miRTarBase - #MIRT098827 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PCMT1   
Synonyms PIMT
Description protein-L-isoaspartate (D-aspartate) O-methyltransferase
Transcript NM_005389   
Expression
Putative miRNA Targets on PCMT1
3'UTR of PCMT1
(miRNA target sites are highlighted)
>PCMT1|NM_005389|3'UTR
   1 TTTTATCTTCTGCTCTTTCTTCTTCCACACATGCAAGGGATGAATTGTAAAAGCAACATCAGCTTGACCAGTATAAAATT
  81 ACAGTGGATTGCTCATCTCAGTCCTCAAAGCTTTTTGAAAACCAACACCATCACAGCTTGTTTTGGACTTTGTTACACTG
 161 TTATTTTCAGCATGAAAATGTGTGTTTTTTTAGGGTTTCTGATTCTTCAAAGAGGCACAGAGCCAAATTGGTAGAGGAAG
 241 GATGCAAAGTATAAATTTGTGTAATATTACTTTAACATGCCCATATTTTACTTGGAAATATTAAAAGAAAGGGTTCTGTA
 321 AAATGGAAAACTTAGTTTGTGAATTGATTTTGAGGAGTGGTTTTTCTTTTCTTGGACACTTAATTCTGTTCTGATATTAA
 401 TTTATCAGATTGCTTTTGTGCATTGGATAACACCACCATTCACAAGTTAAGATTCTTGGTATTTGGATATCTGTTAGATG
 481 CTACTAAGAAAATAGAGATGAGCTTTCTTTTTAAAGCTTTTGATGTGGTGTCATAGAATAGCATGTTGTAGATACAATCA
 561 GCTGCTTTGTTACCTTAAAACTAGGCATTTGTAAATATTAAACCATAAGATGGCAGGTGATGTCCTGTAAACACTCAGCT
 641 GTTCAGATTGGACATAACTGACTTAGTTCTTCCCTTCTCTCTCTCTCAAAATTATAGGAGACTTGTAGTTTAGTGTGGTT
 721 TTCTGTTTCTAATTTGCTGCTGATAATGTATATGAACTTAACATGCTGTGTAAGCTGTGTCCTAGTTCTTGAACAGTTTA
 801 TGCAGTGCTGCTTTGCCAAATAAAGTTAAAAGTAAAAGAGGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU-AAUA---CACGACGAu 5'
            ::||| : ||||   |||||||| 
Target 5' ctTGAACAGTTTATGCAGTGCTGCTt 3'
788 - 813 160.00 -17.10
2
miRNA  3' guguuuGGUAA----UACACGACGAu 5'
                |::||    || ||||||| 
Target 5' ggttttCTGTTTCTAATTTGCTGCTg 3'
717 - 742 150.00 -10.60
3
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              | |::|||  |||| || 
Target 5' ggatATCTGTTAGATGCTACTa 3'
465 - 486 126.00 -7.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30537164 11 COSMIC
COSN30125886 16 COSMIC
COSN30131647 90 COSMIC
COSN19416234 98 COSMIC
COSN14201564 102 COSMIC
COSN30537120 119 COSMIC
COSN27262713 241 COSMIC
COSN27201550 244 COSMIC
COSN19196305 245 COSMIC
COSN27262705 245 COSMIC
COSN23491840 258 COSMIC
COSN23497706 259 COSMIC
COSN21146924 522 COSMIC
COSN14995325 902 COSMIC
COSN2147190 1139 COSMIC
COSN2147191 1201 COSMIC
COSN24913094 1690 COSMIC
COSN20795300 1836 COSMIC
COSN4919620 2392 COSMIC
COSN25724577 2982 COSMIC
COSN25924642 2991 COSMIC
COSN25829703 2998 COSMIC
COSN26456640 3259 COSMIC
COSN20181700 3360 COSMIC
COSN6308440 3426 COSMIC
COSN32112148 3502 COSMIC
COSN27424008 3621 COSMIC
COSN15911306 4110 COSMIC
COSN16283195 4349 COSMIC
COSN7694086 5255 COSMIC
COSN9497106 5962 COSMIC
COSN24012945 6612 COSMIC
COSN7694087 6888 COSMIC
COSN16044424 7245 COSMIC
COSN2147195 7770 COSMIC
COSN7694088 7818 COSMIC
COSN27173193 7892 COSMIC
COSN16922539 7902 COSMIC
COSN18718872 8077 COSMIC
