miRTarBase - #MIRT109185 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol VMA21   
Synonyms MEAX, XMEA
Description VMA21, vacuolar ATPase assembly factor
Transcript NM_001017980   
Putative miRNA Targets on VMA21
3'UTR of VMA21
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guuugUGGUA-AC---AG-----UGUGAGGu 5'
               |::|| ||   ||     ||||||| 
992 - 1022 141.00 -10.90
              |||:| |   ||||||  
Target 5' atctCACTACTCAAACACTCag 3'
630 - 651 134.00 -12.30
            || | |:||  ||||:||: 
3953 - 3974 132.00 -12.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
208803 7 ClinVar
208805 13 ClinVar
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs763492918 7 dbSNP
rs878854355 7 dbSNP
rs372822114 10 dbSNP
rs1286593356 15 dbSNP
rs1050236372 18 dbSNP
rs1327698159 34 dbSNP
rs376244455 45 dbSNP
rs759636959 47 dbSNP
rs765271039 51 dbSNP
rs889868106 63 dbSNP
rs764940224 64 dbSNP
rs191937091 77 dbSNP
rs1033120961 81 dbSNP
rs1050124032 99 dbSNP
rs762469521 109 dbSNP
rs372929263 119 dbSNP
rs1454245279 120 dbSNP
rs956305438 125 dbSNP
rs1350066731 138 dbSNP
rs146494103 142 dbSNP
rs1452520006 177 dbSNP
rs1294891756 179 dbSNP
rs1354080011 184 dbSNP
rs1261370425 190 dbSNP
rs1203626282 194 dbSNP
rs1353031104 195 dbSNP
rs1227540261 201 dbSNP
rs1286866463 204 dbSNP
rs866977691 211 dbSNP
rs150170190 212 dbSNP
rs138037107 214 dbSNP
rs368403239 214 dbSNP
rs57412333 214 dbSNP
rs202068639 216 dbSNP
rs866356920 218 dbSNP
rs867134079 219 dbSNP
rs1345699586 220 dbSNP
rs1305492705 223 dbSNP
rs1309209736 233 dbSNP
rs1325631863 244 dbSNP
rs1315895440 246 dbSNP
rs947033573 250 dbSNP
rs1023930457 269 dbSNP
rs1041751355 269 dbSNP
rs971436785 271 dbSNP
rs1393849629 272 dbSNP
rs1174823231 286 dbSNP
rs1478609623 288 dbSNP
rs979784918 289 dbSNP
rs1191432356 296 dbSNP
rs756439092 308 dbSNP
rs1189708515 310 dbSNP
rs927076188 311 dbSNP
rs951812169 316 dbSNP
rs1282452679 320 dbSNP
rs780269282 322 dbSNP
rs1219757686 324 dbSNP
rs1057050701 330 dbSNP
rs1268234317 333 dbSNP
rs754294894 334 dbSNP
rs1340798938 338 dbSNP
rs1311867776 341 dbSNP
rs755218792 353 dbSNP
rs376895229 355 dbSNP
rs907680208 382 dbSNP
rs1012785075 384 dbSNP
rs1376758416 386 dbSNP
rs771622462 395 dbSNP
rs975957830 403 dbSNP
rs777113887 412 dbSNP
rs1396340930 424 dbSNP
rs1006319786 444 dbSNP
rs779324775 451 dbSNP
rs934016743 458 dbSNP
rs769307681 462 dbSNP
rs1049746441 529 dbSNP
rs1420792599 539 dbSNP
rs889890157 542 dbSNP
rs1187473718 552 dbSNP
rs1432209609 561 dbSNP
rs1015307635 568 dbSNP
rs748191957 579 dbSNP
rs1210862250 584 dbSNP
rs1437191670 609 dbSNP
rs936059985 618 dbSNP
rs1054571896 625 dbSNP
rs141031699 636 dbSNP
