miRTarBase - #MIRT107218 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZBTB34   
Synonyms ZNF918
Description zinc finger and BTB domain containing 34
Transcript NM_001099270   
Expression
Putative miRNA Targets on ZBTB34
3'UTR of ZBTB34
(miRNA target sites are highlighted)
>ZBTB34|NM_001099270|3'UTR
   1 GATGGTAAAGAAGTGCACCCAAACAAAGCACATTAATCAATGCATATTTGTGATTTGCTTTGTTGTAATCTTTGGTTTTC
  81 CCAACCATCTGGAAATCTCTTGGTCTCTTGGCAGTTTTTCTAAAGTTTCTGGATGGAACACTTCGTTGTGTTTATCCTTT
 161 CCCCTGCCCTCCCTCCCCGAAGGAGCTCAAAGCATGAAGGGCAACGCATCCAGGGAAAACACAGGCTGACAGTATTCCTC
 241 TTTGGCTGAACTCTTAATCCAAAATCTGCCAGTGATTTAGCTATGCCAACTGGTTGACCCTCCATTCTCTGCCAAGAGGC
 321 ATACTCTTTCTCATTGTGTGCGCTGGCAGCAGTGCACTTCCACGGAGGGAGATTAGGATGCCGTCAGCTGATACAAATGG
 401 GTAACCTTTTCTAATTTAAAATTCCTTTTAGGGGGTAGTTAGACAATTTATATATATATATAATAAAACTATTATTATAT
 481 ATATAGTATATATACATTTTCAAATTTGATTTTATTCTGGTTGAGGTGAATGTAAGAGGAATATATAATTTAATACAATG
 561 TGAACAGGGCTTCTGAGTCTATCTCATCCCTACCTAATATGTTAGGGTTTTGCCCCTTCATTTCCCTTACAAAAGAATGT
 641 TAGTAGGTTTATATTAATCATTGTGTCCAAAAGCAAGCAAAGCAAATCACAGTGTTCACAGCTCTGCTTCATAACAAATA
 721 CATAAACCAAATGCCATAAAATTTCTTCAACTCTAGTTGGAAACCGTTTGGAATTTTTGTTAGTTGTCCAGCAGGTAAGC
 801 TGGATGACCTGTGGTGCTGACCTTTTTACATAGTGTAGTGTTATATTAGCCAACCCCAAAGGAGCAGTGGTTTTCAAGGT
 881 TTTTACTGGCCTACAAATCTACCTTCATTCCGTACTGTAGAAACATACATACCAGGTAACTAAATCGAATCACTCTCTAT
 961 CATGAGTTAGTACTCACTCGCACTTAAGGAAAGGGATTTGTAGTTCTGTCTACAAAATTCTCCAAGCAGTGTTGTGGTTT
1041 TTTTTGTTTTTGTTTTTTTTCTTTCTCTTTTCAAACAGCCAGTTCAGGTGCACAGCAACTTTTTCTACATGCAGTTCCCA
1121 GGGAAACTGCAGAACTTAGAATTTGTACTTTTTGTAAAGCTATACTCTATGGGAATTGCAAGCAATATATCTATCTTAGT
1201 ATTGTGTGTGCTAATGAGAGCCTCAGTGGCTCCCCCACTCTCTCAGTGTTTCCTGCTTAAAGAACCAACAGTTTAAAAGC
1281 CCTCTAAGATACTCTGTGTGTCACCAAATCTGTGTGTCACCATTTTTTGGTCATGTGGTGCTATTTTTGTTAAGTGTCTT
1361 TTTAGGTCAGTATAGTTGTAGAAAATGTGAAATCTGATGGTAATAATGAATTATAATTGTTTTCCTCTCTTGAGTTCATA
1441 GCTTGAAAAGAGACCTCAAAAGCATGTGCTGGCAAACACGTTACTGTATGAAAACATACCTGAGTCCATTTGAATAATGT
1521 TTTATTAGTACTTTCGGAAATGTCTTCAGTTCTGTATTGTGTTCACATACACAAACAGGCTTTACAAGATTGCTTCGGTA
1601 CTGTAAACTCTGGCAGAGAGTAATTTTGTAGGCAGTTTGGTGGTGAGTTTGTGCTGCAGGCTGCCTGTGGGATGTCAGCG
1681 TTCTGGTATCTGCCTGAGAACCTGGGCTCTGAGACGCACAACCAGTGCACCTCCATAGGAGAACAGTGCAGCCACCTAAA
1761 AGAAAAACGAACGAAGGACCAGCCTCAGAGGCTAGAAGTTAAAGGAATACAGAATTAGATGTTTGCTGGTTTTCTGTGCT
1841 TTTTTGGCTCCTAAAATACCAATGGTGGATTTGTTTTTGTTTTTGTTTTTTGTTTTGAGAAATAAAAAGTCATTCAAGCC
1921 CTTTGTGTGTAATAGCCCCCAGGGGTGGCAGCTGTGCAGTCGCATCTCTTTGGCACACAGGATCTGTTCACGTGTGAACT
2001 GCTGCGCTACACATCAGTGTTAACTCCCTACAGATTACACTCTAATCCCGCTGCTCCCGAGGAGCGGCTTTGCTAAATCG
2081 GGTATATAGTATATGCCTTTTTCCTCGTCAAACTGCCTAAGTAGGGGTTCGTTCTCTCCCTGAAGCACTTGTTCAACTCC
2161 TGTTAAAGCCGCGTGCCTCAAGGGGAGGCTGGACCCCAAGTGTTTACCCACTTAAATATGTTCTGGGGTTTCAGGTAAAT
2241 GTTTGTGGGTTTTTTTTTCCTTACATGAATAAGTTTGGTTTTGATTTTTTTTTAATTGAATGCAAAAAATTTGTGTTGTG
2321 ATACAAATTAAGTTTGTGACAAGAAATGCCCAAATCCAAGGACATAAGAGGTCAAGCTCAGGGAAGGAACCTCCTTTTCA
2401 CTCAGGCTTGGGGCCTCCAGCGAGGTTTCCAGAGCATTCCATGGTATGAGAGACAGTGAGGAGGGAGGGCACCTGGCGCG
2481 GGCACTTCCAGCGTCCTGGCTCTTGGCATTGTCCGTCTTAACCTTATTTACATGGAGTTCTTTGTATTTGTGAATCTGTT
2561 TAACTGGTTTGAGTTTACCAAAGAGTGACTTATCCAAAATTGTCTTTGACAAAAATATCCATTGCTTTGATTGTACAGTT
2641 CAGGTTCAAACATTGTAATGGGACTGTTAAGGGGCAGAAAATTGATTGAGTTTCTCTCTAAGAATCATGATTCCACATTT
2721 TGCAAGTTCCACTTGCTCCCATTCGTGTTGCTAACACTTTACCCTTTCCACTGCTCGCAGTGTTAAGAATGAATTCTCAA
2801 GCCATAACACAGTACTGTAAAGTTCCGCAGGGCTTCGAGGGAGGCAGCGCCTAGGCCAGCACGGAGCTGTGTAGCCTCTC
2881 TGAGCGTTCGCACTGTCATGCTTCCCAGGGGTGTGACTGGTGAGAGATTAACTCCATTCAGATCGGGCAGCAGCAATTAA
2961 TTGTGCCTTGCCGCATGAGGATGTGTCAGGAGGATTAACATGACCACAGAACCGAAACATTCTCTCCCTGAAGTTCACTT
3041 CACGTCTCCGCAGACGAAGTACGCTGTGTAACTCCTTAGAGCAACTCTTTTTGGAAAGCAAAGTCCCTATTTCTGTACAG
3121 TTTTAGGTTAGGTGTTTCATTTATAACAGATGCAGAAATCAATTAAGATAAAGTGATATGTGAAGAAATCTTTTACAGTA
3201 AAATATATCCTGAATTCATATAGGCTTGTTCATAATTGAGTCTCTTCTTGAGCTACCTTTTCAATATTAGACAATGTGAA
3281 GACAGTGACAGCGTCCTTTTCTAGAGATATTTAGCCTGTTATTACAAACTGTGAAGACAAAGAATTTTATACTTTTACTA
3361 ATGTTTGTGGTTTTAAACAGTTATTTTCATTCTAATCAGTTCTCTACCCTCTAATTTCTACTAAAGCTGTAAATACATTT
3441 AGAAATTATATTTGTAAATACAGTATATGGAGACAAGTTAATTTTTTGGTCAGTGGAAAAAGCCTCCCAACCAATTGGCC
3521 CTGCCTTGGCAGTTGTGTTTTTTGTTGTTGTTGTTGTTGTTTTAGTTTAGTTTTTTTTTTTAAACAGCAGAAAGGATACT
3601 GTCGGTTCACTGTTGAGCAGAATATACTGTAGAACGAAAATGATAATTTTTAAATCTTCCAGAGCATGAGTAAATGTCTT
3681 TTCTAATGATAGCAAATATAACCAACTCTTTGTTTTTCCCTTAGCCCAGACCATATAGACCTGCGTATTTTGTGTGTGGT
3761 TTTGTTTTTATTTTTGTTCTTACAGCCTAGACCCTAGGAAAAATTTGCAGGAACACGAAACAAGGGCTGGGGGGAAAATC
3841 ATCTATGTGAATGAGCTTTACTTTAAAGAGATCAATGTATTTTATTTTATCAACTTTTTCTCTTAGTTACTGTGATTTTT
3921 GTTGTTGTTGTCCTCGTTATTGTTAAATTCTGTAATGGTTTCCTGTGAAGCCTCCACTGAAAGGGACTCAAATATGCAAC
