miRTarBase - #MIRT099631 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol E2F3   
Synonyms E2F-3
Description E2F transcription factor 3
Transcript NM_001949   
Expression
Putative miRNA Targets on E2F3
3'UTR of E2F3
(miRNA target sites are highlighted)
>E2F3|NM_001949|3'UTR
   1 TTATGCTTCGTGTGAACTCTCCTTAAAAACCGATATTTTTTTATCATGGAACCAGAACATCTGTCATGCAGTGTTGTCCC
  81 TTCCTACCTTCTTCCTCCAAGAGAGTATCATGAAGTAAACTACAAACTTCAGAAGAAAGCTGACATTTTAATGAATTTTT
 161 TAAAAAATTAATAAACAAATTGTCTAAACGCACAGTTGCAGGCTCCCTTGGGAAAGCCCTGCTTTGCTCCAGGCTCCAAG
 241 ATCTCCTGGCTAAGTCAGCAAGTGAGAAAATGTGCAATCAGGTGTCTCTCACCCCGAATTGTCCTTCCTCCTTCCTCCCC
 321 GGATTGGCTTGCTGTGCCTGACGGATGGGCTGTAGAATGGGGTCTGGCCACCTGGCCTGCTGGGAAACAGCAATCTTCCT
 401 TAATAGCATTTCAAGCCGTGCCTTCTCCGCAGAATGCATGTCTTTGAGGTCTGCTAATATGGAATGGAACTGCAGCAAAT
 481 GCAAACTTGAAGTCATGCAAAAGTATGAAATGGATTTCTTCAGCTCTTCTTAGGAATATTTAAATTACTGTCATAATTCA
 561 GTTTAAGCTATGAACTGTGTGTCCCAGTAGGAGGTCAAGAAAACCTCCACAGCCTTCTGGATGAAGAACCTGTTTTCAAA
 641 TATACTTGTTGCAGATACAGAAGACTAGTAGAGTTCTGCCACTCTAAGCTGTTGTGGATTTTCCTGTCTCCATGAACCAC
 721 TCCCATTCCCCCGTCCCCAATGTGTTTGTGAGTTTCCAGTTGATTTGTAGCAAATGCCTACTTAGTTCTTTGTGGATTGT
 801 TCTAGACTTTTAATTTTTTTAGCTGCCATTTAAGCATTCCTGTGGCACCCATCACCATTTCAATTTAATTGTTTACTTTG
 881 AAGCGGTTTTTGCAAATTCATATTACTTAAGCAGAGGGAGAGAACCTCTACTGATCAGAGCATCTAAACCTGTGTGATCT
 961 AAGGTTTATCAGCCTCTGCAAGGAGCTTTGTCCCATCGTGCTTCCATTCCCAGGAGGGGGAGCTTGGAGCGAGTCAGTCC
1041 TGGGGCTTGCTGACATGGGTGGCCCATTGGAAAGGAGAACCAGGTCAGATGATGTAACAGCCCCAAGGAGCAGCAGGCAT
1121 GGGTCCCTCCATCCTTGGGCTTCCCGGGCCCCTGTGACAGGGGAAAGGGCTCTCTTACACCGCACTCAGGGAGACCACTT
1201 CTCAGGATGGGGTCAGATGGAGAGACCTCTAGGGAGAAAGACATCCCCATTGTGTGAGTGGCATTTCCTTAAGCTGGCAG
1281 GAACAGGGAGCAGCCCTGTGTCGGGGGCTGGAATAGTTCTGGCCAGACCCCGTTCCCCTTCCTCTATGAAGGAATAAGTT
1361 GGACCAAGGGAAGTCGGGGACGTAAAAAATGAAGCAAAACAATGCCAGGGTGTCTCCCGCTTTACTCTTCAGGAATGGTG
1441 TCCCAAGTTGGAGGCTTTGTGTCAGCTGCAAATCCTACCAGTTATGTCCAAGAATGGCTTTCCCTCGGGCAGGTGGCAGC
1521 GGCCATCTCCCACTGGGAATATGGCGTAGTATCTCCGGTCCATTCCTTGGATGCTAAGGACTGCGGGAATGAGGGAGTCA
1601 GATAAAGAACAAACCTCGAAACGAACAGTTAAATTGAAATGCTATGTGCCTGACCCAATGGTAGGCACATAGTAGGCACT
1681 CAACTCATATGTTTAATTGAATTGAAAATATCCCTTAGGAAAAAAAAAAAACACACAAAAAACCACAAGAGCCCCAGCCA
1761 GTTTACTCCAGGTAGATTTCCACAATATGCAAAGTGGTGGTGGGGTCAAGACAGATGACACCAGCACTTTAAACTCTTTG
1841 TGTGGGTATGCGTGGGTGTATGTTTGGGAAGAAAAACAAAGGTGCAGACTATCTTCCTTTTTTTCTTCTTCAGCCTCCAT
1921 CCCTGGCCTCCTCCCCTCACACACACTGGACTTGGTACAAAATGTCGGTGTGGTCCTAGATGAAGCATTGGGGTGGGGGA
2001 GGGAGAGGGAGCTTTGTGTTAAGTGCCTACTGGAAATGCACTGTGGGGTTTTTTCCTGTATGGGAAACCATTTATGCCAA
2081 GCTTTTCCCCATTTCCCATATTTATCTCATCTGGTTAGCTGCCTCTGCTTCCAGCTTTGTGTAATTCTCTTTGCCAGCTG
2161 CACAAAGCTGATTTTTTCCAAAGTCTAAAGACTGAGCTCACCTGGCTAGATTGTTGTGTGTTTTGTTGAATTTTTTCATA
2241 ATGTAATGCCGTATTTATTGTTTTTAAAATGAAAGGAATACTAATAAGTCTTAAAAGTTCCTTCATGCATAAGATTTTTT
2321 TCCAGTTACTGGGTTTAACTGGTGTACATTAATTAGATGTCCATACTGTATTTTGTTTGCATTAAGTAATTTTCTTTTTG
2401 ACTTAGTATCCGGCACACAAAGTGGGTTAGTACTACAGTATTTGCGTTACTTTAAGTACTAAGTATGCAGGTTTCCTGGT