rs976735529 639 dbSNP
rs1010454944 640 dbSNP
rs1292359516 641 dbSNP
rs1231080732 642 dbSNP
rs923579035 647 dbSNP
rs759856152 651 dbSNP
rs1440804790 654 dbSNP
rs1354507980 666 dbSNP
rs1314931324 671 dbSNP
rs907450209 672 dbSNP
rs986284351 676 dbSNP
rs1446961183 683 dbSNP
rs914759312 686 dbSNP
rs1164582308 688 dbSNP
rs1270583632 705 dbSNP
rs183611158 708 dbSNP
rs1416171434 712 dbSNP
rs1182571709 724 dbSNP
rs1469665654 724 dbSNP
rs1363953521 736 dbSNP
rs1231173194 739 dbSNP
rs1226156145 752 dbSNP
rs1180417790 753 dbSNP
rs1458114026 756 dbSNP
rs1272352537 763 dbSNP
rs1001633132 766 dbSNP
rs1323191177 767 dbSNP
rs947108575 767 dbSNP
rs1290104921 775 dbSNP
rs777786751 776 dbSNP
rs1370517905 782 dbSNP
rs1041474909 784 dbSNP
rs1449662023 787 dbSNP
rs746934286 788 dbSNP
rs762365631 801 dbSNP
rs1276006295 811 dbSNP
rs1034008046 822 dbSNP
rs1441518601 827 dbSNP
rs1400254777 859 dbSNP
rs951787218 862 dbSNP
rs3207598 870 dbSNP
rs1243101313 884 dbSNP
rs188503869 886 dbSNP
rs1057415872 890 dbSNP
rs1252270802 890 dbSNP
rs1440263162 890 dbSNP
rs961839257 894 dbSNP
rs575770171 895 dbSNP
rs975903811 905 dbSNP
rs1246981458 918 dbSNP
rs1214646046 923 dbSNP
rs923218799 926 dbSNP
rs1314690916 937 dbSNP
rs5970036 959 dbSNP
rs769416762 963 dbSNP
rs1355110115 969 dbSNP
rs985891828 981 dbSNP
rs911203664 992 dbSNP
rs1398318951 994 dbSNP
rs1385521009 997 dbSNP
rs1370168512 1005 dbSNP
rs762677432 1023 dbSNP
rs1430284703 1026 dbSNP
rs1343605175 1028 dbSNP
rs1400287015 1031 dbSNP
rs888290401 1043 dbSNP
rs936092470 1045 dbSNP
rs1394473016 1056 dbSNP
rs1006680888 1069 dbSNP
rs1015052002 1071 dbSNP
rs1326202761 1079 dbSNP
rs1054437339 1085 dbSNP
rs891873643 1090 dbSNP
rs1484704694 1092 dbSNP
rs1264856742 1100 dbSNP
rs1216758712 1101 dbSNP
rs962342402 1119 dbSNP
rs1280315019 1122 dbSNP
rs997553465 1144 dbSNP
rs1432638072 1150 dbSNP
rs1302437251 1154 dbSNP
rs1214327956 1166 dbSNP
rs1030520364 1167 dbSNP
rs1371668191 1169 dbSNP
rs763523869 1172 dbSNP
rs1311068400 1186 dbSNP
rs1467548415 1189 dbSNP
rs1359626756 1199 dbSNP
rs1169548104 1207 dbSNP
rs1426488773 1209 dbSNP
rs1045884120 1214 dbSNP
rs907478638 1218 dbSNP
rs1001763505 1230 dbSNP
rs1193917968 1243 dbSNP
rs1474644515 1254 dbSNP
rs775152306 1256 dbSNP
rs1254781471 1262 dbSNP
rs751132488 1266 dbSNP
rs1201631858 1268 dbSNP
rs1484553809 1271 dbSNP
rs193229751 1283 dbSNP
rs1272612407 1291 dbSNP
rs1316430412 1296 dbSNP
rs573627542 1296 dbSNP
rs953605542 1296 dbSNP
rs1310696093 1306 dbSNP
rs1397841494 1306 dbSNP
rs866175886 1311 dbSNP
rs1205414801 1313 dbSNP
rs761720610 1322 dbSNP
rs1402214322 1326 dbSNP
rs1171042389 1331 dbSNP
rs1005982342 1341 dbSNP
rs1415181045 1342 dbSNP