4001 ACCTAAACTATTTTCCAAGGGCACATGCCCCTTGAATGGTGCTTCTAGACTGGTCAGGGTTATTTATTAAATTTTATATA
4081 TGAAAGTATTGGGGAATTATGTAAATTCTTTATATGAAACTATCTAGTTCATAAATCATAGATTTCATATTACTCAGTGC
4161 AACTGAACTAAAAGTTCAGAAAAGTCATTCACATTGTTCCAAATTTGTAATGGTTGTCACATGTCACATGCGTCTTTTTC
4241 AGTAAGTGCCAGAGTGTTCCCACTGTTTCTGCCCAGTGCTTGACTTCTCGGCCCGGAAGAGAACCTGCTTTCTCTGGTTT
4321 CCTTCCTGAGTCTGGCACAGACGGGGCTATTGTAGTTCTTGATCAAGTCCTGGAGTCAGCCTTGCCTGGCTCTCCTTGTA
4401 GCAGATTCAGTCCACAGACCTCTTGCTGCCCCTCAGTGACAAGTATGCTGTGAATTCAACCTTTGGACTTGCTGCCCAAG
4481 CCTTTGGTTGCTGCCCTGACTATTGTAAGAGGTAAACTTACCTGGTTTGTTTGAGAATGACCATTTTCCTAATGTGAAAA
4561 CCATCTCTCTCACCACTTTTATTAGTAGGGCTAACATTTTTTTCCGTTATAAATGGTTGAGCAATTTGAATGACTTAACA
4641 CAGTGTCATTATCTTGCAATATAAACTGGTAACCTCACAACTCCACACTTCATCACCATATGAAGTAAATGAAGCTAGCT
4721 AAGCGGATGCTGTATCAACTAGTAACTTGCCATTAAGGATTATTTTATAGCATGAATTTAAGACTATTTATTCAAATGAT
4801 ATTTTACTCTTGTATTCACTTTGTTTTAGATTTGTGACATGAATATTTCAGTGCTGCTTAATTTTGTTCTGAATTCTTGT
4881 TTCTTGCTTGTAAATGGCTTTTTTATGGTATAAATAAAGTCAATGGACATTGCTGTTTGTAAATAAAAATGCTGCTAGAG
4961 CAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ::||:  ||  |||||||| 
Target 5' caTGAATATTTCAGTGCTGCTt 3'
4838 - 4859 156.00 -12.90
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            |||:|| ||:  ||||||  
Target 5' ccCAAGCCTTTGGTTGCTGCcc 3'
4475 - 4496 148.00 -15.10
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|||: |  |  ||||||| 
Target 5' tgTAAATAA--AAATGCTGCTa 3'
4938 - 4957 148.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30147394 11 COSMIC
COSN30455490 21 COSMIC
COSN31590442 71 COSMIC
COSN28664714 104 COSMIC
COSN15626979 145 COSMIC
COSN15626980 164 COSMIC
COSN25809414 206 COSMIC
COSN8295589 516 COSMIC
COSN15626981 625 COSMIC
COSN15626982 627 COSMIC
COSN14878467 632 COSMIC
COSN31517351 641 COSMIC
COSN26585311 702 COSMIC
COSN31517081 740 COSMIC
COSN30114145 757 COSMIC
COSN31548275 777 COSMIC
COSN28395330 808 COSMIC
COSN30120809 825 COSMIC
COSN19538552 833 COSMIC
COSN30138534 902 COSMIC
COSN30543740 912 COSMIC
COSN30113304 947 COSMIC
COSN30166914 967 COSMIC
COSN26602603 971 COSMIC
COSN31517088 981 COSMIC
COSN30135080 1021 COSMIC
COSN31520734 1022 COSMIC
COSN31590908 1027 COSMIC
COSN30135322 1038 COSMIC
COSN31596675 1046 COSMIC
COSN23013055 1061 COSMIC
COSN30120627 1066 COSMIC
COSN31963112 1066 COSMIC
COSN31596239 1092 COSMIC
COSN26518023 1133 COSMIC
COSN30126475 1294 COSMIC
COSN15626983 1321 COSMIC
COSN31489259 1369 COSMIC
COSN28676349 1415 COSMIC
COSN22158936 1446 COSMIC
COSN30139886 1453 COSMIC
COSN31532346 1507 COSMIC
COSN15626984 1532 COSMIC
COSN31556092 1613 COSMIC
COSN8581183 1768 COSMIC
COSN30142142 1773 COSMIC
COSN31518605 1892 COSMIC
COSN30129219 1906 COSMIC
COSN14899089 1962 COSMIC
COSN31513360 2006 COSMIC
COSN28773514 2059 COSMIC
COSN20464042 2067 COSMIC
COSN31535649 2279 COSMIC
COSN30137738 2294 COSMIC
COSN26284287 2425 COSMIC
COSN31576257 2425 COSMIC
COSN30133055 2478 COSMIC
COSN26602424 2512 COSMIC
COSN30117080 2539 COSMIC
COSN30136238 2541 COSMIC
COSN26638826 2639 COSMIC
COSN21843521 2650 COSMIC
COSN15626985 2662 COSMIC
COSN31864139 2672 COSMIC
COSN15626986 2772 COSMIC
COSN20092017 2799 COSMIC
COSN30124732 2827 COSMIC
COSN31545636 2838 COSMIC
COSN30169470 2860 COSMIC
COSN30175677 2891 COSMIC
COSN30118030 2901 COSMIC
COSN2310923 2945 COSMIC
COSN31537522 2967 COSMIC
COSN30121372 3015 COSMIC
COSN30124618 3050 COSMIC
COSN31529841 3051 COSMIC
COSN15626987 3075 COSMIC
COSN31544022 3124 COSMIC
COSN30513213 3127 COSMIC
COSN30539329 3139 COSMIC
COSN31521789 3140 COSMIC
COSN30128980 3156 COSMIC
COSN31514784 3173 COSMIC
COSN31546705 3191 COSMIC
COSN30141539 3207 COSMIC
COSN30114151 3231 COSMIC
COSN31481178 3302 COSMIC
COSN2310924 3310 COSMIC
COSN30121827 3345 COSMIC
COSN30511687 3364 COSMIC
COSN31515932 3445 COSMIC
COSN15626988 3520 COSMIC
COSN32056474 3545 COSMIC
COSN19656479 3582 COSMIC
COSN28183428 3585 COSMIC
COSN20577672 3669 COSMIC
COSN31585476 3689 COSMIC
COSN31555563 3693 COSMIC
COSN26051670 3717 COSMIC
COSN30117197 3817 COSMIC
COSN31481481 3835 COSMIC
COSN24303067 3839 COSMIC
COSN28201905 3936 COSMIC
COSN19151293 3951 COSMIC
COSN30167067 4095 COSMIC
COSN29574083 4139 COSMIC
COSN31517926 4144 COSMIC
COSN31596217 4245 COSMIC
COSN15226004 4404 COSMIC
COSN31585048 4536 COSMIC
COSN30510394 4576 COSMIC
COSN30131758 4613 COSMIC
COSN31539076 4617 COSMIC
COSN28832591 4670 COSMIC
COSN8519971 4670 COSMIC
COSN31570244 4746 COSMIC
COSN30136343 4799 COSMIC
COSN30136705 4877 COSMIC
COSN31547095 4888 COSMIC
COSN15626989 4931 COSMIC
COSN20747845 4950 COSMIC
COSN30177944 4959 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1170636447 7 dbSNP