2481 ACCATTGAGTTGCTGCTATTAAAGCTCACACACGAAATGGCTAAAAGTTACAAGTGTGCAAATTATGACTGCGTGAGCCT
2561 TAGAAAATAAAATGTATAAAGGGCAACACATGAGCTGTCAAACAGTGTTAGGAGTGTGTTTATATGTACAGAGTTGTGCA
2641 TAGCAATCGTTTTATTTAAGTTGATATGTAGTCTACTCACATTTTCATTATTTAGCAATTTTGTACAAAAATAGCAATTA
2721 ATTTGTAAACACTGCCAGAATACTTTCTAGCTGCTTTGTAATTTTTTAAGAGTGTTATTTTGTTTTTGTTTTTCTGTTCT
2801 TTGTTGTGGCTCTTGTTTTCATTTTTGTTGTACGTGTAGATCTGTAAATAAAATTGCAGTATTTAAAGCTTAAGCTTTCA
2881 GGAAAAAGAAAATAAGAATTCAGTGTGTGCATGACAACTCGTGTGTATGAGAAGGAGGGATATGAAGGAAGATGGCTTGC
2961 AGAGTAAGTCGGGTGGCAATTGTCAGGGTGTGGGAATTTCTTTTCCTACGGGGTACGTGATTTTGTAAAAAGGAAGTATT
3041 TCTCCCAAAATTGGGAGTAGGCAAACTACTAATCAGTTTAGCTTTGTGTTGTATGCTAGTTTAAAAAAGAAAATATGTAA
3121 TATAATGTAAAAAAAAACAAAAAAAAGCTTTTATGATGGATTTTGTAAATAGATTTGTTACAGGGTGACCTGTTCTCTAG
3201 CTGTGATCTTACCACTTCAAATGGGTGTAATTTGAATAAATTTTGTATGGTAAAGGATCAATAAAATGATTTTTTTTAAG
3281 AGTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUAC-ACGACGAu 5'
               ||||||: | ||||||| 
Target 5' ctggtACCATTGAGTTGCTGCTa 3'
2476 - 2498 165.00 -18.60
2
miRNA  3' guGUUUGGUAAUACA-CGACGAu 5'
            ||:| :| | | | |||||| 
Target 5' gcCAGAATACTTTCTAGCTGCTt 3'
2734 - 2756 128.00 -10.60
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            |||| :| ||  ||:|||  
Target 5' ttCAAA-TA-TACTTGTTGCag 3'
635 - 654 118.00 -6.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26974419 10 COSMIC
COSN14211145 11 COSMIC
COSN29840172 13 COSMIC
COSN31544974 32 COSMIC
COSN26974417 43 COSMIC
COSN30494068 43 COSMIC
COSN31513244 74 COSMIC
COSN30160857 102 COSMIC
COSN30468939 110 COSMIC
COSN30118943 133 COSMIC
COSN30464428 136 COSMIC
COSN30136784 156 COSMIC
COSN30186334 180 COSMIC
COSN5086288 212 COSMIC
COSN31590396 408 COSMIC
COSN21830139 578 COSMIC
COSN28679858 595 COSMIC
COSN31589538 611 COSMIC
COSN26577245 613 COSMIC
COSN31600769 669 COSMIC
COSN31563724 733 COSMIC
COSN31517906 789 COSMIC
COSN31544721 841 COSMIC
COSN31609187 866 COSMIC
COSN19008156 889 COSMIC
COSN31556649 901 COSMIC
COSN31564499 1006 COSMIC
COSN30545352 1084 COSMIC
COSN17331638 1155 COSMIC
COSN26509206 1170 COSMIC
COSN30165594 1183 COSMIC
COSN31607202 1376 COSMIC
COSN31594832 1383 COSMIC
COSN20628448 1469 COSMIC
COSN8513790 1571 COSMIC
COSN17658989 1618 COSMIC
COSN31482346 1637 COSMIC
COSN31610871 1731 COSMIC
COSN1329678 1732 COSMIC
COSN7866661 2049 COSMIC
COSN31557426 2154 COSMIC
COSN31537787 2413 COSMIC
COSN24301602 2495 COSMIC
COSN31545245 2584 COSMIC
COSN31545067 2596 COSMIC
COSN31482718 2687 COSMIC
COSN31555947 2709 COSMIC
COSN31606713 2767 COSMIC
COSN20091347 2791 COSMIC
COSN30161554 2826 COSMIC
COSN30541308 2835 COSMIC
COSN27681562 2844 COSMIC
COSN27683692 2847 COSMIC
COSN31489201 2902 COSMIC
COSN31590524 3018 COSMIC
COSN30540381 3097 COSMIC
COSN19662907 3128 COSMIC
COSN19660895 3129 COSMIC
COSN31532649 3138 COSMIC
COSN18854244 3139 COSMIC
COSN20102454 3139 COSMIC