rs1460626096 1342 dbSNP
rs1285387779 1343 dbSNP
rs1423882662 1346 dbSNP
rs1257554045 1353 dbSNP
rs986357881 1357 dbSNP
rs1014713583 1362 dbSNP
rs185633245 1368 dbSNP
rs914708389 1379 dbSNP
rs1469330491 1382 dbSNP
rs1201057288 1389 dbSNP
rs374436208 1390 dbSNP
rs976342363 1400 dbSNP
rs1376046931 1406 dbSNP
rs1306312011 1427 dbSNP
rs1444483697 1439 dbSNP
rs1378972489 1454 dbSNP
rs968916477 1459 dbSNP
rs189302172 1460 dbSNP
rs1388215874 1471 dbSNP
rs977572169 1472 dbSNP
rs191301448 1475 dbSNP
rs924414070 1476 dbSNP
rs1156257225 1477 dbSNP
rs75469696 1484 dbSNP
rs35275320 1485 dbSNP
rs78504946 1486 dbSNP
rs1240551254 1487 dbSNP
rs1179705468 1491 dbSNP
rs1159434792 1494 dbSNP
rs992484700 1497 dbSNP
rs1265607971 1507 dbSNP
rs1211874898 1519 dbSNP
rs1488892621 1528 dbSNP
rs953437968 1539 dbSNP
rs1260250534 1551 dbSNP
rs1018033033 1553 dbSNP
rs1455397984 1555 dbSNP
rs1319675935 1564 dbSNP
rs966129070 1567 dbSNP
rs948586356 1568 dbSNP
rs767486519 1570 dbSNP
rs911223086 1571 dbSNP
rs957404722 1573 dbSNP
rs761081873 1576 dbSNP
rs1383728796 1580 dbSNP
rs913343278 1581 dbSNP
rs1330069921 1582 dbSNP
rs1239146860 1583 dbSNP
rs1159772560 1591 dbSNP
rs946123376 1599 dbSNP
rs939906539 1603 dbSNP
rs755819285 1604 dbSNP
rs928794571 1615 dbSNP
rs937591685 1620 dbSNP
rs1036839651 1627 dbSNP
rs1286754980 1633 dbSNP
rs766949517 1634 dbSNP
rs1210081030 1639 dbSNP
rs754127957 1646 dbSNP
rs1056016120 1666 dbSNP
rs1276417010 1677 dbSNP
rs183801280 1688 dbSNP
rs1325533947 1689 dbSNP
rs1005927682 1690 dbSNP
rs1275912051 1692 dbSNP
rs1401376137 1706 dbSNP
rs1030258944 1708 dbSNP
rs188510420 1709 dbSNP
rs1414430804 1732 dbSNP
rs752973487 1734 dbSNP
rs1174730037 1739 dbSNP
rs1007726810 1753 dbSNP
rs1451047746 1753 dbSNP
rs758494839 1783 dbSNP
rs1423251744 1784 dbSNP
rs1191793830 1799 dbSNP
rs1478886568 1803 dbSNP
rs1264031505 1814 dbSNP
rs1186865029 1818 dbSNP
rs555926860 1830 dbSNP
rs1280607419 1835 dbSNP
rs1182645179 1836 dbSNP
rs1200893779 1837 dbSNP
rs1338492520 1846 dbSNP
rs1254193203 1854 dbSNP
rs997244736 1855 dbSNP
rs7067140 1856 dbSNP
rs1292159065 1861 dbSNP
rs150205644 1863 dbSNP
rs1007799465 1865 dbSNP
rs757113678 1874 dbSNP
rs1339268505 1876 dbSNP
rs1336702487 1894 dbSNP
rs181310196 1900 dbSNP
rs745608094 1901 dbSNP
rs1400032016 1902 dbSNP
rs1032262193 1905 dbSNP
rs1168931222 1909 dbSNP
rs1021871508 1911 dbSNP
rs752797988 1923 dbSNP
rs1459375869 1929 dbSNP
rs758714812 1937 dbSNP
rs7066731 1961 dbSNP
rs1471850513 1968 dbSNP
rs969279205 1971 dbSNP
rs1389943254 1975 dbSNP
rs1391417031 1980 dbSNP
rs1188185043 1990 dbSNP
rs1457215864 1992 dbSNP
rs957930585 2000 dbSNP
rs1200250025 2005 dbSNP
rs990138820 2019 dbSNP
