Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiRNA_215008026168.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 581

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 583

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 585

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 954

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 969

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 970

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 979

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: Invalid argument supplied for foreach() in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1399

Warning: array_push() expects parameter 1 to be array, null given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1422

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: Invalid argument supplied for foreach() in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1399

Warning: array_push() expects parameter 1 to be array, null given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1422

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpTarget_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1305

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1306

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1307

Warning: fopen(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpmiR_215008026168-known.fa): failed to open stream: No space left on device in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1309

Warning: fputs() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1310

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1311

Warning: file(/home/miRTarBase/public_html/miRTarBase_2022/cache/tmp/20220518/tmpMIRT_215008026168-known.miranda): failed to open stream: No such file or directory in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1316

Warning: Invalid argument supplied for foreach() in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1399

Warning: array_push() expects parameter 1 to be array, null given in /home/miRTarBase/public_html/miRTarBase_2022/php/detail.php on line 1422

Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT106292 [miRNA, hsa-miR-15a-5p :: ZFHX4, target gene]
miRTarBase - #MIRT106292 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZFHX4   
Synonyms ZFH4, ZHF4
Description zinc finger homeobox 4
Transcript NM_024721   
Putative miRNA Targets on ZFHX4
3'UTR of ZFHX4
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN9680617 2 COSMIC
COSN30661755 15 COSMIC
COSN30517881 17 COSMIC
COSN30473150 19 COSMIC
COSN31527053 45 COSMIC
COSN30110861 55 COSMIC
COSN1368382 58 COSMIC
COSN20105588 58 COSMIC
COSN19456232 83 COSMIC
COSN30045402 99 COSMIC
COSN21107797 118 COSMIC