COSN31596629 3140 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773227029 2 dbSNP
rs1226978922 3 dbSNP
rs750584037 3 dbSNP
rs1292211695 6 dbSNP
rs746883408 10 dbSNP
rs771049572 11 dbSNP
rs1256214385 13 dbSNP
rs759177070 22 dbSNP
rs1358425079 25 dbSNP
rs759892274 32 dbSNP
rs199852126 33 dbSNP
rs756538936 33 dbSNP
rs765548421 34 dbSNP
rs1248478834 35 dbSNP
rs780275342 35 dbSNP
rs1425694447 36 dbSNP
rs749610635 36 dbSNP
rs191550792 46 dbSNP
rs763387191 47 dbSNP
rs566721808 56 dbSNP
rs56364223 66 dbSNP
rs1474606537 87 dbSNP
rs1459293870 103 dbSNP
rs1194953661 106 dbSNP
rs1028632619 108 dbSNP
rs954347697 124 dbSNP
rs1008502425 125 dbSNP
rs1030771919 129 dbSNP
rs140174545 144 dbSNP
rs989028146 155 dbSNP
rs1338079085 156 dbSNP
rs1391813139 156 dbSNP
rs1400453674 162 dbSNP
rs558655818 162 dbSNP
rs576846225 168 dbSNP
rs4134983 169 dbSNP
rs1459480645 173 dbSNP
rs980321710 181 dbSNP
rs1342482054 190 dbSNP
rs927517720 191 dbSNP
rs182906095 199 dbSNP
rs1194831612 200 dbSNP
rs1057441109 218 dbSNP
rs1265850508 226 dbSNP
rs1193462636 227 dbSNP
rs1489147722 228 dbSNP
rs535500716 230 dbSNP
rs1278160464 232 dbSNP
rs1315681105 234 dbSNP
rs1259652389 262 dbSNP
rs1218988965 274 dbSNP
rs1299049691 277 dbSNP
rs1388466593 296 dbSNP
rs1368321469 297 dbSNP
rs907989682 300 dbSNP
rs186978420 305 dbSNP
rs1402704619 313 dbSNP
rs1247514416 321 dbSNP
rs764084652 322 dbSNP
rs1376307995 323 dbSNP
rs1265655729 328 dbSNP
rs1037546149 330 dbSNP
rs1407980908 333 dbSNP
rs1177451012 335 dbSNP
rs751571493 343 dbSNP
rs1207714000 344 dbSNP
rs1240281392 355 dbSNP
rs1198918356 362 dbSNP
rs1460664961 363 dbSNP
rs866450335 371 dbSNP
rs1235235080 372 dbSNP
rs1488349402 375 dbSNP
rs1306265780 377 dbSNP
rs931911800 383 dbSNP
rs1379254365 394 dbSNP
rs1192829379 418 dbSNP
rs1452208862 419 dbSNP
rs542072016 429 dbSNP
rs556692128 430 dbSNP
rs1363702909 433 dbSNP
rs1008556509 435 dbSNP
rs1437234877 437 dbSNP
rs1165138575 438 dbSNP
rs1367694820 440 dbSNP
rs1178800016 450 dbSNP
rs1457553600 471 dbSNP
rs1253722144 478 dbSNP
rs1201942675 480 dbSNP
rs1483479741 507 dbSNP
rs1285176028 511 dbSNP
rs1161942289 518 dbSNP
rs1031076652 527 dbSNP
rs1310087576 527 dbSNP
rs1245425272 537 dbSNP
rs892222800 545 dbSNP
rs1011031840 551 dbSNP
rs1396941441 553 dbSNP
rs1021808219 573 dbSNP
rs572345281 578 dbSNP
rs575132721 580 dbSNP
rs1362510127 612 dbSNP
rs968904066 622 dbSNP
rs1361818252 623 dbSNP
rs191402559 658 dbSNP
rs1034640365 659 dbSNP
rs960273097 659 dbSNP
rs1189231870 660 dbSNP
rs1398307271 663 dbSNP
rs1313807614 664 dbSNP
rs992853187 695 dbSNP
rs1321518328 702 dbSNP
rs1489229895 705 dbSNP
rs1242111130 707 dbSNP
rs1209297186 710 dbSNP
rs564632005 714 dbSNP
rs531681460 729 dbSNP
rs4134984 733 dbSNP
rs183649544 734 dbSNP
rs940806296 741 dbSNP
rs1326156281 749 dbSNP
rs973866112 761 dbSNP
rs920665413 768 dbSNP
rs1283271969 779 dbSNP
rs1341665767 781 dbSNP
rs931838156 783 dbSNP
rs1182402963 788 dbSNP
rs1387977949 800 dbSNP
rs755216364 806 dbSNP
rs1050214261 807 dbSNP
