbSNP
rs1381255984 3321 dbSNP
rs1181757592 3325 dbSNP
rs1436621192 3348 dbSNP
rs925988746 3356 dbSNP
rs1201168245 3393 dbSNP
rs1482965858 3396 dbSNP
rs1278466582 3406 dbSNP
rs782010456 3408 dbSNP
rs934628442 3409 dbSNP
rs1309759795 3410 dbSNP
rs1238031024 3428 dbSNP
rs1052968333 3433 dbSNP
rs1333964562 3435 dbSNP
rs1336084451 3438 dbSNP
rs1396110089 3444 dbSNP
rs782165259 3445 dbSNP
rs949919294 3452 dbSNP
rs1421098729 3454 dbSNP
rs1360732768 3455 dbSNP
rs1044222778 3466 dbSNP
rs1468912730 3468 dbSNP
rs6627785 3471 dbSNP
rs1188776921 3472 dbSNP
rs782008676 3473 dbSNP
rs1474931019 3476 dbSNP
rs1255434434 3481 dbSNP
rs375979473 3487 dbSNP
rs782746219 3488 dbSNP
rs1204400657 3490 dbSNP
rs186450847 3492 dbSNP
rs886111884 3504 dbSNP
rs189670385 3505 dbSNP
rs8781 3511 dbSNP
rs1290947904 3514 dbSNP
rs781849170 3521 dbSNP
rs1401285724 3528 dbSNP
rs901413409 3532 dbSNP
rs35548981 3534 dbSNP
rs1360837138 3561 dbSNP
rs1317193439 3600 dbSNP
rs1399329855 3601 dbSNP
rs1393258522 3623 dbSNP
rs1164370423 3629 dbSNP
rs1461411953 3632 dbSNP
rs1416295398 3645 dbSNP
rs998379710 3646 dbSNP
rs1028510124 3664 dbSNP
rs782527302 3665 dbSNP
rs782592071 3666 dbSNP
rs782359440 3681 dbSNP
rs1191229025 3692 dbSNP
rs978875772 3697 dbSNP
rs1445088286 3699 dbSNP
rs781838371 3719 dbSNP
rs1214057623 3721 dbSNP
rs182066732 3721 dbSNP
rs3256 3722 dbSNP
rs1220012453 3725 dbSNP
rs782274656 3728 dbSNP
rs375648745 3737 dbSNP
rs782648976 3740 dbSNP
rs1428161265 3741 dbSNP
rs1324672559 3742 dbSNP
rs186650584 3744 dbSNP
rs1392997536 3745 dbSNP
rs782307480 3751 dbSNP
rs3257 3753 dbSNP
rs1418831177 3798 dbSNP
rs1166403228 3807 dbSNP
rs1479152139 3807 dbSNP
rs1194092751 3813 dbSNP
rs1247488661 3813 dbSNP
rs1251071096 3813 dbSNP
rs1467866016 3813 dbSNP
rs1200399120 3814 dbSNP
rs554575135 3815 dbSNP
rs886184347 3820 dbSNP
rs1212269953 3822 dbSNP
rs1346750658 3832 dbSNP
rs940367276 3836 dbSNP
rs1440632386 3847 dbSNP
rs1369159396 3851 dbSNP
rs1333976385 3911 dbSNP
rs1448115561 3919 dbSNP
rs782059830 3926 dbSNP
rs1326988232 3943 dbSNP
rs1040044225 3947 dbSNP
rs1426222723 3949 dbSNP
rs1173178776 3973 dbSNP
rs1453593007 3978 dbSNP
rs1392988436 3995 dbSNP
rs1180469774 3997 dbSNP
rs1480944306 4002 dbSNP
rs901487023 4006 dbSNP
rs998453171 4013 dbSNP
rs1443573058 4014 dbSNP
rs1280613379 4032 dbSNP
rs1233045455 4043 dbSNP
rs191310393 4064 dbSNP
rs1311969414 4066 dbSNP
rs1224663008 4068 dbSNP
rs782025723 4075 dbSNP
rs1000769373 4076 dbSNP
rs782393388 4082 dbSNP
rs1359757998 4087 dbSNP
rs1033131903 4094 dbSNP
rs1433054961 4106 dbSNP
rs1362645418 4114 dbSNP
rs782114081 4115 dbSNP
rs781989737 4136 dbSNP
rs1175402692 4137 dbSNP
rs1473522879 4150 dbSNP
rs988794151 4165 dbSNP
rs1257567862 4167 dbSNP
rs782108318 4170 dbSNP
rs971341076 4183 dbSNP
rs782738916 4191 dbSNP
rs1316691512 4194 dbSNP
rs927201748 4195 dbSNP
rs930529589 4225 dbSNP
rs782765971 4233 dbSNP
rs1292777099 4235 dbSNP
rs781813365 4236 dbSNP
rs1342620285 4237 dbSNP
rs143775675 4246 dbSNP