rs752904694 7 dbSNP
rs770458627 11 dbSNP
rs1406452502 12 dbSNP
rs776291084 14 dbSNP
rs1316757132 17 dbSNP
rs956422445 20 dbSNP
rs760688099 23 dbSNP
rs1216210936 24 dbSNP
rs1275057988 29 dbSNP
rs759197089 33 dbSNP
rs1304059268 36 dbSNP
rs765012557 41 dbSNP
rs762818182 43 dbSNP
rs376892982 45 dbSNP
rs751698648 45 dbSNP
rs751512707 48 dbSNP
rs942999580 68 dbSNP
rs1178520543 83 dbSNP
rs540718785 85 dbSNP
rs10819246 104 dbSNP
rs867037355 108 dbSNP
rs1196695262 118 dbSNP
rs933115769 123 dbSNP
rs1263643201 126 dbSNP
rs371134283 130 dbSNP
rs1232347934 132 dbSNP
rs1002626565 133 dbSNP
rs1035520209 134 dbSNP
rs1225612083 137 dbSNP
rs565346819 141 dbSNP
rs1330824797 143 dbSNP
rs1245843582 146 dbSNP
rs1260406599 147 dbSNP
rs1337952488 151 dbSNP
rs1465871098 158 dbSNP
rs1471704245 165 dbSNP
rs897018010 171 dbSNP
rs994475567 173 dbSNP
rs1379278232 174 dbSNP
rs1348787457 179 dbSNP
rs1206735782 183 dbSNP
rs886252667 196 dbSNP
rs1243736223 197 dbSNP
rs1199747800 199 dbSNP
rs1482155314 203 dbSNP
rs190160177 205 dbSNP
rs952755353 206 dbSNP
rs764713838 207 dbSNP
rs1460821555 218 dbSNP
rs143680464 221 dbSNP
rs757238684 222 dbSNP
rs541999370 230 dbSNP
rs895101432 236 dbSNP
rs1385015478 258 dbSNP
rs1180423962 260 dbSNP
rs375665296 263 dbSNP
rs1314074541 272 dbSNP
rs964764400 273 dbSNP
rs866417296 284 dbSNP
rs1400540952 285 dbSNP
rs1022999445 290 dbSNP
rs1454598755 303 dbSNP
rs976174564 305 dbSNP
rs923421294 309 dbSNP
rs1445939387 310 dbSNP
rs1385238714 313 dbSNP
rs1186787668 321 dbSNP
rs1422038471 324 dbSNP
rs1263728257 341 dbSNP
rs1186958420 342 dbSNP
rs79612201 343 dbSNP
rs1214647284 350 dbSNP
rs989404485 352 dbSNP
rs1470949011 357 dbSNP
rs758147548 364 dbSNP
rs371169040 365 dbSNP
rs779588311 369 dbSNP
rs181073919 371 dbSNP
rs1044045506 375 dbSNP
rs990726653 383 dbSNP
rs938403611 384 dbSNP
rs531011623 389 dbSNP
rs1056909834 391 dbSNP
rs544745109 395 dbSNP
rs964967481 399 dbSNP
rs1404946996 406 dbSNP
rs974368572 407 dbSNP
rs993989901 415 dbSNP
rs1477377946 417 dbSNP
rs1048714907 422 dbSNP
rs922966184 425 dbSNP
rs933002493 426 dbSNP
rs888327018 427 dbSNP
rs1006802819 428 dbSNP
rs1354316645 430 dbSNP
rs1253609073 431 dbSNP
rs983194869 433 dbSNP
rs907617618 435 dbSNP
rs1219713882 436 dbSNP
rs1017553261 438 dbSNP
rs1396729643 443 dbSNP
rs1276643246 445 dbSNP
rs941868751 447 dbSNP
rs755399500 449 dbSNP
rs964711042 449 dbSNP
rs1037571049 451 dbSNP
rs895049227 459 dbSNP
rs1306368398 465 dbSNP
rs1384583634 470 dbSNP
rs149699043 470 dbSNP
rs956333320 473 dbSNP
rs1334272546 475 dbSNP
rs1178369078 476 dbSNP
rs1421367839 476 dbSNP
rs947974225 482 dbSNP
rs1478229822 488 dbSNP
rs1241372393 491 dbSNP
rs1198351494 492 dbSNP
rs1449943039 494 dbSNP
rs1252706478 499 dbSNP
rs1288765894 501 dbSNP
rs988959576 508 dbSNP
rs1046365053 510 dbSNP
rs1322503005 512 dbSNP
rs1221643263 517 dbSNP
rs914727215 522 dbSNP
rs1264972195 523 dbSNP
rs1273889910 533 dbSNP
rs561265032 542 dbSNP
rs1230568366 543 dbSNP
rs149772438 545 dbSNP
rs980383864 546 dbSNP
rs926930630 548 dbSNP
rs546350393 551 dbSNP
rs1398105642 558 dbSNP
rs550340954 559 dbSNP
rs1003293453 570 dbSNP
rs1483524004 572 dbSNP
rs1338606868 578 dbSNP
rs1031717231 582 dbSNP
rs1194786782 587 dbSNP
rs891915087 590 dbSNP
rs1439194585 591 dbSNP
rs1182376069 593 dbSNP
rs1413205576 608 dbSNP
rs1011694498 616 dbSNP
rs1480339091 621 dbSNP
rs1174706655 627 dbSNP
rs1021777919 640 dbSNP
rs1179412979 644 dbSNP
rs756664502 645 dbSNP
rs1236902621 656 dbSNP
rs1057217656 661 dbSNP
rs570407847 671 dbSNP
rs1199075989 682 dbSNP
rs1352452057 682 dbSNP
rs532923054 683 dbSNP
rs1238862839 685 dbSNP
rs1373934860 699 dbSNP
rs1467000546 712 dbSNP
rs1048223942 722 dbSNP
rs888315840 723 dbSNP
rs546682192 728 dbSNP
rs1362755915 734 dbSNP
rs901116897 739 dbSNP
rs1394354600 742 dbSNP
rs1411925659 748 dbSNP
rs1030556435 757 dbSNP
rs566181593 766 dbSNP
rs983559613 767 dbSNP
rs535672389 785 dbSNP
rs1237384749 799 dbSNP
rs1185949261 804 dbSNP
rs1010775947 805 dbSNP
rs1286299357 813 dbSNP
rs1221509059 819 dbSNP
rs941802417 823 dbSNP
rs973213575 824 dbSNP
rs1228371423 826 dbSNP
rs1021786762 832 dbSNP
rs968903829 836 dbSNP
rs1282344463 839 dbSNP
rs1432654267 843 dbSNP
rs1340828155 844 dbSNP
rs555505880 845 dbSNP
rs1034574219 854 dbSNP
rs1358838422 857 dbSNP
rs1167059784 878 dbSNP
rs947887781 892 dbSNP
rs1413772179 894 dbSNP
rs992471622 908 dbSNP
rs1226520241 912 dbSNP
rs1249126487 913 dbSNP
rs747646147 920 dbSNP
rs918287728 935 dbSNP
rs1487131242 937 dbSNP
rs929734109 937 dbSNP
rs762515351 941 dbSNP
rs1320530488 948 dbSNP
rs1340795966 950 dbSNP
rs906450721 952 dbSNP
rs1216217164 953 dbSNP
rs370989827 953 dbSNP