rs1421882036 811 dbSNP
rs530017043 814 dbSNP
rs890405747 815 dbSNP
rs1181951216 821 dbSNP
rs1478710445 827 dbSNP
rs1263773334 842 dbSNP
rs1382456077 843 dbSNP
rs779212686 847 dbSNP
rs1449884422 852 dbSNP
rs944586815 854 dbSNP
rs1158051118 855 dbSNP
rs1052108463 862 dbSNP
rs1256463627 867 dbSNP
rs1220825052 871 dbSNP
rs1319075215 872 dbSNP
rs1343521164 884 dbSNP
rs892101153 885 dbSNP
rs1328783548 886 dbSNP
rs1010559047 888 dbSNP
rs1386909119 889 dbSNP
rs1303962662 900 dbSNP
rs187910150 916 dbSNP
rs1466952640 924 dbSNP
rs904941451 927 dbSNP
rs772446034 932 dbSNP
rs1377100316 937 dbSNP
rs1477002823 938 dbSNP
rs1379366036 939 dbSNP
rs1432552405 949 dbSNP
rs1457408232 951 dbSNP
rs566758940 952 dbSNP
rs527511531 953 dbSNP
rs1236541634 960 dbSNP
rs1200782597 975 dbSNP
rs1458450844 979 dbSNP
rs1278368089 981 dbSNP
rs552061012 991 dbSNP
rs960283091 993 dbSNP
rs1276015538 995 dbSNP
rs1234346784 998 dbSNP
rs993466309 1012 dbSNP
rs570543556 1017 dbSNP
rs537505973 1018 dbSNP
rs556130215 1019 dbSNP
rs1313475713 1031 dbSNP
rs751465698 1031 dbSNP
rs920716222 1032 dbSNP
rs1255395568 1040 dbSNP
rs1482143400 1041 dbSNP
rs1200372828 1046 dbSNP
rs932057664 1052 dbSNP
rs1180672049 1082 dbSNP
rs1440547453 1083 dbSNP
rs985934420 1085 dbSNP
rs911686262 1086 dbSNP
rs944658216 1092 dbSNP
rs369329259 1095 dbSNP
rs1279908486 1099 dbSNP
rs1216546175 1101 dbSNP
rs1052811138 1104 dbSNP
rs1440488289 1109 dbSNP
rs913802483 1111 dbSNP
rs1178280847 1118 dbSNP
rs1373589073 1120 dbSNP
rs1283285062 1121 dbSNP
rs567765034 1123 dbSNP
rs756498022 1130 dbSNP
rs1435019480 1136 dbSNP
rs1177395534 1141 dbSNP
rs1359163989 1146 dbSNP
rs193045881 1147 dbSNP
rs1043404996 1159 dbSNP
rs1413311104 1173 dbSNP
rs1180371486 1177 dbSNP
rs904953086 1181 dbSNP
rs1238421975 1182 dbSNP
rs1401512908 1183 dbSNP
rs1309440995 1184 dbSNP
rs1001916911 1187 dbSNP
rs1288854286 1196 dbSNP
rs1487589202 1196 dbSNP
rs1218136837 1207 dbSNP
rs554075842 1213 dbSNP
rs778227610 1223 dbSNP
rs1055993959 1230 dbSNP
rs1358122792 1235 dbSNP
rs572380681 1236 dbSNP
rs185351691 1245 dbSNP
rs1338311913 1246 dbSNP
rs1300010152 1249 dbSNP
rs4134985 1250 dbSNP
rs1220404508 1251 dbSNP
rs1015613846 1252 dbSNP
rs1349396787 1264 dbSNP
rs1162870634 1273 dbSNP
rs962314975 1278 dbSNP
rs576489430 1294 dbSNP
rs995278674 1304 dbSNP
rs1027577764 1316 dbSNP
rs1477073922 1319 dbSNP
rs543504487 1326 dbSNP
rs986153645 1332 dbSNP
rs562156542 1333 dbSNP
rs966296438 1343 dbSNP
rs987990972 1345 dbSNP
rs913841617 1347 dbSNP
rs189929537 1348 dbSNP
rs946621123 1352 dbSNP
rs1215098685 1359 dbSNP
rs1424752313 1368 dbSNP
rs1291849699 1375 dbSNP
rs1043416905 1376 dbSNP
rs1395466372 1376 dbSNP
rs926256158 1377 dbSNP
rs541416153 1382 dbSNP
rs770466832 1383 dbSNP
rs896217449 1384 dbSNP
rs560471133 1390 dbSNP
rs1014874352 1403 dbSNP
rs375068453 1415 dbSNP
rs1292375880 1419 dbSNP
rs1343118882 1420 dbSNP
rs1036521515 1421 dbSNP
rs1220345109 1425 dbSNP
rs1469453296 1437 dbSNP