COSN31598137 141 COSMIC
COSN27910130 152 COSMIC
COSN31480302 162 COSMIC
COSN31530898 167 COSMIC
COSN31562676 183 COSMIC
COSN23843100 197 COSMIC
COSN9269389 208 COSMIC
COSN31592052 244 COSMIC
COSN31485537 255 COSMIC
COSN31519601 278 COSMIC
COSN31561974 359 COSMIC
COSN21068444 365 COSMIC
COSN31490380 494 COSMIC
COSN15955319 506 COSMIC
COSN31522377 521 COSMIC
COSN28438701 586 COSMIC
COSN23076969 597 COSMIC
COSN31596663 598 COSMIC
COSN31518603 669 COSMIC
COSN31607563 736 COSMIC
COSN28639610 834 COSMIC
COSN31569791 937 COSMIC
COSN31529809 949 COSMIC
COSN31548727 949 COSMIC
COSN26566989 971 COSMIC
COSN27699342 981 COSMIC
COSN31548294 1019 COSMIC
COSN8519459 1096 COSMIC
COSN22272777 1117 COSMIC
COSN28677943 1153 COSMIC
COSN31551713 1162 COSMIC
COSN31486170 1164 COSMIC
COSN30444448 1237 COSMIC
COSN19611447 1242 COSMIC
COSN24302656 1356 COSMIC
COSN31572110 1375 COSMIC
COSN8519460 1396 COSMIC
COSN8519461 1397 COSMIC
COSN8519462 1401 COSMIC
COSN31531341 1403 COSMIC
COSN6363618 1419 COSMIC
COSN31588238 1432 COSMIC
COSN8101971 1509 COSMIC
COSN17309831 1514 COSMIC
COSN31569797 1544 COSMIC
COSN24466741 1558 COSMIC
COSN31607406 1653 COSMIC
COSN23570849 1702 COSMIC
COSN28637487 1764 COSMIC
COSN14972436 1833 COSMIC
COSN31530121 1843 COSMIC
COSN24294976 1855 COSMIC
COSN32061517 1910 COSMIC
COSN28745448 1937 COSMIC
COSN8519463 1937 COSMIC
COSN31578900 1948 COSMIC
COSN31589552 2000 COSMIC
COSN27763717 2002 COSMIC
COSN8519464 2119 COSMIC
COSN26504578 2122 COSMIC
COSN26465425 2234 COSMIC
COSN31559469 2235 COSMIC
COSN20418683 2244 COSMIC
COSN17666287 2245 COSMIC
COSN20105593 2253 COSMIC
COSN26469388 2255 COSMIC
COSN31607054 2256 COSMIC
COSN31532728 2264 COSMIC
COSN26574806 2273 COSMIC
COSN28411550 2357 COSMIC
COSN23452369 2390 COSMIC
COSN31585677 2412 COSMIC
COSN5238591 2421 COSMIC
COSN27157436 2443 COSMIC
COSN31591325 2495 COSMIC
COSN32069355 2553 COSMIC
COSN31583004 2577 COSMIC
COSN31597169 2585 COSMIC
COSN31526824 2634 COSMIC
COSN31571696 2647 COSMIC
COSN31591352 2678 COSMIC
COSN18968090 2682 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1367401495 2 dbSNP
rs1163628586 4 dbSNP
rs542039768 6 dbSNP
rs756884261 13 dbSNP
rs377073632 15 dbSNP
rs755255231 19 dbSNP
rs781638674 20 dbSNP
rs1262087573 24 dbSNP
rs1203778723 25 dbSNP
rs1261399346 25 dbSNP
rs1356727590 28 dbSNP
rs1221072498 32 dbSNP
rs1269535232 33 dbSNP
rs949224880 40 dbSNP
rs1222460252 42 dbSNP
rs1357350680 44 dbSNP
rs1363993727 45 dbSNP
rs1037344400 47 dbSNP
rs3830275 48 dbSNP
rs771325758 48 dbSNP
rs777118177 48 dbSNP
rs957096915 48 dbSNP
rs1491348235 49 dbSNP
rs200572308 49 dbSNP
rs748549046 50 dbSNP
rs1438647494 53 dbSNP
rs1048390617 54 dbSNP
rs867265458 55 dbSNP
rs949907565 56 dbSNP
rs1046016645 57 dbSNP