rs909701009 953 dbSNP
rs984306894 953 dbSNP
rs569243891 954 dbSNP
rs1267797521 956 dbSNP
rs538508396 958 dbSNP
rs530081588 963 dbSNP
rs891858681 969 dbSNP
rs1349302155 970 dbSNP
rs549212888 974 dbSNP
rs1197802376 976 dbSNP
rs1011644128 980 dbSNP
rs146877384 982 dbSNP
rs1170463016 993 dbSNP
rs1477043346 1008 dbSNP
rs771632471 1015 dbSNP
rs1191347241 1016 dbSNP
rs866795043 1021 dbSNP
rs867306539 1023 dbSNP
rs1434271267 1032 dbSNP
rs139780948 1033 dbSNP
rs900652905 1035 dbSNP
rs1257344434 1036 dbSNP
rs1170304415 1038 dbSNP
rs996300805 1038 dbSNP
rs41274418 1039 dbSNP
rs192327035 1044 dbSNP
rs28399300 1047 dbSNP
rs1051766231 1053 dbSNP
rs1219992092 1053 dbSNP
rs28553528 1056 dbSNP
rs955172057 1059 dbSNP
rs1004535957 1062 dbSNP
rs144387117 1066 dbSNP
rs1401746720 1068 dbSNP
rs963090088 1070 dbSNP
rs754366487 1075 dbSNP
rs35842647 1079 dbSNP
rs755395578 1086 dbSNP
rs574154495 1090 dbSNP
rs1001674427 1095 dbSNP
rs1176363532 1110 dbSNP
rs1432289727 1111 dbSNP
rs916336070 1113 dbSNP
rs1293400288 1121 dbSNP
rs1180047782 1126 dbSNP
rs1439762195 1140 dbSNP
rs1034524108 1145 dbSNP
rs1196603321 1147 dbSNP
rs1484128637 1155 dbSNP
rs960318838 1156 dbSNP
rs1209134949 1158 dbSNP
rs772429032 1163 dbSNP
rs1228577797 1166 dbSNP
rs969177054 1168 dbSNP
rs981975143 1169 dbSNP
rs927900609 1170 dbSNP
rs1290392896 1186 dbSNP
rs542064513 1194 dbSNP
rs951144759 1207 dbSNP
rs1381944768 1219 dbSNP
rs1356833803 1220 dbSNP
rs866221127 1225 dbSNP
rs1053111006 1231 dbSNP
rs575772014 1231 dbSNP
rs909609346 1232 dbSNP
rs913193599 1235 dbSNP
rs975178468 1237 dbSNP
rs1425535335 1238 dbSNP
rs1488989877 1239 dbSNP
rs1181132910 1242 dbSNP
rs1482145187 1243 dbSNP
rs922477776 1256 dbSNP
rs1219023128 1260 dbSNP
rs1354531141 1270 dbSNP
rs1285463755 1275 dbSNP
rs933914612 1283 dbSNP
rs914606136 1293 dbSNP
rs1186259724 1294 dbSNP
rs1314054919 1295 dbSNP
rs1260317973 1298 dbSNP
rs891774028 1304 dbSNP
rs1299685014 1322 dbSNP
rs1400175158 1323 dbSNP
rs775603526 1325 dbSNP
rs1156346326 1328 dbSNP
rs1458990003 1329 dbSNP
rs1369045005 1333 dbSNP
rs1163918236 1335 dbSNP
rs1421869449 1339 dbSNP
rs1043081034 1340 dbSNP
rs1043092030 1341 dbSNP
rs1488763891 1343 dbSNP
rs1262740565 1354 dbSNP
rs1384612148 1363 dbSNP
rs1489474282 1366 dbSNP
rs900631659 1367 dbSNP
rs904572460 1368 dbSNP
rs1001622044 1369 dbSNP
rs1333173335 1378 dbSNP
rs1243774812 1382 dbSNP
rs1280541440 1384 dbSNP
rs1219598061 1387 dbSNP
rs1339514838 1388 dbSNP
rs1263502952 1392 dbSNP
rs146615070 1405 dbSNP
rs1390741134 1414 dbSNP
rs74824065 1415 dbSNP
rs890702574 1421 dbSNP
rs1425650251 1428 dbSNP
rs1286887669 1430 dbSNP
rs776752612 1438 dbSNP
rs1015196058 1439 dbSNP
rs963001031 1442 dbSNP
rs544494774 1461 dbSNP
rs746670195 1465 dbSNP
rs564183634 1468 dbSNP
rs532942467 1479 dbSNP
rs1313757446 1480 dbSNP
rs1268082561 1481 dbSNP
rs1209291171 1489 dbSNP
rs77633622 1496 dbSNP
rs1260544156 1497 dbSNP
rs1023381763 1500 dbSNP
rs969165616 1521 dbSNP
rs1268050051 1525 dbSNP
rs1234901704 1527 dbSNP
rs1331304331 1531 dbSNP
rs1229711362 1536 dbSNP
rs1300043366 1537 dbSNP
rs1438074124 1542 dbSNP
rs1026292453 1554 dbSNP
rs149197870 1555 dbSNP
rs927814897 1558 dbSNP
rs765164501 1565 dbSNP
rs1215589498 1573 dbSNP
rs1394022976 1588 dbSNP
rs1166389968 1592 dbSNP
rs528940126 1598 dbSNP
rs1266616181 1602 dbSNP
rs988437885 1606 dbSNP
rs551145518 1608 dbSNP
rs1179737709 1615 dbSNP
rs549191769 1617 dbSNP
rs963760975 1619 dbSNP
rs1457625181 1622 dbSNP
rs947353887 1626 dbSNP
rs975165290 1631 dbSNP
rs1043080896 1636 dbSNP
rs1231460884 1641 dbSNP
rs1378394505 1646 dbSNP
rs922004517 1670 dbSNP
rs1242632023 1678 dbSNP
rs766160045 1680 dbSNP
rs569104367 1681 dbSNP
rs955404980 1682 dbSNP
rs1414824224 1686 dbSNP
rs1183652775 1687 dbSNP
rs114301377 1689 dbSNP
rs913779232 1694 dbSNP
rs1179312356 1698 dbSNP
rs1470109652 1703 dbSNP
rs946662072 1706 dbSNP
rs552061503 1716 dbSNP
rs1255050469 1717 dbSNP
rs1390495341 1719 dbSNP
rs940873310 1731 dbSNP
rs925978468 1736 dbSNP
rs1208225092 1739 dbSNP
rs1036988068 1742 dbSNP
rs1055912540 1743 dbSNP
rs895920086 1744 dbSNP
rs899449265 1745 dbSNP
rs1457727196 1746 dbSNP
rs571134805 1748 dbSNP
rs1403779333 1753 dbSNP
rs536742783 1754 dbSNP
rs1449642661 1759 dbSNP
rs1312531760 1765 dbSNP
rs1413110553 1766 dbSNP
rs7023460 1768 dbSNP
rs188745953 1769 dbSNP
rs534221136 1770 dbSNP
rs1372238265 1773 dbSNP
rs1221646997 1774 dbSNP
rs1286862657 1780 dbSNP
rs1165435829 1781 dbSNP
rs1473346406 1782 dbSNP
rs1417524527 1793 dbSNP
rs1186233825 1813 dbSNP
rs1047237139 1816 dbSNP
rs904928578 1819 dbSNP
rs1331609047 1820 dbSNP
rs1005798727 1821 dbSNP
rs1003674068 1822 dbSNP
rs554176907 1842 dbSNP
rs751288659 1848 dbSNP