rs776063248 1439 dbSNP
rs1278810085 1443 dbSNP
rs1317048414 1446 dbSNP
rs898078015 1449 dbSNP
rs995010112 1454 dbSNP
rs1027628681 1467 dbSNP
rs1205037282 1477 dbSNP
rs527559660 1485 dbSNP
rs181590088 1486 dbSNP
rs541918297 1491 dbSNP
rs1007498226 1507 dbSNP
rs1371855181 1508 dbSNP
rs1308735727 1511 dbSNP
rs1019488005 1512 dbSNP
rs1222618776 1519 dbSNP
rs966147066 1522 dbSNP
rs1299088246 1540 dbSNP
rs1465898939 1543 dbSNP
rs988388470 1546 dbSNP
rs139667103 1547 dbSNP
rs572737857 1557 dbSNP
rs979316507 1561 dbSNP
rs1196446285 1575 dbSNP
rs1264608978 1585 dbSNP
rs1437426179 1586 dbSNP
rs531531614 1600 dbSNP
rs1482827538 1604 dbSNP
rs775238500 1610 dbSNP
rs937682403 1616 dbSNP
rs1166444920 1618 dbSNP
rs1416425215 1619 dbSNP
rs991819432 1623 dbSNP
rs1405538377 1625 dbSNP
rs917690216 1634 dbSNP
rs1308029366 1638 dbSNP
rs939750999 1647 dbSNP
rs1377467296 1650 dbSNP
rs1305052684 1655 dbSNP
rs1435890824 1659 dbSNP
rs762788898 1661 dbSNP
rs1363129445 1673 dbSNP
rs1360517801 1681 dbSNP
rs1036940521 1683 dbSNP
rs1417371860 1687 dbSNP
rs1298717807 1688 dbSNP
rs897970445 1691 dbSNP
rs1182116676 1718 dbSNP
rs1422977572 1718 dbSNP
rs1029182658 1720 dbSNP
rs1332684130 1720 dbSNP
rs747112786 1720 dbSNP
rs930909223 1721 dbSNP
rs1049328510 1731 dbSNP
rs1491049039 1731 dbSNP
rs549503893 1731 dbSNP
rs879099108 1732 dbSNP
rs1428568660 1733 dbSNP
rs567797275 1737 dbSNP
rs1007550693 1743 dbSNP
rs4134986 1747 dbSNP
rs35111005 1749 dbSNP
rs1229075892 1750 dbSNP
rs1291382891 1754 dbSNP
rs1357359491 1760 dbSNP
rs553321334 1761 dbSNP
rs1158727573 1767 dbSNP
rs1457098771 1771 dbSNP
rs749381101 1773 dbSNP
rs901928066 1775 dbSNP
rs1166799333 1781 dbSNP
rs1009633207 1794 dbSNP
rs1262340503 1801 dbSNP
rs1446873786 1804 dbSNP
rs561508460 1807 dbSNP
rs1380320312 1824 dbSNP
rs1262528312 1835 dbSNP
rs1209389746 1836 dbSNP
rs1487618133 1837 dbSNP
rs1191695573 1839 dbSNP
rs183947206 1840 dbSNP
rs1317720689 1842 dbSNP
rs1473354683 1847 dbSNP
rs1221016335 1853 dbSNP
rs1180901907 1857 dbSNP
rs1327608870 1862 dbSNP
rs188385499 1864 dbSNP
rs1420982223 1866 dbSNP
rs1388096574 1874 dbSNP
rs1327539551 1883 dbSNP
rs1461728886 1886 dbSNP
rs1158661339 1893 dbSNP
rs1422676871 1895 dbSNP
rs1168371923 1898 dbSNP
rs562213888 1898 dbSNP
rs979243026 1903 dbSNP
rs1398837051 1906 dbSNP
rs1336133372 1909 dbSNP
rs1359500309 1911 dbSNP
rs1447085269 1912 dbSNP
rs4134987 1913 dbSNP
rs1380778644 1914 dbSNP
rs1033634104 1915 dbSNP
rs529375562 1916 dbSNP
rs991829293 1918 dbSNP
rs779170092 1920 dbSNP
rs558333687 1922 dbSNP
rs939784174 1923 dbSNP
rs576605115 1927 dbSNP
rs1340650468 1930 dbSNP
rs1274817472 1931 dbSNP
rs972480976 1934 dbSNP
rs761912445 1938 dbSNP
rs543981914 1942 dbSNP
rs1441189446 1944 dbSNP
rs1399184724 1948 dbSNP
rs1329032381 1950 dbSNP
rs1049213285 1964 dbSNP
rs1397080640 1966 dbSNP
rs180850030 1967 dbSNP
rs1241697877 1968 dbSNP
rs1441105085 1969 dbSNP
rs1194429416 1970 dbSNP
rs1439313977 1978 dbSNP
rs1178899097 1988 dbSNP