rs1309354307 2022 dbSNP
rs1272114871 2031 dbSNP
rs1226175147 2033 dbSNP
rs879173012 2044 dbSNP
rs1357862573 2050 dbSNP
rs35860657 2069 dbSNP
rs747133359 2071 dbSNP
rs775062279 2072 dbSNP
rs1449439423 2074 dbSNP
rs1376745254 2100 dbSNP
rs1032275685 2111 dbSNP
rs771534207 2115 dbSNP
rs1408896798 2119 dbSNP
rs1401380335 2120 dbSNP
rs1288103260 2126 dbSNP
rs1403761294 2126 dbSNP
rs186883339 2127 dbSNP
rs1336007876 2129 dbSNP
rs1163876285 2131 dbSNP
rs981509204 2138 dbSNP
rs1439034461 2143 dbSNP
rs1378380266 2159 dbSNP
rs1180322199 2160 dbSNP
rs1458044661 2166 dbSNP
rs1245854868 2169 dbSNP
rs1218930288 2194 dbSNP
rs1247453381 2195 dbSNP
rs879103893 2200 dbSNP
rs1289996619 2203 dbSNP
rs190080635 2224 dbSNP
rs1264149927 2236 dbSNP
rs992587020 2246 dbSNP
rs1242845012 2262 dbSNP
rs1378131490 2266 dbSNP
rs937558537 2267 dbSNP
rs915542435 2271 dbSNP
rs1351785069 2272 dbSNP
rs1356294188 2278 dbSNP
rs948408610 2284 dbSNP
rs1056363407 2286 dbSNP
rs984032500 2289 dbSNP
rs1160398002 2297 dbSNP
rs1276917014 2317 dbSNP
rs1482189238 2318 dbSNP
rs909827377 2323 dbSNP
rs939829935 2331 dbSNP
rs773702878 2332 dbSNP
rs781749750 2339 dbSNP
rs1189193533 2344 dbSNP
rs1478832096 2347 dbSNP
rs182244739 2357 dbSNP
rs1246891474 2359 dbSNP
rs1215340618 2364 dbSNP
rs1487013121 2365 dbSNP
rs1036841577 2366 dbSNP
rs942244203 2385 dbSNP
rs1318009379 2389 dbSNP
rs1301047073 2391 dbSNP
rs1258491262 2404 dbSNP
rs1284160163 2408 dbSNP
rs1036040931 2410 dbSNP
rs746408014 2411 dbSNP
rs1358704814 2412 dbSNP
rs553621770 2413 dbSNP
rs1300070632 2416 dbSNP
rs1420254210 2426 dbSNP
rs1358481889 2435 dbSNP
rs571920704 2436 dbSNP
rs41302170 2445 dbSNP
rs187212963 2447 dbSNP
rs189661830 2454 dbSNP
rs1007549104 2465 dbSNP
rs759914713 2473 dbSNP
rs1264746951 2480 dbSNP
rs1021813849 2481 dbSNP
rs888862342 2484 dbSNP
rs904750895 2485 dbSNP
rs1169918878 2487 dbSNP
rs1368233252 2488 dbSNP
rs1314297975 2489 dbSNP
rs999526979 2511 dbSNP
rs1218283912 2514 dbSNP
rs1338645527 2525 dbSNP
rs1280231460 2526 dbSNP
rs1007416588 2528 dbSNP
rs774616491 2543 dbSNP
rs180869527 2550 dbSNP
rs960488768 2555 dbSNP
rs768349490 2560 dbSNP
rs1020243960 2571 dbSNP
rs967369443 2572 dbSNP
rs1169649864 2576 dbSNP
rs1463759011 2578 dbSNP
rs1425302871 2591 dbSNP
rs1170821608 2597 dbSNP
rs1422725489 2601 dbSNP
rs992577211 2619 dbSNP
rs176454 2620 dbSNP
rs1035817999 2625 dbSNP
rs374374491 2630 dbSNP
rs1244154083 2634 dbSNP
rs969701807 2642 dbSNP
rs983810117 2663 dbSNP
rs1398111012 2674 dbSNP
rs753169819 2678 dbSNP
rs1321207985 2683 dbSNP
rs1487172002 2687 dbSNP
rs532620326 2710 dbSNP
rs866900373 2716 dbSNP
rs945526370 2741 dbSNP
rs979620978 2752 dbSNP
rs368001505 2755 dbSNP