COSN24398087 8115 COSMIC
COSN24398088 8139 COSMIC
COSN31489668 8304 COSMIC
COSN19025154 8376 COSMIC
COSN20054420 8391 COSMIC
COSN26419629 8396 COSMIC
COSN31519312 8405 COSMIC
COSN16525369 8455 COSMIC
COSN19661557 8805 COSMIC
COSN31519105 8972 COSMIC
COSN30176174 8991 COSMIC
rs2095375 4659 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1275404968 4 dbSNP
rs752074342 6 dbSNP
rs915047134 6 dbSNP
rs766040566 7 dbSNP
rs1051233629 10 dbSNP
rs769800622 14 dbSNP
rs777409467 14 dbSNP
rs1289825868 17 dbSNP
rs1490226699 20 dbSNP
rs201665205 21 dbSNP
rs778709538 23 dbSNP
rs562584727 26 dbSNP
rs758180199 29 dbSNP
rs113324257 40 dbSNP
rs777757580 47 dbSNP
rs1017331024 50 dbSNP
rs746959005 51 dbSNP
rs531594379 52 dbSNP
rs1036108942 62 dbSNP
rs1030080716 65 dbSNP
rs1169005821 70 dbSNP
rs147489372 71 dbSNP
rs997187394 73 dbSNP
rs1239685064 83 dbSNP
rs994431984 88 dbSNP
rs571422701 98 dbSNP
rs1266019262 99 dbSNP
rs1219884585 116 dbSNP
rs774383737 117 dbSNP
rs1274829576 123 dbSNP
rs148104760 126 dbSNP
rs1022533399 132 dbSNP
rs1337799352 137 dbSNP
rs968231639 161 dbSNP
rs999693002 166 dbSNP
rs1422605936 170 dbSNP
rs1031128124 181 dbSNP
rs960791303 182 dbSNP
rs959508714 184 dbSNP
rs992219589 185 dbSNP
rs1371410378 186 dbSNP
rs1307613299 196 dbSNP
rs990886296 201 dbSNP
rs1417100999 223 dbSNP
rs1174288467 229 dbSNP
rs199872961 229 dbSNP
rs915359062 230 dbSNP
rs1196656799 233 dbSNP
rs1473263559 233 dbSNP
rs968138688 233 dbSNP
rs1203972441 234 dbSNP
rs1281158607 235 dbSNP
rs978063149 235 dbSNP
rs1201586256 236 dbSNP
rs1281860431 236 dbSNP
rs59103152 236 dbSNP
rs3828703 237 dbSNP
rs750035704 238 dbSNP
rs79971268 240 dbSNP
rs370217600 241 dbSNP
rs397751421 241 dbSNP
rs62441336 241 dbSNP
rs376819310 242 dbSNP
rs1248814914 245 dbSNP
rs746501455 245 dbSNP
rs746933103 245 dbSNP
rs769662513 245 dbSNP
rs1335925244 246 dbSNP
rs1166500247 248 dbSNP
rs796525565 248 dbSNP
rs1174118340 249 dbSNP
rs1414755155 249 dbSNP
rs35626867 249 dbSNP
rs9393174 249 dbSNP
rs56146391 250 dbSNP
rs1447750829 251 dbSNP
rs567712796 253 dbSNP
rs3828704 255 dbSNP
rs1397721505 259 dbSNP
rs1188687338 260 dbSNP
rs1313437189 264 dbSNP
rs1442166276 273 dbSNP
rs1261840106 280 dbSNP
rs1211102851 287 dbSNP
rs1306836322 288 dbSNP
rs1225034027 296 dbSNP
rs1366745241 297 dbSNP
rs1381637502 298 dbSNP
rs189310179 301 dbSNP
rs1259719380 307 dbSNP
rs1024077512 310 dbSNP
rs1334651977 327 dbSNP
rs180944202 329 dbSNP
rs1051822306 330 dbSNP
rs1202588460 332 dbSNP
rs1388804050 336 dbSNP
rs556889923 337 dbSNP
rs969400401 343 dbSNP
rs1398385791 351 dbSNP
rs770376996 355 dbSNP
rs1415551397 361 dbSNP
rs1483908466 364 dbSNP
rs985133150 367 dbSNP
rs1038514269 376 dbSNP
rs909128973 386 dbSNP
rs1241655758 394 dbSNP