rs1190630190 58 dbSNP
rs768313922 70 dbSNP
rs927197439 72 dbSNP
rs937253751 83 dbSNP
rs1317633459 109 dbSNP
rs1055106053 114 dbSNP
rs1481608539 127 dbSNP
rs1270118495 137 dbSNP
rs560378518 142 dbSNP
rs527630143 143 dbSNP
rs1259246595 153 dbSNP
rs1275138836 156 dbSNP
rs1196481465 161 dbSNP
rs1047797667 162 dbSNP
rs1338943011 163 dbSNP
rs1249810074 165 dbSNP
rs868699275 175 dbSNP
rs886561026 179 dbSNP
rs150375735 181 dbSNP
rs1325405618 188 dbSNP
rs1283766092 190 dbSNP
rs1019540467 193 dbSNP
rs1006941504 194 dbSNP
rs1329294030 198 dbSNP
rs964964097 201 dbSNP
rs1391433482 202 dbSNP
rs78152837 203 dbSNP
rs542187565 204 dbSNP
rs1470788560 206 dbSNP
rs1010431413 209 dbSNP
rs957022404 211 dbSNP
rs1477300015 212 dbSNP
rs988471925 215 dbSNP
rs1183222809 216 dbSNP
rs138036812 222 dbSNP
rs1180637782 224 dbSNP
rs979474460 226 dbSNP
rs971561260 227 dbSNP
rs1409227426 229 dbSNP
rs924986105 234 dbSNP
rs959088027 234 dbSNP
rs981268368 240 dbSNP
rs1342659841 248 dbSNP
rs1165318397 253 dbSNP
rs116113052 263 dbSNP
rs1334652562 279 dbSNP
rs1328688878 285 dbSNP
rs1454195105 294 dbSNP
rs1456297749 303 dbSNP
rs937181634 318 dbSNP
rs751502767 324 dbSNP
rs919872721 328 dbSNP
rs1374127608 334 dbSNP
rs1422342435 348 dbSNP
rs930626536 349 dbSNP
rs1179852596 353 dbSNP
rs1048194175 358 dbSNP
rs886493324 359 dbSNP
rs1470133486 361 dbSNP
rs1378487553 366 dbSNP
rs1390965881 368 dbSNP
rs1304967344 390 dbSNP
rs944802178 391 dbSNP
rs774310916 392 dbSNP
rs184637621 395 dbSNP
rs1242724829 401 dbSNP
rs1202064249 403 dbSNP
rs917702870 459 dbSNP
rs996330203 462 dbSNP
rs1033217324 471 dbSNP
rs114819665 478 dbSNP
rs972633271 484 dbSNP
rs555187211 491 dbSNP
rs1247578675 492 dbSNP
rs372496598 501 dbSNP
rs1382940267 506 dbSNP
rs1313901888 510 dbSNP
rs1020383681 512 dbSNP
rs971146783 519 dbSNP
rs931251755 524 dbSNP
rs1048844470 530 dbSNP
rs1319397305 539 dbSNP
rs868386547 556 dbSNP
rs981580443 559 dbSNP
rs1034131597 567 dbSNP
rs1480592972 568 dbSNP
rs189493353 569 dbSNP
rs1384749115 584 dbSNP
rs973939657 585 dbSNP
rs534227100 586 dbSNP
rs919800682 590 dbSNP
rs1193658125 591 dbSNP
rs1487900460 592 dbSNP
rs1283763538 593 dbSNP
rs558787293 595 dbSNP
rs1010818407 597 dbSNP
rs1226194384 598 dbSNP
rs752584363 600 dbSNP
rs1271089295 601 dbSNP
rs1430417861 606 dbSNP
rs1338964977 609 dbSNP
rs531366346 610 dbSNP
rs983444980 611 dbSNP
rs1416866810 612 dbSNP
rs576449437 617 dbSNP
rs1364965898 623 dbSNP
rs1421894791 625 dbSNP
rs1411817130 636 dbSNP
rs944750085 648 dbSNP
rs1167599668 655 dbSNP
rs1477360888 663 dbSNP
rs180681967 666 dbSNP
rs1201502069 671 dbSNP
rs1490495639 679 dbSNP
rs900629943 688 dbSNP
rs1245568156 690 dbSNP
rs1218772399 691 dbSNP
rs755916804 693 dbSNP
rs1273238426 695 dbSNP
rs879523543 718 dbSNP
rs1461432903 738 dbSNP