rs773822714 2758 dbSNP
rs973067505 2759 dbSNP
rs909350285 2760 dbSNP
rs922419990 2764 dbSNP
rs372015243 2774 dbSNP
rs1298381542 2788 dbSNP
rs1457047932 2802 dbSNP
rs1276857589 2814 dbSNP
rs12854949 2826 dbSNP
rs1366234250 2827 dbSNP
rs942276882 2829 dbSNP
rs972276569 2832 dbSNP
rs1426124974 2837 dbSNP
rs755370141 2837 dbSNP
rs764420276 2837 dbSNP
rs1051788641 2844 dbSNP
rs1240347381 2850 dbSNP
rs919501742 2850 dbSNP
rs1196604245 2851 dbSNP
rs1204537790 2852 dbSNP
rs185462390 2856 dbSNP
rs910659803 2857 dbSNP
rs767040602 2861 dbSNP
rs943475319 2863 dbSNP
rs1378857629 2865 dbSNP
rs1198484628 2871 dbSNP
rs1255273798 2875 dbSNP
rs1307360647 2878 dbSNP
rs1429040486 2886 dbSNP
rs757382856 2895 dbSNP
rs1051848317 2896 dbSNP
rs1366793214 2903 dbSNP
rs888902590 2903 dbSNP
rs943086769 2904 dbSNP
rs1053570211 2908 dbSNP
rs780923323 2909 dbSNP
rs1382584567 2920 dbSNP
rs1182925584 2925 dbSNP
rs1432873759 2926 dbSNP
rs1265500476 2927 dbSNP
rs1009445930 2928 dbSNP
rs1490530598 2942 dbSNP
rs1285327704 2952 dbSNP
rs1214368742 2955 dbSNP
rs1020860619 2975 dbSNP
rs1355703409 2980 dbSNP
rs772966608 2981 dbSNP
rs1002899245 2982 dbSNP
rs1036086715 2983 dbSNP
rs1464270951 2996 dbSNP
rs999076221 3000 dbSNP
rs745816220 3015 dbSNP
rs1301443568 3023 dbSNP
rs1402027296 3024 dbSNP
rs1418435542 3032 dbSNP
rs1436283303 3043 dbSNP
rs958829948 3049 dbSNP
rs991546841 3054 dbSNP
rs190173953 3055 dbSNP
rs1227710505 3060 dbSNP
rs963574301 3081 dbSNP
rs760666467 3082 dbSNP
rs183110557 3087 dbSNP
rs1231418152 3088 dbSNP
rs749121841 3094 dbSNP
rs919541033 3098 dbSNP
rs895975885 3110 dbSNP
rs1199716052 3121 dbSNP
rs529860314 3124 dbSNP
rs768170950 3125 dbSNP
rs1223779596 3158 dbSNP
rs1316863462 3162 dbSNP
rs1275813554 3166 dbSNP
rs1401273755 3173 dbSNP
rs910187927 3191 dbSNP
rs1022706416 3207 dbSNP
rs943126958 3209 dbSNP
rs1005321463 3213 dbSNP
rs367577819 3224 dbSNP
rs747569974 3227 dbSNP
rs893546987 3237 dbSNP
rs1423140889 3246 dbSNP
rs1470452356 3246 dbSNP
rs1464416591 3255 dbSNP
rs972674004 3267 dbSNP
rs922545389 3277 dbSNP
rs1186754481 3281 dbSNP
rs1440587012 3291 dbSNP
rs1244768097 3293 dbSNP
rs1204037811 3295 dbSNP
rs1193684791 3296 dbSNP
rs771617864 3315 dbSNP
rs1219999221 3316 dbSNP
rs1431089804 3320 dbSNP
rs1042182674 3321 dbSNP
rs955195491 3326 dbSNP
rs985236210 3341 dbSNP
rs911067167 3342 dbSNP
rs1174836664 3343 dbSNP
rs1339179426 3351 dbSNP
rs188543019 3354 dbSNP
rs6627161 3357 dbSNP
rs760108765 3365 dbSNP
rs766085926 3380 dbSNP
rs112595787 3393 dbSNP
rs925972320 3395 dbSNP
rs1329573288 3403 dbSNP
rs1411801880 3418 dbSNP
rs1035712699 3422 dbSNP
rs934689523 3432 dbSNP
rs1053358656 3438 dbSNP
rs1386982357 3446 dbSNP