rs1236639950 1989 dbSNP
rs1184388916 1992 dbSNP
rs1438788251 1993 dbSNP
rs1278478926 2002 dbSNP
rs866694422 2005 dbSNP
rs1379117565 2010 dbSNP
rs1199260266 2013 dbSNP
rs574154470 2017 dbSNP
rs943585144 2020 dbSNP
rs1234462794 2038 dbSNP
rs1174230003 2040 dbSNP
rs1402903110 2049 dbSNP
rs1444053249 2050 dbSNP
rs1336148881 2056 dbSNP
rs1333363100 2061 dbSNP
rs1413839770 2075 dbSNP
rs1040798307 2085 dbSNP
rs1377272014 2087 dbSNP
rs1174324968 2090 dbSNP
rs1209043919 2091 dbSNP
rs748476997 2092 dbSNP
rs1449229610 2098 dbSNP
rs1009971341 2099 dbSNP
rs1277008364 2112 dbSNP
rs1021063402 2115 dbSNP
rs1486935550 2119 dbSNP
rs903934000 2121 dbSNP
rs541452906 2141 dbSNP
rs1332348687 2142 dbSNP
rs1335226057 2158 dbSNP
rs1281636248 2161 dbSNP
rs1225125163 2162 dbSNP
rs1351041314 2172 dbSNP
rs766472230 2187 dbSNP
rs753805799 2188 dbSNP
rs1237049628 2200 dbSNP
rs544644267 2206 dbSNP
rs1357264436 2209 dbSNP
rs184958522 2217 dbSNP
rs1399428903 2221 dbSNP
rs1343523622 2223 dbSNP
rs755092438 2226 dbSNP
rs190937838 2241 dbSNP
rs1413423177 2243 dbSNP
rs1161807104 2244 dbSNP
rs959276506 2247 dbSNP
rs545827310 2249 dbSNP
rs1419156114 2251 dbSNP
rs562787983 2252 dbSNP
rs1487640975 2255 dbSNP
rs750466715 2261 dbSNP
rs1223463477 2270 dbSNP
rs992064833 2277 dbSNP
rs1459400409 2279 dbSNP
rs1198856513 2282 dbSNP
rs35225726 2293 dbSNP
rs1231183578 2295 dbSNP
rs1249449188 2299 dbSNP
rs1343922119 2310 dbSNP
rs1217942904 2312 dbSNP
rs765326057 2325 dbSNP
rs748284638 2329 dbSNP
rs1042317 2335 dbSNP
rs1377716321 2337 dbSNP
rs57922460 2340 dbSNP
rs1431641758 2342 dbSNP
rs149773947 2345 dbSNP
rs549540677 2346 dbSNP
rs1174230718 2348 dbSNP
rs1170502457 2353 dbSNP
rs1425470177 2354 dbSNP
rs1422342792 2355 dbSNP
rs1465992329 2359 dbSNP
rs1245719347 2371 dbSNP
rs1475478697 2371 dbSNP
rs1211456172 2376 dbSNP
rs1469596002 2382 dbSNP
rs1273578188 2383 dbSNP
rs1171636578 2391 dbSNP
rs972790773 2403 dbSNP
rs919711701 2405 dbSNP
rs1305674676 2409 dbSNP
rs952430738 2411 dbSNP
rs1215193021 2412 dbSNP
rs561465783 2413 dbSNP
rs560743891 2415 dbSNP
rs1331784028 2419 dbSNP
rs1249050056 2430 dbSNP
rs747485409 2432 dbSNP
rs182027017 2446 dbSNP
rs1040659012 2447 dbSNP
rs766807450 2447 dbSNP
rs1320429135 2466 dbSNP
rs1356756329 2468 dbSNP
rs1171760556 2480 dbSNP
rs1409984742 2486 dbSNP
rs527963114 2490 dbSNP
rs1366400266 2491 dbSNP
rs187074627 2510 dbSNP
rs945438696 2512 dbSNP
rs1042771056 2514 dbSNP
rs1253295435 2515 dbSNP
rs1177745851 2521 dbSNP
rs1211292420 2523 dbSNP
rs1252946629 2529 dbSNP
rs1205146804 2531 dbSNP
rs903943809 2532 dbSNP
rs1278275533 2535 dbSNP
rs1267394354 2537 dbSNP
rs1308853884 2539 dbSNP
rs1000911597 2540 dbSNP
rs771357661 2541 dbSNP
rs112065694 2545 dbSNP
rs77872144 2546 dbSNP
rs747501848 2550 dbSNP
rs145742366 2553 dbSNP
rs894951039 2554 dbSNP
rs1478024248 2557 dbSNP
rs4134988 2575 dbSNP
rs1436090836 2581 dbSNP
rs1395273626 2583 dbSNP
rs745847670 2596 dbSNP
rs1417019806 2599 dbSNP