rs1217697753 751 dbSNP
rs1306206449 754 dbSNP
rs1054555902 760 dbSNP
rs893359314 761 dbSNP
rs1345458231 764 dbSNP
rs1292963058 767 dbSNP
rs1010923134 769 dbSNP
rs1291816671 775 dbSNP
rs1034625597 777 dbSNP
rs1020557768 784 dbSNP
rs1169993411 785 dbSNP
rs1216622472 787 dbSNP
rs1464323661 794 dbSNP
rs1296753960 801 dbSNP
rs1421126571 807 dbSNP
rs1178343577 808 dbSNP
rs906849974 812 dbSNP
rs1480696331 821 dbSNP
rs1424414319 825 dbSNP
rs1189450623 826 dbSNP
rs1481318530 828 dbSNP
rs1002574827 829 dbSNP
rs1197544128 836 dbSNP
rs1307373228 842 dbSNP
rs1034095958 854 dbSNP
rs974274114 854 dbSNP
rs1312020899 856 dbSNP
rs1299795003 857 dbSNP
rs555868019 858 dbSNP
rs1203068073 861 dbSNP
rs1226036072 867 dbSNP
rs1374142839 869 dbSNP
rs574514084 871 dbSNP
rs1444768554 873 dbSNP
rs1408606155 887 dbSNP
rs1338412887 888 dbSNP
rs541556648 889 dbSNP
rs958444940 900 dbSNP
rs1486394288 901 dbSNP
rs1211139419 908 dbSNP
rs1173859594 911 dbSNP
rs1420807702 912 dbSNP
rs777478441 913 dbSNP
rs753491050 914 dbSNP
rs1482075207 927 dbSNP
rs918437483 932 dbSNP
rs1177491167 933 dbSNP
rs185095158 934 dbSNP
rs1203961004 935 dbSNP
rs12155655 935 dbSNP
rs1218477408 935 dbSNP
rs1187987593 938 dbSNP
rs1026834688 940 dbSNP
rs951255476 943 dbSNP
rs1427812780 944 dbSNP
rs1166689720 945 dbSNP
rs1396947650 949 dbSNP
rs745413121 953 dbSNP
rs1401145787 960 dbSNP
rs1300879438 962 dbSNP
rs1455238575 963 dbSNP
rs984035906 969 dbSNP
rs911165518 975 dbSNP
rs1417296982 979 dbSNP
rs1386619752 981 dbSNP
rs558870589 996 dbSNP
rs983089420 1009 dbSNP
rs757497032 1030 dbSNP
rs912511735 1039 dbSNP
rs1357581831 1059 dbSNP
rs1188685573 1066 dbSNP
rs966432798 1070 dbSNP
rs976148956 1071 dbSNP
rs921981769 1073 dbSNP
rs901226546 1074 dbSNP
rs1361671282 1077 dbSNP
rs946166656 1079 dbSNP
rs1244257120 1084 dbSNP
rs1042255485 1086 dbSNP
rs904672805 1088 dbSNP
rs1383672633 1094 dbSNP
rs932077093 1101 dbSNP
rs1361747035 1103 dbSNP
rs1398147773 1104 dbSNP
rs1366822682 1108 dbSNP
rs1054528671 1109 dbSNP
rs1163681718 1110 dbSNP
rs879413322 1116 dbSNP
rs1306345684 1117 dbSNP
rs1172141293 1123 dbSNP
rs189423019 1130 dbSNP
rs1429462952 1134 dbSNP
rs527442327 1137 dbSNP
rs571948124 1140 dbSNP
rs1042353775 1142 dbSNP
rs1192043342 1150 dbSNP
rs1490986351 1157 dbSNP
rs1279011822 1161 dbSNP
rs1269635778 1162 dbSNP
rs907488174 1164 dbSNP
rs371118918 1166 dbSNP
rs1217537892 1173 dbSNP
rs1228507364 1175 dbSNP
rs781767334 1182 dbSNP
rs748594607 1190 dbSNP
rs1055475875 1191 dbSNP
rs532714982 1192 dbSNP
rs995275826 1195 dbSNP
rs1385704705 1196 dbSNP
rs1026760727 1204 dbSNP
rs531484960 1206 dbSNP
rs1465820084 1210 dbSNP
rs1454664744 1219 dbSNP
rs1423284151 1226 dbSNP
rs1173028198 1227 dbSNP
rs972525327 1247 dbSNP
rs1025837136 1251 dbSNP