rs896091269 3455 dbSNP
rs191626805 3460 dbSNP
rs1438009566 3466 dbSNP
rs1044556988 3467 dbSNP
rs1294180614 3471 dbSNP
rs938259568 3482 dbSNP
rs1369909446 3490 dbSNP
rs41314149 3510 dbSNP
rs1317758187 3518 dbSNP
rs1300782578 3522 dbSNP
rs1247273119 3525 dbSNP
rs1376632733 3546 dbSNP
rs6627162 3549 dbSNP
rs147083260 3551 dbSNP
rs11555859 3560 dbSNP
rs1229963514 3570 dbSNP
rs1444665076 3571 dbSNP
rs183880461 3573 dbSNP
rs1323020142 3580 dbSNP
rs1005267723 3581 dbSNP
rs1266064058 3583 dbSNP
rs1017135984 3589 dbSNP
rs1438940689 3592 dbSNP
rs187756671 3596 dbSNP
rs1378292106 3606 dbSNP
rs761738015 3620 dbSNP
rs961065078 3624 dbSNP
rs767618049 3627 dbSNP
rs1026872938 3630 dbSNP
rs751861525 3631 dbSNP
rs1218811482 3636 dbSNP
rs1490700157 3641 dbSNP
rs757363161 3646 dbSNP
rs1248387476 3649 dbSNP
rs1223923963 3650 dbSNP
rs138457145 3658 dbSNP
rs1282654756 3666 dbSNP
rs988090893 3676 dbSNP
rs1190146556 3696 dbSNP
rs910226108 3699 dbSNP
rs1029349056 3721 dbSNP
rs964378269 3730 dbSNP
rs985350664 3735 dbSNP
rs1347473411 3736 dbSNP
rs1303799282 3737 dbSNP
rs1161800348 3749 dbSNP
rs1410288843 3750 dbSNP
rs989101489 3764 dbSNP
rs1018022017 3767 dbSNP
rs915012919 3768 dbSNP
rs781342453 3777 dbSNP
rs1424130495 3784 dbSNP
rs1189099583 3799 dbSNP
rs978859353 3828 dbSNP
rs926056720 3831 dbSNP
rs756014647 3839 dbSNP
rs746290338 3843 dbSNP
rs1293054747 3844 dbSNP
rs1351313860 3855 dbSNP
rs989196966 3857 dbSNP
rs1411965691 3867 dbSNP
rs1488272550 3870 dbSNP
rs917269636 3878 dbSNP
rs780014544 3883 dbSNP
rs1042236619 3886 dbSNP
rs1317913086 3887 dbSNP
rs927762663 3888 dbSNP
rs1044672435 3892 dbSNP
rs1325873301 3895 dbSNP
rs753579026 3901 dbSNP
rs1284060529 3912 dbSNP
rs1399448154 3918 dbSNP
rs754831698 3961 dbSNP
rs1290572487 3974 dbSNP
rs1431296294 3976 dbSNP
rs1358391153 3984 dbSNP
rs1173634981 3985 dbSNP
rs1291874091 3989 dbSNP
rs906028457 3991 dbSNP
rs1319887484 4004 dbSNP
rs941560507 4005 dbSNP
rs1188806081 4014 dbSNP
rs1220148413 4015 dbSNP
rs1055486723 4019 dbSNP
rs756709051 4020 dbSNP
rs144010777 4023 dbSNP
rs1048391 4026 dbSNP
rs1462858090 4029 dbSNP
rs1048393 4031 dbSNP
rs1048396 4033 dbSNP
rs1048398 4035 dbSNP
rs1048400 4040 dbSNP
rs896142962 4044 dbSNP
rs1182830770 4061 dbSNP
rs1305838066 4070 dbSNP
rs1297759641 4083 dbSNP
rs1215110081 4087 dbSNP
rs1378318857 4097 dbSNP
rs1029707985 4101 dbSNP
rs1012946462 4118 dbSNP
rs1406439929 4129 dbSNP
rs371661173 4130 dbSNP
rs1006758501 4131 dbSNP
rs1018180432 4138 dbSNP
rs899264112 4154 dbSNP
rs192677771 4158 dbSNP
rs993559936 4161 dbSNP
rs1429683757 4165 dbSNP
rs979696803 4166 dbSNP
rs147315626 4180 dbSNP
rs956293081 4181 dbSNP
rs988921891 4190 dbSNP