rs549615225 2599 dbSNP
rs757646504 2602 dbSNP
rs1485295516 2617 dbSNP
rs1165260521 2618 dbSNP
rs1366249095 2624 dbSNP
rs1255377648 2626 dbSNP
rs1213071336 2629 dbSNP
rs1348726818 2641 dbSNP
rs570309015 2647 dbSNP
rs60408508 2649 dbSNP
rs1026570396 2650 dbSNP
rs952483683 2650 dbSNP
rs1354082050 2660 dbSNP
rs985149294 2669 dbSNP
rs555963268 2674 dbSNP
rs1416042926 2680 dbSNP
rs1375531066 2681 dbSNP
rs745328770 2696 dbSNP
rs1287856063 2707 dbSNP
rs910959307 2712 dbSNP
rs1295247690 2715 dbSNP
rs1365239427 2725 dbSNP
rs1159531794 2731 dbSNP
rs769370298 2741 dbSNP
rs976656703 2744 dbSNP
rs1190008507 2758 dbSNP
rs1246499772 2759 dbSNP
rs79842081 2761 dbSNP
rs75902881 2763 dbSNP
rs1265715561 2770 dbSNP
rs191574805 2772 dbSNP
rs769686639 2776 dbSNP
rs577740898 2777 dbSNP
rs1358092926 2794 dbSNP
rs535204793 2797 dbSNP
rs4134989 2801 dbSNP
rs553431353 2804 dbSNP
rs1185891031 2810 dbSNP
rs1259361863 2813 dbSNP
rs1340514761 2818 dbSNP
rs577991553 2828 dbSNP
rs1294214516 2829 dbSNP
rs1380073549 2830 dbSNP
rs1386640066 2831 dbSNP
rs144083937 2834 dbSNP
rs571021462 2835 dbSNP
rs568802323 2837 dbSNP
rs1055243409 2841 dbSNP
rs1386168728 2844 dbSNP
rs1444238928 2845 dbSNP
rs1166914406 2850 dbSNP
rs1161683420 2856 dbSNP
rs1362558970 2857 dbSNP
rs1454728721 2859 dbSNP
rs1288842555 2863 dbSNP
rs1383236991 2865 dbSNP
rs895214264 2869 dbSNP
rs1013459338 2881 dbSNP
rs1312982890 2885 dbSNP
rs1046622156 2895 dbSNP
rs1381503140 2896 dbSNP
rs1243337204 2901 dbSNP
rs1467370342 2905 dbSNP
rs897073518 2911 dbSNP
rs1214774522 2918 dbSNP
rs1339281481 2921 dbSNP
rs528804010 2922 dbSNP
rs1353846203 2935 dbSNP
rs547168892 2946 dbSNP
rs564249216 2949 dbSNP
rs1026621298 2956 dbSNP
rs952412411 2958 dbSNP
rs768568055 2971 dbSNP
rs1484108931 2972 dbSNP
rs1018020311 2977 dbSNP
rs1395632397 2980 dbSNP
rs1166105853 2994 dbSNP
rs1463535030 2996 dbSNP
rs1200748955 3005 dbSNP
rs1242311217 3010 dbSNP
rs568666935 3011 dbSNP
rs965495428 3017 dbSNP
rs1182015287 3018 dbSNP
rs1437647870 3037 dbSNP
rs976283014 3084 dbSNP
rs576255311 3087 dbSNP
rs1159007131 3094 dbSNP
rs967002994 3098 dbSNP
rs978308592 3111 dbSNP
rs748907544 3117 dbSNP
rs543226128 3124 dbSNP
rs146499346 3126 dbSNP
rs1436868358 3128 dbSNP
rs1468036350 3128 dbSNP
rs754411000 3129 dbSNP
rs879698734 3129 dbSNP
rs925512077 3129 dbSNP
rs1438924089 3130 dbSNP
rs1405839305 3135 dbSNP
rs936678365 3135 dbSNP
rs1449973292 3136 dbSNP
rs878972635 3137 dbSNP
rs201254207 3138 dbSNP
rs990816209 3138 dbSNP
rs199794702 3139 dbSNP
rs79489313 3139 dbSNP
rs949460078 3139 dbSNP
rs1046249257 3147 dbSNP
rs1222773387 3149 dbSNP
rs1438875709 3154 dbSNP
rs896952937 3156 dbSNP
rs1313822142 3157 dbSNP
rs1233902686 3160 dbSNP
rs929814698 3179 dbSNP
rs1484415775 3182 dbSNP
rs767293643 3183 dbSNP
rs1281944383 3184 dbSNP
rs1262230601 3193 dbSNP
rs781575132 3211 dbSNP
rs1240983650 3221 dbSNP
rs1351001414 3233 dbSNP
rs1201989040 3246 dbSNP
rs1377369808 3250 dbSNP
rs1048324571 3258 dbSNP