rs754715500 1851 dbSNP
rs1355407451 1855 dbSNP
rs574222090 1863 dbSNP
rs996531586 1864 dbSNP
rs1342677308 1870 dbSNP
rs1029800993 1874 dbSNP
rs1298967253 1874 dbSNP
rs1430107791 1874 dbSNP
rs1441181679 1876 dbSNP
rs1326131807 1879 dbSNP
rs1163314373 1880 dbSNP
rs1406506257 1880 dbSNP
rs1212418552 1886 dbSNP
rs987997613 1898 dbSNP
rs955163988 1909 dbSNP
rs1185510133 1910 dbSNP
rs1247898173 1916 dbSNP
rs1022168557 1919 dbSNP
rs988346068 1921 dbSNP
rs1468030393 1931 dbSNP
rs1271180311 1932 dbSNP
rs1180230483 1934 dbSNP
rs1200318948 1936 dbSNP
rs913737113 1937 dbSNP
rs1279111549 1944 dbSNP
rs967962930 1946 dbSNP
rs1214151120 1957 dbSNP
rs1360102607 1962 dbSNP
rs1413950319 1962 dbSNP
rs142545802 1963 dbSNP
rs921909682 1966 dbSNP
rs979373749 1978 dbSNP
rs925926270 1979 dbSNP
rs937301443 1981 dbSNP
rs191441564 1993 dbSNP
rs575403683 2003 dbSNP
rs987921978 2005 dbSNP
rs879139181 2006 dbSNP
rs1427182006 2007 dbSNP
rs1407907726 2010 dbSNP
rs1426824820 2012 dbSNP
rs1191325349 2014 dbSNP
rs917290094 2025 dbSNP
rs751224175 2027 dbSNP
rs911988384 2034 dbSNP
rs1180387013 2040 dbSNP
rs544028375 2043 dbSNP
rs1250594610 2044 dbSNP
rs940847615 2047 dbSNP
rs564424524 2051 dbSNP
rs1176155497 2058 dbSNP
rs41274420 2059 dbSNP
rs1235137481 2060 dbSNP
rs887316021 2066 dbSNP
rs1301926544 2067 dbSNP
rs899396710 2068 dbSNP
rs930910535 2075 dbSNP
rs1309425762 2076 dbSNP
rs1350692080 2077 dbSNP
rs900109649 2083 dbSNP
rs1045352992 2087 dbSNP
rs1176248863 2089 dbSNP
rs1433593194 2091 dbSNP
rs1392667347 2098 dbSNP
rs540257815 2105 dbSNP
rs76698109 2107 dbSNP
rs150960616 2108 dbSNP
rs1003210894 2112 dbSNP
rs1035146686 2121 dbSNP
rs892247378 2122 dbSNP
rs140659445 2127 dbSNP
rs1009356515 2128 dbSNP
rs548658894 2131 dbSNP
rs1211819695 2132 dbSNP
rs1009800052 2133 dbSNP
rs1278347886 2141 dbSNP
rs967898822 2149 dbSNP
rs1318109743 2152 dbSNP
rs878861857 2158 dbSNP
rs746342842 2161 dbSNP
rs1221379550 2162 dbSNP
rs1033567306 2166 dbSNP
rs959286278 2171 dbSNP
rs562205158 2172 dbSNP
rs531937759 2173 dbSNP
rs1419764888 2174 dbSNP
rs551655965 2177 dbSNP
rs967870012 2182 dbSNP
rs79675254 2199 dbSNP
rs1425370161 2200 dbSNP
rs1414191341 2203 dbSNP
rs1186934238 2217 dbSNP
rs1485490840 2219 dbSNP
rs372086549 2228 dbSNP
rs553604929 2236 dbSNP
rs182824146 2239 dbSNP
rs1483495823 2240 dbSNP
rs982915220 2247 dbSNP
rs1028200608 2248 dbSNP
rs547842274 2249 dbSNP
rs375804188 2250 dbSNP
rs941506986 2250 dbSNP
rs987524690 2251 dbSNP
rs567664028 2259 dbSNP
rs536785248 2266 dbSNP
rs865830873 2273 dbSNP
rs1051198453 2274 dbSNP
rs1383570120 2278 dbSNP
rs564514406 2285 dbSNP
rs59456476 2285 dbSNP
rs890829883 2285 dbSNP
rs1350366541 2291 dbSNP
rs1164038901 2294 dbSNP
rs1474069740 2311 dbSNP
rs1415962177 2314 dbSNP
rs1418205260 2321 dbSNP
rs1196062909 2333 dbSNP
rs1429222046 2341 dbSNP
rs1261186011 2347 dbSNP
rs376719676 2348 dbSNP
rs1203430834 2352 dbSNP
rs1489790733 2356 dbSNP
rs940809539 2367 dbSNP
rs1274336298 2376 dbSNP
rs1213478736 2378 dbSNP
rs1333067543 2386 dbSNP
rs1279736197 2391 dbSNP
rs1227643143 2392 dbSNP
rs755983038 2395 dbSNP
rs1427305340 2402 dbSNP
rs1169912710 2407 dbSNP
rs369700770 2414 dbSNP
rs61133304 2418 dbSNP
rs1371714503 2421 dbSNP
rs576429455 2422 dbSNP
rs12002895 2423 dbSNP
rs1000667830 2432 dbSNP
rs1402137334 2442 dbSNP
rs1168257961 2452 dbSNP
rs1033517930 2453 dbSNP
rs1372712997 2462 dbSNP
rs1045301210 2464 dbSNP
rs557649766 2469 dbSNP
rs1191190284 2478 dbSNP
rs959276233 2479 dbSNP
rs992123813 2480 dbSNP
rs1193519068 2481 dbSNP
rs1467435429 2486 dbSNP
rs926868334 2493 dbSNP
rs939004071 2494 dbSNP
rs1439263541 2497 dbSNP
rs1338421705 2506 dbSNP
rs1276005591 2509 dbSNP
rs1056159536 2510 dbSNP
rs983203908 2514 dbSNP
rs747324714 2523 dbSNP
rs1438684195 2524 dbSNP
rs1276857229 2525 dbSNP
rs1343140751 2527 dbSNP
rs1009291116 2533 dbSNP
rs941456351 2538 dbSNP
rs974172358 2541 dbSNP
rs1395719825 2549 dbSNP
rs1173067553 2559 dbSNP
rs921471557 2562 dbSNP
rs1240569429 2568 dbSNP
rs1183060635 2577 dbSNP
rs1199266665 2581 dbSNP
rs1387495441 2595 dbSNP
rs1241494370 2608 dbSNP
rs1201767899 2612 dbSNP
rs1348126859 2618 dbSNP
rs1279041118 2619 dbSNP
rs932888091 2621 dbSNP
rs1280005972 2636 dbSNP
rs1355834708 2636 dbSNP
rs1238063449 2637 dbSNP
rs1051375432 2650 dbSNP
rs1327134878 2652 dbSNP
rs1416913857 2654 dbSNP
rs768994154 2664 dbSNP
rs912826247 2669 dbSNP
rs1312423837 2675 dbSNP
rs1432932032 2676 dbSNP
rs945032986 2679 dbSNP
rs1042455974 2681 dbSNP
rs1469965824 2688 dbSNP
rs1362471795 2692 dbSNP
rs903567529 2696 dbSNP
rs1043475608 2699 dbSNP
rs1256347898 2699 dbSNP
rs903658502 2700 dbSNP
rs577895708 2702 dbSNP
rs1443655367 2706 dbSNP