rs550989200 1258 dbSNP
rs1449924098 1262 dbSNP
rs951278998 1269 dbSNP
rs1252835321 1273 dbSNP
rs563066841 1280 dbSNP
rs1004083978 1284 dbSNP
rs1257138410 1288 dbSNP
rs1216608961 1294 dbSNP
rs1325477479 1295 dbSNP
rs548016205 1296 dbSNP
rs113946042 1297 dbSNP
rs976022814 1299 dbSNP
rs1308531535 1301 dbSNP
rs1446996305 1304 dbSNP
rs1160169825 1305 dbSNP
rs963932718 1308 dbSNP
rs1344961061 1314 dbSNP
rs200940625 1317 dbSNP
rs371086829 1317 dbSNP
rs202064475 1318 dbSNP
rs16939381 1319 dbSNP
rs1365551859 1323 dbSNP
rs1440853564 1329 dbSNP
rs1439277451 1330 dbSNP
rs1236552945 1333 dbSNP
rs1205870929 1335 dbSNP
rs749525302 1338 dbSNP
rs926066315 1342 dbSNP
rs1199745888 1355 dbSNP
rs1342318276 1358 dbSNP
rs953403004 1371 dbSNP
rs1225095036 1372 dbSNP
rs936182336 1374 dbSNP
rs1375583250 1386 dbSNP
rs1316117596 1391 dbSNP
rs1206524361 1395 dbSNP
rs149499606 1405 dbSNP
rs894699256 1408 dbSNP
rs914693584 1409 dbSNP
rs147488334 1411 dbSNP
rs1046071839 1412 dbSNP
rs906178552 1414 dbSNP
rs1041890652 1421 dbSNP
rs928844118 1428 dbSNP
rs1377985401 1431 dbSNP
rs536757069 1443 dbSNP
rs534096928 1451 dbSNP
rs774399929 1455 dbSNP
rs952607433 1457 dbSNP
rs1186612743 1463 dbSNP
rs111364237 1468 dbSNP
rs1005302727 1480 dbSNP
rs1407442973 1483 dbSNP
rs1018071357 1498 dbSNP
rs772719457 1499 dbSNP
rs976621124 1502 dbSNP
rs552327327 1509 dbSNP
rs1395713785 1510 dbSNP
rs1283932866 1516 dbSNP
rs922540400 1527 dbSNP
rs894130078 1530 dbSNP
rs1328615084 1531 dbSNP
rs759685674 1543 dbSNP
rs1048167348 1548 dbSNP
rs1400002840 1555 dbSNP
rs1322205968 1561 dbSNP
rs977865217 1562 dbSNP
rs555078656 1567 dbSNP
rs571155055 1568 dbSNP
rs926022988 1582 dbSNP
rs1279639373 1589 dbSNP
rs1004414560 1590 dbSNP
rs1265147590 1592 dbSNP
rs1349439375 1599 dbSNP
rs1487930532 1604 dbSNP
rs1226220258 1608 dbSNP
rs1274777732 1618 dbSNP
rs114055842 1619 dbSNP
rs569926841 1622 dbSNP
rs1223170671 1629 dbSNP
rs1321838967 1649 dbSNP
rs1288677358 1655 dbSNP
rs965645882 1656 dbSNP
rs996699604 1662 dbSNP
rs1028225156 1676 dbSNP
rs953370621 1678 dbSNP
rs916098577 1682 dbSNP
rs138370199 1698 dbSNP
rs1287722425 1699 dbSNP
rs78772317 1702 dbSNP
rs967494122 1703 dbSNP
rs977962686 1708 dbSNP
rs898104412 1714 dbSNP
rs1321822466 1718 dbSNP
rs1411871427 1719 dbSNP
rs1232398538 1720 dbSNP
rs1171153858 1726 dbSNP
rs1477432972 1727 dbSNP
rs1421355358 1733 dbSNP
rs1471711627 1745 dbSNP
rs1192904038 1748 dbSNP
rs760592937 1757 dbSNP
rs1419001718 1760 dbSNP
rs535545494 1766 dbSNP
rs1245696997 1772 dbSNP
rs1475120467 1774 dbSNP
rs181701439 1777 dbSNP
rs993845738 1789 dbSNP
rs1411034236 1790 dbSNP
rs1047172266 1813 dbSNP
rs1340578197 1818 dbSNP
rs753656851 1822 dbSNP
rs1316492556 1824 dbSNP
rs556174642 1828 dbSNP
rs374290399 1829 dbSNP