rs1198281556 4191 dbSNP
rs1306346220 4193 dbSNP
rs917217738 4207 dbSNP
rs780265419 4213 dbSNP
rs1009058228 4214 dbSNP
rs1312813176 4215 dbSNP
rs1248009671 4241 dbSNP
rs1383266887 4250 dbSNP
rs749869522 4255 dbSNP
rs1398489753 4270 dbSNP
rs927560080 4283 dbSNP
rs1298296891 4285 dbSNP
rs1448429631 4286 dbSNP
rs1285772068 4293 dbSNP
rs765918705 4293 dbSNP
rs941519460 4302 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuugUGGUA-AC---AG-----UGUGAGGu 5'
               |::|| ||   ||     ||||||| 
1 - 30
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000330374.6 | 3UTR | ACUAAUUAUGUGCAAUCUAAAAACACUCCCACAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.661 2.2e-4 -0.685 1.1e-4 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.652 3.7e-4 -0.649 4.0e-4 23 Click to see details
GSE17306 Multiple myeloma -0.318 1.3e-2 -0.017 4.5e-1 49 Click to see details
GSE21849 B cell lymphoma 0.407 1.4e-2 0.455 6.6e-3 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.398 2.4e-2 0.230 1.3e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.193 3.4e-2 -0.169 5.6e-2 90 Click to see details
GSE19350 CNS germ cell tumors -0.468 6.2e-2 -0.343 1.4e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.3 9.9e-2 0.120 3.1e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.373 1.0e-1 -0.341 1.3e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.19 1.8e-1 -0.273 9.3e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.156 2.0e-1 0.254 8.0e-2 32 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.334 2.6e-1 0.086 4.4e-1 6 Click to see details
GSE38226 Liver fibrosis -0.063 3.9e-1 -0.068 3.8e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.026 4.2e-1 -0.032 4.0e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.014 4.7e-1 -0.032 4.4e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.016 4.8e-1 -0.029 4.6e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.225 0.06 -0.203 0.08 49 Click to see details
ESCA -0.745 0.07 -0.600 0.14 5 Click to see details
KIRC 0.243 0.1 0.190 0.16 29 Click to see details
KIRP -0.373 0.16 -0.583 0.05 9 Click to see details
CHOL 0.235 0.27 0.400 0.14 9 Click to see details
HNSC 0.43 0.36 -0.500 0.33 3 Click to see details
KICH -0.093 0.41 -0.095 0.41 8 Click to see details
STAD -0.067 0.44 0.024 0.48 8 Click to see details
THCA 0.013 0.49 -0.200 0.37 5 Click to see details
THCA 0.013 0.49 -0.200 0.37 5 Click to see details
THCA 0.013 0.49 -0.200 0.37 5 Click to see details
THCA 0.013 0.49 -0.200 0.37 5 Click to see details
THCA 0.013 0.49 -0.200 0.37 5 Click to see details
THCA 0.013 0.49 -0.200 0.37 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*