rs1028189168 2713 dbSNP
rs1488945265 2717 dbSNP
rs375323583 2724 dbSNP
rs1284912134 2726 dbSNP
rs1204432254 2730 dbSNP
rs776771087 2742 dbSNP
rs761894652 2745 dbSNP
rs1348432098 2746 dbSNP
rs191658910 2754 dbSNP
rs1054959313 2757 dbSNP
rs1009294677 2763 dbSNP
rs183756332 2765 dbSNP
rs1356403436 2772 dbSNP
rs1292841983 2776 dbSNP
rs573311496 2777 dbSNP
rs1013900757 2778 dbSNP
rs1024868363 2782 dbSNP
rs1047439815 2785 dbSNP
rs542171273 2788 dbSNP
rs950702973 2790 dbSNP
rs1018975530 2792 dbSNP
rs908706587 2798 dbSNP
rs940180161 2799 dbSNP
rs749252908 2800 dbSNP
rs1345185303 2807 dbSNP
rs1433441366 2820 dbSNP
rs1299929463 2827 dbSNP
rs562624755 2828 dbSNP
rs531275282 2829 dbSNP
rs545620159 2834 dbSNP
rs1185291759 2837 dbSNP
rs920678321 2838 dbSNP
rs1358707619 2843 dbSNP
rs768580562 2857 dbSNP
rs962765313 2863 dbSNP
rs952155717 2864 dbSNP
rs1463501263 2867 dbSNP
rs921419242 2868 dbSNP
rs954214777 2870 dbSNP
rs1376303634 2872 dbSNP
rs987389057 2882 dbSNP
rs1430084187 2886 dbSNP
rs565318597 2887 dbSNP
rs980967983 2888 dbSNP
rs528037620 2890 dbSNP
rs114633740 2891 dbSNP
rs187448137 2893 dbSNP
rs145819527 2894 dbSNP
rs1057133800 2899 dbSNP
rs1185490331 2904 dbSNP
rs779024581 2906 dbSNP
rs936394116 2908 dbSNP
rs1254820752 2912 dbSNP
rs1194143620 2918 dbSNP
rs945048440 2925 dbSNP
rs1369899228 2928 dbSNP
rs1250950323 2937 dbSNP
rs573477711 2943 dbSNP
rs762988632 2945 dbSNP
rs1164201927 2946 dbSNP
rs766212665 2948 dbSNP
rs1214063490 2951 dbSNP
rs1337482709 2954 dbSNP
rs1306293271 2961 dbSNP
rs1442350572 2964 dbSNP
rs1013389558 2968 dbSNP
rs1444799161 2971 dbSNP
rs996632491 2973 dbSNP
rs193276830 2974 dbSNP
rs1049573224 2976 dbSNP
rs1407745592 2982 dbSNP
rs1396410276 2993 dbSNP
rs570164401 2999 dbSNP
rs1395572274 3001 dbSNP
rs891023325 3010 dbSNP
rs886318280 3014 dbSNP
rs1251045671 3015 dbSNP
rs545720600 3023 dbSNP
rs1480795942 3027 dbSNP
rs538736286 3030 dbSNP
rs557979188 3042 dbSNP
rs1245723627 3044 dbSNP
rs571344225 3045 dbSNP
rs1482185950 3047 dbSNP
rs559173501 3050 dbSNP
rs1015539330 3051 dbSNP
rs962712733 3056 dbSNP
rs1225837572 3057 dbSNP
rs1374463061 3058 dbSNP
rs1297274813 3059 dbSNP
rs879046007 3063 dbSNP
rs575957192 3064 dbSNP
rs1460808554 3065 dbSNP
rs767290586 3066 dbSNP
rs1198300660 3069 dbSNP
rs993502884 3073 dbSNP
rs1161144729 3085 dbSNP
rs1419475505 3095 dbSNP
rs752345647 3104 dbSNP
rs1027730326 3108 dbSNP
rs1407039843 3110 dbSNP
rs1257573910 3115 dbSNP
rs553655111 3116 dbSNP
rs755713144 3117 dbSNP
rs777463420 3118 dbSNP
rs185431624 3124 dbSNP
rs1485347971 3127 dbSNP
rs1251581123 3128 dbSNP
rs926785440 3133 dbSNP
rs41274422 3141 dbSNP
rs1413416844 3145 dbSNP
rs1318013701 3148 dbSNP
rs529475015 3148 dbSNP
rs1226929523 3153 dbSNP
rs1356990394 3157 dbSNP
rs1293451848 3158 dbSNP
rs1413661151 3160 dbSNP
rs978370436 3162 dbSNP
rs1170910237 3163 dbSNP
rs1404386748 3168 dbSNP
rs1454286739 3171 dbSNP
rs1344534022 3173 dbSNP
rs759004804 3185 dbSNP
rs190584095 3186 dbSNP
rs924924885 3188 dbSNP
rs1188873083 3190 dbSNP
rs1474935006 3192 dbSNP
rs1254229440 3200 dbSNP
rs945037158 3210 dbSNP
rs138921312 3212 dbSNP
rs1486511825 3213 dbSNP
rs760707377 3220 dbSNP
rs1207222363 3223 dbSNP
rs990497074 3226 dbSNP
rs544776009 3227 dbSNP
rs916295900 3237 dbSNP
rs979106738 3241 dbSNP
rs1232349116 3246 dbSNP
rs1338303026 3250 dbSNP
rs561378847 3258 dbSNP
rs41274424 3265 dbSNP
rs1361206124 3273 dbSNP
rs1318385738 3291 dbSNP
rs373273766 3293 dbSNP
rs1049956506 3294 dbSNP
rs141466174 3304 dbSNP
rs943869973 3311 dbSNP
rs115291943 3312 dbSNP
rs897096845 3315 dbSNP
rs1461181688 3317 dbSNP
rs1366920134 3319 dbSNP
rs1322734218 3323 dbSNP
rs1429128713 3326 dbSNP
rs1230897681 3331 dbSNP
rs1257262646 3339 dbSNP
rs1345055019 3343 dbSNP
rs1187170089 3344 dbSNP
rs1470201216 3353 dbSNP
rs1254061365 3358 dbSNP
rs1213457627 3362 dbSNP
rs768952708 3366 dbSNP
rs1252645967 3370 dbSNP
rs1194705752 3381 dbSNP
rs1227531069 3381 dbSNP
rs899101514 3383 dbSNP
rs73585568 3385 dbSNP
rs530400109 3394 dbSNP
rs1027678173 3395 dbSNP
rs887792770 3399 dbSNP
rs1483823772 3400 dbSNP
rs1371603934 3409 dbSNP
rs1002268339 3422 dbSNP
rs1184869171 3427 dbSNP
rs1252918663 3439 dbSNP
rs1388853395 3446 dbSNP
rs1433140591 3458 dbSNP
rs1300073529 3460 dbSNP
rs1034183323 3474 dbSNP
rs1389681201 3483 dbSNP
rs1166759044 3489 dbSNP
rs960873197 3503 dbSNP
rs540282537 3504 dbSNP
rs1008764708 3513 dbSNP
rs1021205513 3515 dbSNP
rs1450169959 3519 dbSNP
rs966957103 3525 dbSNP
rs1195971259 3534 dbSNP
rs1480094887 3536 dbSNP
rs1019769353 3537 dbSNP
rs1348519814 3542 dbSNP
rs145057369 3542 dbSNP
rs373861645 3542 dbSNP
rs979054377 3542 dbSNP
rs978275799 3545 dbSNP
rs201167146 3551 dbSNP