rs546048453 1829 dbSNP
rs1407588449 1830 dbSNP
rs963833274 1833 dbSNP
rs998009917 1834 dbSNP
rs577525389 1835 dbSNP
rs930963096 1840 dbSNP
rs1048094514 1843 dbSNP
rs768352785 1845 dbSNP
rs1433709621 1850 dbSNP
rs1282226155 1853 dbSNP
rs939800296 1856 dbSNP
rs1228279231 1860 dbSNP
rs1188978503 1870 dbSNP
rs796475340 1879 dbSNP
rs1177683267 1890 dbSNP
rs1456712932 1893 dbSNP
rs1033442206 1895 dbSNP
rs111487945 1896 dbSNP
rs11419240 1896 dbSNP
rs1444933253 1896 dbSNP
rs544756244 1896 dbSNP
rs76493588 1899 dbSNP
rs1374302486 1902 dbSNP
rs564259732 1905 dbSNP
rs1304389368 1908 dbSNP
rs186870578 1909 dbSNP
rs1215122082 1910 dbSNP
rs200024659 1910 dbSNP
rs1273971621 1911 dbSNP
rs1482143649 1912 dbSNP
rs1213279606 1914 dbSNP
rs1258569858 1922 dbSNP
rs1442068903 1926 dbSNP
rs1358468470 1934 dbSNP
rs957415886 1937 dbSNP
rs1185799955 1944 dbSNP
rs991550298 1944 dbSNP
rs77998047 1950 dbSNP
rs76867872 1951 dbSNP
rs191456123 1952 dbSNP
rs1258641821 1953 dbSNP
rs1167891691 1955 dbSNP
rs1388995034 1957 dbSNP
rs1427338009 1960 dbSNP
rs1483151578 1961 dbSNP
rs17445167 1962 dbSNP
rs1047903 1980 dbSNP
rs530005575 1989 dbSNP
rs948154465 1993 dbSNP
rs1375613565 1994 dbSNP
rs996668405 2000 dbSNP
rs1395112870 2002 dbSNP
rs548295076 2005 dbSNP
rs560239277 2015 dbSNP
rs764962380 2016 dbSNP
rs1323759940 2018 dbSNP
rs1483803 2037 dbSNP
rs893724088 2042 dbSNP
rs929554586 2044 dbSNP
rs1011496575 2047 dbSNP
rs527760975 2050 dbSNP
rs1310987425 2051 dbSNP
rs1021638805 2066 dbSNP
rs1401770599 2085 dbSNP
rs1046698996 2087 dbSNP
rs181461840 2088 dbSNP
rs1340137419 2089 dbSNP
rs1423586995 2090 dbSNP
rs143903680 2095 dbSNP
rs757983080 2096 dbSNP
rs1036214990 2099 dbSNP
rs960190028 2110 dbSNP
rs991698241 2111 dbSNP
rs1198985951 2121 dbSNP
rs1489532188 2121 dbSNP
rs1266246094 2132 dbSNP
rs1029920351 2135 dbSNP
rs1320820163 2136 dbSNP
rs916126588 2143 dbSNP
rs1341088398 2156 dbSNP
rs570951954 2173 dbSNP
rs1380005879 2177 dbSNP
rs999194713 2180 dbSNP
rs1032950183 2185 dbSNP
rs1188481630 2188 dbSNP
rs538533582 2191 dbSNP
rs1173307869 2192 dbSNP
rs908221104 2193 dbSNP
rs772898362 2196 dbSNP
rs1192193378 2197 dbSNP
rs550165559 2198 dbSNP
rs79869762 2199 dbSNP
rs1209402654 2200 dbSNP
rs74990748 2201 dbSNP
rs1487640037 2216 dbSNP
rs1395192712 2226 dbSNP
rs939709241 2228 dbSNP
rs971473284 2233 dbSNP
rs1225240449 2234 dbSNP
rs1277474166 2234 dbSNP
rs1332256649 2234 dbSNP
rs981599298 2235 dbSNP
rs568063756 2241 dbSNP
rs1385832344 2242 dbSNP
rs72659527 2244 dbSNP
rs5892570 2245 dbSNP
rs80083030 2245 dbSNP
rs766090572 2251 dbSNP
rs397692769 2253 dbSNP
rs202237947 2254 dbSNP
rs869292017 2254 dbSNP
rs200107708 2255 dbSNP
rs1240239101 2262 dbSNP
rs932448317 2263 dbSNP
rs985433713 2268 dbSNP
rs909503176 2269 dbSNP