rs370255116 4251 dbSNP
rs1454175160 4268 dbSNP
rs1344365187 4274 dbSNP
rs1040119095 4278 dbSNP
rs1407045871 4286 dbSNP
rs1418425455 4295 dbSNP
rs1186621088 4303 dbSNP
rs1473901172 4310 dbSNP
rs1264965074 4317 dbSNP
rs1186728348 4318 dbSNP
rs922941123 4331 dbSNP
rs1224182223 4337 dbSNP
rs1336133788 4338 dbSNP
rs931600615 4339 dbSNP
rs782154275 4342 dbSNP
rs148130961 4343 dbSNP
rs781805943 4344 dbSNP
rs1381834661 4367 dbSNP
rs1360087685 4378 dbSNP
rs890026942 4390 dbSNP
rs183067536 4400 dbSNP
rs1442757888 4401 dbSNP
rs188592558 4410 dbSNP
rs891938969 4414 dbSNP
rs1010288165 4415 dbSNP
rs1425120060 4417 dbSNP
rs1170755148 4420 dbSNP
rs1427585576 4422 dbSNP
rs1259167184 4424 dbSNP
rs1193295733 4438 dbSNP
rs1469189749 4451 dbSNP
rs1252992879 4452 dbSNP
rs1024308507 4460 dbSNP
rs781865187 4470 dbSNP
rs1212345957 4472 dbSNP
rs1459177951 4486 dbSNP
rs781862359 4494 dbSNP
rs374287461 4497 dbSNP
rs1305998528 4508 dbSNP
rs1034301711 4509 dbSNP
rs1236304501 4528 dbSNP
rs1371443550 4538 dbSNP
rs952038174 4539 dbSNP
rs192957315 4540 dbSNP
rs907724228 4542 dbSNP
rs1298269721 4543 dbSNP
rs200460349 4573 dbSNP
rs1460988647 4585 dbSNP
rs782509206 4604 dbSNP
rs975831784 4618 dbSNP
rs1175117681 4619 dbSNP
rs1455018259 4642 dbSNP
rs1394829613 4647 dbSNP
rs1192101570 4649 dbSNP
rs782595812 4651 dbSNP
rs1251800781 4652 dbSNP
rs923011679 4654 dbSNP
rs782614819 4676 dbSNP
rs781821427 4683 dbSNP
rs782227247 4698 dbSNP
rs1479696091 4701 dbSNP
rs1258045219 4712 dbSNP
rs782455597 4713 dbSNP
rs1348371836 4723 dbSNP
rs1302449199 4734 dbSNP
rs1231737893 4736 dbSNP
rs782438881 4740 dbSNP
rs375042950 4760 dbSNP
rs1390379804 4763 dbSNP
rs936266222 4772 dbSNP
rs1393669505 4790 dbSNP
rs1314377255 4807 dbSNP
rs1434985110 4812 dbSNP
rs1374426673 4822 dbSNP
rs1172180727 4826 dbSNP
rs1471324447 4828 dbSNP
rs1364948847 4829 dbSNP
rs782571423 4830 dbSNP
rs1181704316 4845 dbSNP
rs782287305 4849 dbSNP
rs782292065 4857 dbSNP
rs782428243 4859 dbSNP
rs781999773 4860 dbSNP
rs1278387001 4861 dbSNP
rs1208466029 4870 dbSNP
rs907270537 4873 dbSNP
rs782211003 4875 dbSNP
rs1001568772 4877 dbSNP
rs1034783128 4879 dbSNP
rs1352562387 4891 dbSNP
rs1261296182 4894 dbSNP
rs1238205686 4905 dbSNP
rs952051389 4906 dbSNP
rs1294622672 4920 dbSNP
rs782350823 4932 dbSNP
rs1354434158 4944 dbSNP
rs1006152204 4958 dbSNP
rs1310695398 4962 dbSNP
rs1402865983 4970 dbSNP
rs1014811494 4974 dbSNP
rs961910469 4977 dbSNP
rs1158535601 4984 dbSNP
rs1452296000 4986 dbSNP
rs975905350 4990 dbSNP
rs1420584578 4995 dbSNP
rs923044482 5002 dbSNP
rs1255752114 5005 dbSNP
rs1195571066 5009 dbSNP
rs1448565767 5016 dbSNP
rs1262210577 5017 dbSNP
rs1204280220 5028 dbSNP
rs1348474772 5032 dbSNP
rs1274900922 5033 dbSNP
rs1233438665 5036 dbSNP
rs1333509049 5039 dbSNP
rs56181618 5041 dbSNP
rs1432420808 5043 dbSNP
rs985872623 5060 dbSNP
rs1318099260 5066 dbSNP
rs924952225 5068 dbSNP
rs936314503 5070 dbSNP
rs1397325556 5071 dbSNP
rs1166276412 5075 dbSNP
rs1461035782 5121 dbSNP