rs888363260 3266 dbSNP
rs1006547470 3270 dbSNP
rs1160623821 3270 dbSNP
rs1470734067 3278 dbSNP
rs1417710244 3280 dbSNP
rs773235226 3281 dbSNP
rs1017859586 3282 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.742 2.5e-5 -0.647 4.2e-4 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.714 2.0e-4 0.856 7.4e-7 20 Click to see details
GSE21687 Ependynoma primary tumors -0.418 2.9e-4 -0.408 4.1e-4 64 Click to see details
GSE19783 ER- ER- breast cancer -0.316 2.3e-3 -0.309 2.8e-3 79 Click to see details
GSE19536 Breast cancer -0.272 3.1e-3 -0.284 2.1e-3 100 Click to see details
GSE32688 Pancreatic cancer 0.427 7.4e-3 0.275 6.4e-2 32 Click to see details
GSE14794 Lymphoblastoid cells -0.211 2.3e-2 -0.177 4.8e-2 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.329 5.4e-2 0.539 2.7e-3 25 Click to see details
GSE21032 Prostate cancer 0.173 5.9e-2 0.179 5.3e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.308 6.7e-2 0.413 2.0e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.317 8.7e-2 -0.397 4.2e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.238 1.3e-1 0.254 1.2e-1 24 Click to see details
GSE17498 Multiple myeloma -0.181 1.3e-1 -0.093 2.8e-1 40 Click to see details
GSE19350 CNS germ cell tumors -0.328 1.5e-1 -0.608 1.8e-2 12 Click to see details
GSE27834 Pluripotent stem cells -0.228 2.0e-1 -0.176 2.6e-1 16 Click to see details
GSE38226 Liver fibrosis 0.19 2.0e-1 0.076 3.7e-1 21 Click to see details
GSE21849 B cell lymphoma -0.158 2.1e-1 0.242 1.0e-1 29 Click to see details
GSE28260 Renal cortex and medulla -0.182 2.8e-1 -0.242 2.1e-1 13 Click to see details
GSE17306 Multiple myeloma -0.077 3.0e-1 -0.102 2.4e-1 49 Click to see details
GSE28544 Breast cancer 0.055 4.0e-1 0.380 3.4e-2 24 Click to see details
GSE28544 Breast cancer 0.055 4.0e-1 0.380 3.4e-2 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.33 0 0.313 0 68 Click to see details
STAD 0.39 0.01 0.404 0.01 32 Click to see details
HNSC 0.322 0.02 0.475 0 42 Click to see details
KIRP 0.234 0.1 0.187 0.15 32 Click to see details
COAD 0.374 0.18 0.119 0.39 8 Click to see details
PCPG -0.792 0.21 -0.500 0.33 3 Click to see details
THCA 0.093 0.24 0.001 0.5 59 Click to see details
ESCA 0.202 0.28 0.336 0.16 11 Click to see details
LUSC 0.097 0.28 0.175 0.15 38 Click to see details
BRCA 0.061 0.29 0.086 0.22 84 Click to see details
LUAD -0.147 0.32 -0.056 0.43 12 Click to see details
UCEC 0.099 0.34 0.179 0.23 19 Click to see details
LIHC 0.053 0.36 0.065 0.33 49 Click to see details
KICH 0.074 0.36 0.125 0.28 25 Click to see details
BLCA -0.081 0.37 0.053 0.42 18 Click to see details
PRAD -0.041 0.39 -0.139 0.17 50 Click to see details
CHOL 0.087 0.41 -0.017 0.48 9 Click to see details
PAAD 0.163 0.42 0.000 0.5 4 Click to see details
PAAD 0.163 0.42 0.000 0.5 4 Click to see details
CESC 1 0.5 1.000 0.5 3 Click to see details
CESC 1 0.5 1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*