rs1319654452 2270 dbSNP
rs1362875952 2276 dbSNP
rs1193947622 2277 dbSNP
rs941029967 2278 dbSNP
rs1443047842 2279 dbSNP
rs1256036864 2287 dbSNP
rs1039349096 2290 dbSNP
rs1049555168 2294 dbSNP
rs1464190666 2303 dbSNP
rs1304212301 2307 dbSNP
rs1310989501 2308 dbSNP
rs1447062713 2312 dbSNP
rs1376547313 2314 dbSNP
rs1330645725 2317 dbSNP
rs751690903 2323 dbSNP
rs1327293058 2328 dbSNP
rs893694632 2330 dbSNP
rs1010795431 2333 dbSNP
rs899559990 2342 dbSNP
rs933750037 2344 dbSNP
rs1050927817 2351 dbSNP
rs1432929860 2356 dbSNP
rs1382322874 2361 dbSNP
rs1021312784 2362 dbSNP
rs1159408783 2364 dbSNP
rs1262781876 2369 dbSNP
rs1439334305 2373 dbSNP
rs1232046535 2377 dbSNP
rs1179440875 2379 dbSNP
rs902994504 2383 dbSNP
rs147254076 2389 dbSNP
rs148714232 2390 dbSNP
rs1266649022 2393 dbSNP
rs1035777006 2399 dbSNP
rs1287555235 2401 dbSNP
rs1240356953 2402 dbSNP
rs1352567264 2412 dbSNP
rs572206385 2431 dbSNP
rs186200375 2433 dbSNP
rs558031577 2434 dbSNP
rs748727297 2448 dbSNP
rs1341505415 2460 dbSNP
rs1334079871 2461 dbSNP
rs756671501 2471 dbSNP
rs760233472 2476 dbSNP
rs893096571 2480 dbSNP
rs1023154730 2481 dbSNP
rs1012882663 2486 dbSNP
rs576112036 2491 dbSNP
rs971442181 2492 dbSNP
rs984375766 2499 dbSNP
rs543418652 2509 dbSNP
rs200392111 2515 dbSNP
rs1473651171 2521 dbSNP
rs1026428765 2525 dbSNP
rs1187062562 2530 dbSNP
rs1484661869 2531 dbSNP
rs543713492 2534 dbSNP
rs189733940 2544 dbSNP
rs1457458289 2545 dbSNP
rs1281681467 2546 dbSNP
rs141599515 2547 dbSNP
rs1357417470 2551 dbSNP
rs1283988404 2552 dbSNP
rs541852993 2553 dbSNP
rs1342972567 2554 dbSNP
rs1462927495 2565 dbSNP
rs1326559065 2566 dbSNP
rs1325695620 2577 dbSNP
rs1343575379 2577 dbSNP
rs1406183887 2577 dbSNP
rs140993242 2577 dbSNP
rs922322320 2578 dbSNP
rs1390098178 2580 dbSNP
rs560103108 2581 dbSNP
rs1425657291 2583 dbSNP
rs1049526107 2591 dbSNP
rs1336526075 2593 dbSNP
rs920949611 2605 dbSNP
rs933691975 2608 dbSNP
rs1451870949 2617 dbSNP
rs915056982 2620 dbSNP
rs1337471118 2623 dbSNP
rs1051271682 2630 dbSNP
rs946572684 2640 dbSNP
rs1212164067 2650 dbSNP
rs1042299886 2655 dbSNP
rs1320466357 2662 dbSNP
rs1279321687 2671 dbSNP
rs386473197 2674 dbSNP
rs774649743 2676 dbSNP
rs1054291554 2677 dbSNP
rs1330703995 2678 dbSNP
rs893026154 2686 dbSNP
rs552204674 2703 dbSNP
rs1252080630 2705 dbSNP
rs564710690 2705 dbSNP
rs370929993 2706 dbSNP
rs895876909 2713 dbSNP
rs1416743267 2715 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8 PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714642
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000521891.2 | 3UTR | CUUUAUCAACAUUUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000521891.2 | 3UTR | UAUUAUCUUUAUCAACAUUUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.462 1.2e-2 -0.115 3.0e-1 24 Click to see details