rs924920436 3552 dbSNP
rs201714344 3558 dbSNP
rs199978850 3559 dbSNP
rs745427452 3561 dbSNP
rs550224404 3565 dbSNP
rs569945576 3566 dbSNP
rs1306323977 3570 dbSNP
rs916271262 3571 dbSNP
rs949155722 3571 dbSNP
rs982296966 3575 dbSNP
rs867084561 3582 dbSNP
rs12178 3583 dbSNP
rs943877091 3586 dbSNP
rs1431793090 3588 dbSNP
rs1308421084 3589 dbSNP
rs1037309827 3597 dbSNP
rs899047679 3602 dbSNP
rs552399980 3604 dbSNP
rs1198709381 3605 dbSNP
rs1352714731 3611 dbSNP
rs897053803 3613 dbSNP
rs1238044365 3618 dbSNP
rs1350117254 3626 dbSNP
rs1286613691 3629 dbSNP
rs1416736170 3630 dbSNP
rs138015472 3631 dbSNP
rs755411728 3636 dbSNP
rs192274685 3637 dbSNP
rs1002626184 3639 dbSNP
rs1033762272 3641 dbSNP
rs1387776940 3643 dbSNP
rs896603990 3654 dbSNP
rs1456981079 3661 dbSNP
rs1013735692 3665 dbSNP
rs1008294781 3667 dbSNP
rs1189558594 3671 dbSNP
rs374613799 3679 dbSNP
rs553517817 3683 dbSNP
rs567258877 3693 dbSNP
rs1271854938 3697 dbSNP
rs769974699 3698 dbSNP
rs780098198 3709 dbSNP
rs966862243 3709 dbSNP
rs1284798558 3712 dbSNP
rs1204337375 3719 dbSNP
rs536121740 3720 dbSNP
rs1032557992 3726 dbSNP
rs556173278 3728 dbSNP
rs1266496532 3745 dbSNP
rs1235427016 3746 dbSNP
rs953679228 3776 dbSNP
rs1283744940 3783 dbSNP
rs991103895 3783 dbSNP
rs542760172 3786 dbSNP
rs1445899245 3802 dbSNP
rs985562671 3803 dbSNP
rs1319509483 3810 dbSNP
rs970823966 3812 dbSNP
rs1386964643 3816 dbSNP
rs377478111 3817 dbSNP
rs184523046 3818 dbSNP
rs961772530 3827 dbSNP
rs1160960808 3829 dbSNP
rs1476071985 3831 dbSNP
rs973208990 3835 dbSNP
rs571606 3836 dbSNP
rs918401852 3837 dbSNP
rs777214412 3838 dbSNP
rs79072691 3842 dbSNP
rs1050797217 3846 dbSNP
rs1335806224 3854 dbSNP
rs911833340 3872 dbSNP
rs1226710822 3876 dbSNP
rs1341495749 3877 dbSNP
rs1188017119 3878 dbSNP
rs749090418 3878 dbSNP
rs1228363714 3879 dbSNP
rs927230584 3884 dbSNP
rs1328410626 3900 dbSNP
rs1442022266 3911 dbSNP
rs1348948730 3914 dbSNP
rs1321131890 3919 dbSNP
rs1451580844 3919 dbSNP
rs1419673449 3922 dbSNP
rs1167386076 3925 dbSNP
rs1447657777 3927 dbSNP
rs572134760 3935 dbSNP
rs1194043919 3936 dbSNP
rs1488011142 3937 dbSNP
rs774097520 3940 dbSNP
rs1041057870 3953 dbSNP
rs938024697 3972 dbSNP
rs1055560041 3990 dbSNP
rs896555961 3995 dbSNP
rs759393684 3998 dbSNP
rs1014059141 4000 dbSNP
rs541678349 4011 dbSNP
rs767376440 4015 dbSNP
rs1340675318 4016 dbSNP
rs1053949738 4026 dbSNP
rs624903 4030 dbSNP
rs1456243003 4031 dbSNP
rs1295055152 4046 dbSNP
rs1273422642 4060 dbSNP
rs1443977108 4071 dbSNP
rs1012481982 4072 dbSNP
rs1245279264 4087 dbSNP
rs1427203232 4092 dbSNP
rs902649662 4093 dbSNP
rs1000995282 4096 dbSNP
rs1434192099 4100 dbSNP
rs760450207 4101 dbSNP
rs1422842224 4112 dbSNP
rs1178721898 4116 dbSNP
rs763828818 4118 dbSNP
rs550922950 4120 dbSNP
rs575257955 4127 dbSNP
rs1003581098 4131 dbSNP
rs1006536873 4132 dbSNP
rs543748258 4138 dbSNP
rs1283116243 4150 dbSNP
rs753456892 4152 dbSNP
rs965093223 4155 dbSNP
rs1319542250 4156 dbSNP
rs1277037867 4158 dbSNP
rs866814661 4163 dbSNP
rs973157232 4168 dbSNP
rs756659622 4171 dbSNP
rs1287251682 4188 dbSNP
rs972858724 4190 dbSNP
rs918349618 4194 dbSNP
rs1356865301 4200 dbSNP
rs952518464 4202 dbSNP
rs953194512 4203 dbSNP
rs985996932 4208 dbSNP
rs1469319351 4221 dbSNP
rs983994652 4221 dbSNP
rs780627747 4222 dbSNP
rs537915660 4226 dbSNP
rs1208593972 4227 dbSNP
rs927176588 4232 dbSNP
rs149512025 4233 dbSNP
rs532404655 4235 dbSNP
rs1189268792 4241 dbSNP
rs1041439276 4242 dbSNP
rs1413416216 4243 dbSNP
rs1483244083 4253 dbSNP
rs923970355 4257 dbSNP
rs1218391939 4260 dbSNP
rs1330197076 4266 dbSNP
rs188840932 4270 dbSNP
rs1267867062 4274 dbSNP
rs1445613430 4275 dbSNP
rs1057062282 4276 dbSNP
rs552516293 4290 dbSNP
rs1166655799 4291 dbSNP
rs949415632 4295 dbSNP
rs893913009 4296 dbSNP
rs1290515317 4299 dbSNP
rs1368768196 4308 dbSNP
rs1387698705 4313 dbSNP
rs1456669998 4318 dbSNP
rs1318505438 4325 dbSNP
rs766371135 4327 dbSNP
rs1042418487 4332 dbSNP
rs1045239151 4333 dbSNP
rs1390717663 4336 dbSNP
rs375078592 4341 dbSNP
rs1000983779 4343 dbSNP
rs1053901927 4346 dbSNP
rs1165593608 4348 dbSNP
rs1423254916 4356 dbSNP
rs781578324 4357 dbSNP
rs1188847698 4365 dbSNP
rs1465716801 4368 dbSNP
rs1003833800 4369 dbSNP
rs144261440 4375 dbSNP
rs1435259167 4388 dbSNP
rs1469544200 4393 dbSNP
rs547218592 4393 dbSNP
rs567122687 4394 dbSNP
rs1376526679 4404 dbSNP
rs1007523232 4405 dbSNP
rs1315302013 4411 dbSNP
rs1297070855 4412 dbSNP
rs748491455 4413 dbSNP
rs1229107688 4429 dbSNP
rs1335855618 4439 dbSNP
rs1318362047 4450 dbSNP
rs1442761212 4452 dbSNP
rs1228130853 4464 dbSNP
rs1266831787 4469 dbSNP
rs1393157903 4469 dbSNP
rs1331821593 4472 dbSNP
rs1294301365 4476 dbSNP