rs782065566 5127 dbSNP
rs1169687346 5130 dbSNP
rs1475879142 5138 dbSNP
rs1372663578 5140 dbSNP
rs990362256 5142 dbSNP
rs782784629 5144 dbSNP
rs913479648 5151 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |||||| | ||||||| 
Target 5' -gauuACCAUU-UUUGCUGCUu 3'
1 - 20
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000370251.3 | 3UTR | GAUUACCAUUUUUGCUGCUUAUUACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000370251.3 | 3UTR | AUUACCAUUUUUGCUGCUUAUUACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.428 2.1e-2 0.441 1.8e-2 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.336 5.0e-2 0.297 7.5e-2 25 Click to see details
GSE28544 Breast cancer -0.252 1.2e-1 -0.419 2.1e-2 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.218 1.8e-1 -0.292 1.1e-1 20 Click to see details
GSE38226 Liver fibrosis 0.183 2.1e-1 0.102 3.3e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer -0.188 2.1e-1 -0.241 1.5e-1 20 Click to see details
GSE19536 Breast cancer 0.071 2.4e-1 -0.091 1.8e-1 100 Click to see details
GSE21032 Prostate cancer -0.068 2.7e-1 -0.068 2.7e-1 83 Click to see details
GSE21687 Ependynoma primary tumors 0.064 3.1e-1 0.041 3.7e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.142 3.2e-1 -0.049 4.4e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.047 3.4e-1 -0.073 2.6e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.082 3.5e-1 -0.020 4.6e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.085 4.0e-1 0.378 1.1e-1 12 Click to see details
GSE32688 Pancreatic cancer -0.032 4.3e-1 0.044 4.1e-1 32 Click to see details
GSE17306 Multiple myeloma -0.005 4.9e-1 -0.034 4.1e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.004 4.9e-1 0.019 4.6e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.004 4.9e-1 0.019 4.6e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.403 0 -0.449 0 42 Click to see details
STAD -0.368 0.02 -0.430 0.01 32 Click to see details
KIRP 0.284 0.06 0.289 0.05 32 Click to see details
KICH 0.299 0.07 0.186 0.19 25 Click to see details
LUSC 0.23 0.08 0.215 0.1 38 Click to see details
BLCA -0.281 0.13 -0.203 0.21 18 Click to see details
LUAD 0.34 0.14 0.476 0.06 12 Click to see details
BRCA 0.099 0.19 0.067 0.27 84 Click to see details
PAAD 0.622 0.19 0.400 0.3 4 Click to see details
PRAD 0.124 0.2 0.113 0.22 50 Click to see details
CHOL -0.314 0.21 -0.283 0.23 9 Click to see details
UCEC -0.178 0.23 -0.147 0.27 19 Click to see details
COAD 0.29 0.24 0.381 0.18 8 Click to see details
LIHC 0.087 0.28 0.006 0.48 49 Click to see details
ESCA -0.192 0.29 -0.173 0.31 11 Click to see details
PCPG 0.593 0.3 0.500 0.33 3 Click to see details
THCA -0.049 0.36 0.029 0.41 59 Click to see details
CESC -0.393 0.37 -0.500 0.33 3 Click to see details
KIRC 0.027 0.41 -0.002 0.49 68 Click to see details
KIRC 0.027 0.41 -0.002 0.49 68 Click to see details
KIRC 0.027 0.41 -0.002 0.49 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*