GSE19783 ER- ER- breast cancer -0.241 1.6e-2 -0.296 4.0e-3 79 Click to see details
GSE19536 Breast cancer -0.21 1.8e-2 -0.242 7.6e-3 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.425 2.2e-2 -0.424 2.2e-2 23 Click to see details
GSE38226 Liver fibrosis -0.436 2.4e-2 -0.342 6.5e-2 21 Click to see details
GSE21032 Prostate cancer 0.18 5.2e-2 0.144 9.7e-2 83 Click to see details
GSE14794 Lymphoblastoid cells 0.145 8.6e-2 0.082 2.2e-1 90 Click to see details
GSE17498 Multiple myeloma 0.21 9.7e-2 0.112 2.5e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.385 9.7e-2 -0.253 2.0e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.2 1.4e-1 0.135 2.3e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.225 1.4e-1 -0.310 6.6e-2 25 Click to see details
GSE27834 Pluripotent stem cells 0.278 1.5e-1 0.168 2.7e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.21 1.6e-1 0.318 6.1e-2 25 Click to see details
GSE19350 CNS germ cell tumors 0.192 2.7e-1 0.315 1.6e-1 12 Click to see details
GSE17306 Multiple myeloma -0.082 2.9e-1 -0.084 2.8e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer 0.091 3.5e-1 -0.011 4.8e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.056 4.0e-1 0.091 3.4e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.044 4.3e-1 0.165 2.4e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.009 4.7e-1 0.005 4.8e-1 64 Click to see details
GSE21849 B cell lymphoma 0.006 4.9e-1 0.403 1.5e-2 29 Click to see details
GSE21849 B cell lymphoma 0.006 4.9e-1 0.403 1.5e-2 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.602 0 -0.631 0 32 Click to see details
BLCA -0.655 0 -0.612 0 18 Click to see details
KICH 0.422 0.02 0.498 0.01 25 Click to see details
LIHC 0.274 0.03 0.177 0.11 49 Click to see details
PAAD -0.839 0.08 -0.400 0.3 4 Click to see details
CHOL -0.502 0.08 -0.400 0.14 9 Click to see details
COAD -0.455 0.13 -0.524 0.09 8 Click to see details
LUAD 0.259 0.21 0.252 0.21 12 Click to see details
KIRC -0.093 0.23 -0.117 0.17 68 Click to see details
THCA -0.099 0.23 -0.107 0.21 59 Click to see details
BRCA 0.08 0.23 -0.028 0.4 84 Click to see details
CESC -0.59 0.3 -0.500 0.33 3 Click to see details
PCPG -0.524 0.32 -0.500 0.33 3 Click to see details
UCEC 0.079 0.37 0.056 0.41 19 Click to see details
ESCA -0.098 0.39 -0.091 0.4 11 Click to see details
LUSC -0.028 0.43 -0.056 0.37 38 Click to see details
PRAD 0.024 0.43 0.133 0.18 50 Click to see details
HNSC -0.023 0.44 -0.010 0.47 42 Click to see details
KIRP 0.006 0.49 -0.029 0.44 32 Click to see details
KIRP 0.006 0.49 -0.029 0.44 32 Click to see details
KIRP 0.006 0.49 -0.029 0.44 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
Your e-Mail*