rs1216669962 4480 dbSNP
rs897521378 4485 dbSNP
rs1482406562 4499 dbSNP
rs994482527 4503 dbSNP
rs1172614678 4510 dbSNP
rs1450697573 4511 dbSNP
rs1390036009 4512 dbSNP
rs866231961 4518 dbSNP
rs770067367 4519 dbSNP
rs1027334650 4520 dbSNP
rs1208922337 4539 dbSNP
rs777789586 4540 dbSNP
rs1257086090 4556 dbSNP
rs1487284313 4564 dbSNP
rs953166144 4570 dbSNP
rs1205239255 4577 dbSNP
rs986326632 4577 dbSNP
rs536187824 4585 dbSNP
rs1236263026 4594 dbSNP
rs1331426154 4597 dbSNP
rs550216938 4606 dbSNP
rs749399849 4607 dbSNP
rs1388825958 4609 dbSNP
rs1414182779 4619 dbSNP
rs1457643788 4620 dbSNP
rs1430412578 4635 dbSNP
rs1174766388 4641 dbSNP
rs1167205930 4652 dbSNP
rs1356887326 4656 dbSNP
rs1449811749 4658 dbSNP
rs750089187 4660 dbSNP
rs148336832 4663 dbSNP
rs993870193 4671 dbSNP
rs774372746 4679 dbSNP
rs1409659686 4687 dbSNP
rs1252156318 4697 dbSNP
rs1182280516 4698 dbSNP
rs1482421979 4709 dbSNP
rs952465149 4719 dbSNP
rs1213002928 4725 dbSNP
rs935295262 4726 dbSNP
rs1255250216 4733 dbSNP
rs1230710871 4735 dbSNP
rs779556961 4747 dbSNP
rs1224770062 4756 dbSNP
rs989493864 4758 dbSNP
rs983942627 4763 dbSNP
rs567274635 4764 dbSNP
rs1350002155 4772 dbSNP
rs1034156636 4778 dbSNP
rs1045633974 4785 dbSNP
rs759583016 4785 dbSNP
rs958584088 4787 dbSNP
rs993114133 4796 dbSNP
rs906731782 4808 dbSNP
rs879171086 4809 dbSNP
rs1281386722 4810 dbSNP
rs1159385712 4812 dbSNP
rs939582281 4815 dbSNP
rs1249064967 4820 dbSNP
rs772110801 4830 dbSNP
rs141947749 4833 dbSNP
rs917180816 4835 dbSNP
rs949406425 4844 dbSNP
rs978102929 4849 dbSNP
rs1253636439 4851 dbSNP
rs898098509 4870 dbSNP
rs924007404 4877 dbSNP
rs1470487172 4895 dbSNP
rs1268502632 4909 dbSNP
rs936785841 4918 dbSNP
rs1229284959 4924 dbSNP
rs1190516540 4929 dbSNP
rs994430418 4940 dbSNP
rs1422934150 4958 dbSNP
rs1053810896 4963 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ||:  ||  |||||||| 
Target 5' ----AAUAUUUCAGUGCUGCUu 3'
1 - 18
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000319119.4 | 3UTR | AAUAUUUCAGUGCUGCUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.713 2.1e-4 0.701 2.9e-4 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.519 5.6e-3 -0.418 2.4e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.443 6.5e-2 -0.445 6.4e-2 13 Click to see details
GSE19350 CNS germ cell tumors 0.428 8.3e-2 0.301 1.7e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.169 9.1e-2 0.114 1.8e-1 64 Click to see details
GSE21849 B cell lymphoma 0.243 1.0e-1 0.224 1.2e-1 29 Click to see details
GSE26953 Aortic valvular endothelial cells 0.246 1.2e-1 0.327 5.9e-2 24 Click to see details
GSE19536 Breast cancer 0.097 1.7e-1 0.078 2.2e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.183 1.9e-1 0.282 8.6e-2 25 Click to see details
GSE14794 Lymphoblastoid cells 0.091 2.0e-1 0.105 1.6e-1 90 Click to see details
GSE38226 Liver fibrosis -0.19 2.0e-1 -0.021 4.6e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.14 2.2e-1 0.093 3.1e-1 32 Click to see details
GSE28544 Breast cancer -0.147 2.5e-1 -0.397 2.7e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.162 2.5e-1 0.208 1.9e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.06 3.0e-1 0.039 3.7e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.066 3.8e-1 0.025 4.5e-1 25 Click to see details
GSE21032 Prostate cancer 0.026 4.1e-1 0.009 4.7e-1 83 Click to see details
GSE17306 Multiple myeloma 0.032 4.1e-1 -0.019 4.5e-1 49 Click to see details
GSE17306 Multiple myeloma 0.032 4.1e-1 -0.019 4.5e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.339 0.01 0.301 0.02 49 Click to see details
PRAD 0.324 0.01 0.257 0.04 50 Click to see details
KICH -0.413 0.02 -0.367 0.04 25 Click to see details
STAD -0.297 0.05 -0.240 0.09 32 Click to see details
KIRC 0.173 0.08 0.160 0.1 68 Click to see details
HNSC -0.173 0.14 -0.200 0.1 42 Click to see details
PAAD 0.697 0.15 0.800 0.1 4 Click to see details
BRCA 0.106 0.17 0.078 0.24 84 Click to see details
UCEC 0.202 0.2 0.132 0.3 19 Click to see details
KIRP 0.116 0.26 0.062 0.37 32 Click to see details
CHOL 0.187 0.31 0.133 0.37 9 Click to see details
PCPG -0.508 0.33 -0.500 0.33 3 Click to see details
THCA 0.047 0.36 0.032 0.4 59 Click to see details
LUAD -0.112 0.36 0.049 0.44 12 Click to see details
CESC 0.4 0.37 0.500 0.33 3 Click to see details
ESCA -0.08 0.41 0.027 0.47 11 Click to see details
LUSC 0.021 0.45 0.089 0.3 38 Click to see details
BLCA 0.029 0.45 0.123 0.31 18 Click to see details
COAD 0.043 0.46 -0.262 0.27 8 Click to see details
COAD 0.043 0.46 -0.262 0.27 8 Click to see details
COAD 0.043 0.46 -0.262 0.27 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3