rs748286721 397 dbSNP
rs375896398 401 dbSNP
rs186460082 402 dbSNP
rs898894748 420 dbSNP
rs940560642 430 dbSNP
rs1192000438 434 dbSNP
rs994546850 440 dbSNP
rs538624783 450 dbSNP
rs1466354180 451 dbSNP
rs1436935956 455 dbSNP
rs558556268 455 dbSNP
rs1365843138 463 dbSNP
rs1357645512 470 dbSNP
rs1467701523 471 dbSNP
rs1303480688 474 dbSNP
rs572129348 476 dbSNP
rs1361236700 478 dbSNP
rs1351093422 490 dbSNP
rs1165090771 492 dbSNP
rs923067799 501 dbSNP
rs150609018 504 dbSNP
rs4870015 505 dbSNP
rs1419448711 510 dbSNP
rs1222528802 524 dbSNP
rs1260938811 527 dbSNP
rs1489527309 534 dbSNP
rs1012059145 535 dbSNP
rs1022156903 536 dbSNP
rs1489924744 536 dbSNP
rs968085420 539 dbSNP
rs574539054 558 dbSNP
rs947055221 567 dbSNP
rs572730848 568 dbSNP
rs1293595004 575 dbSNP
rs904098595 580 dbSNP
rs999746842 581 dbSNP
rs1363337268 587 dbSNP
rs1031180478 591 dbSNP
rs1309414198 600 dbSNP
rs1430851585 605 dbSNP
rs896635451 606 dbSNP
rs1169036288 607 dbSNP
rs1435412072 614 dbSNP
rs1426416879 615 dbSNP
rs1198793924 617 dbSNP
rs1478394067 617 dbSNP
rs543746099 623 dbSNP
rs1014113225 624 dbSNP
rs1483284227 640 dbSNP
rs1250546870 643 dbSNP
rs1435098379 644 dbSNP
rs1313898478 647 dbSNP
rs1176925067 648 dbSNP
rs1222407919 657 dbSNP
rs1289873986 662 dbSNP
rs1344635257 662 dbSNP
rs1417802265 663 dbSNP
rs1299887234 664 dbSNP
rs1361084553 667 dbSNP
rs1296823067 672 dbSNP
rs1376697049 673 dbSNP
rs1404167521 673 dbSNP
rs1467840333 673 dbSNP
rs869285396 673 dbSNP
rs1160023443 674 dbSNP
rs1167124413 674 dbSNP
rs1202909660 674 dbSNP
rs1202921058 674 dbSNP
rs1228409497 674 dbSNP
rs1269461815 674 dbSNP
rs1320877489 674 dbSNP
rs1336696690 674 dbSNP
rs1362314836 674 dbSNP
rs1380324397 674 dbSNP
rs1390997796 674 dbSNP
rs1398177713 674 dbSNP
rs1425373037 674 dbSNP
rs1451091080 674 dbSNP
rs1453068445 674 dbSNP
rs1466186382 674 dbSNP
rs1468345190 674 dbSNP
rs60853264 674 dbSNP
rs749296557 674 dbSNP
rs770820181 674 dbSNP
rs774636943 674 dbSNP
rs1281114996 675 dbSNP
rs1369330376 678 dbSNP
rs1219404263 679 dbSNP
rs1305695421 681 dbSNP
rs1314549925 686 dbSNP
rs868863854 686 dbSNP
rs1218163093 688 dbSNP
rs1267436188 689 dbSNP
rs1288859209 689 dbSNP
rs955581356 690 dbSNP
rs1488892253 691 dbSNP
rs61631591 692 dbSNP
rs1245307110 693 dbSNP
rs563221041 694 dbSNP
rs1489602761 695 dbSNP
rs969832156 696 dbSNP
rs1213340898 697 dbSNP
rs1367985233 698 dbSNP
rs1321766312 699 dbSNP
rs9689190 699 dbSNP
rs1382838168 700 dbSNP
rs1191932847 701 dbSNP
rs1458588468 702 dbSNP
rs13192997 704 dbSNP
rs905271770 705 dbSNP
rs35284077 706 dbSNP
rs36080452 707 dbSNP
rs1437979163 708 dbSNP
rs1160520073 709 dbSNP
rs1380892395 716 dbSNP
rs984799924 722 dbSNP
rs1162700218 726 dbSNP
rs1442504494 729 dbSNP
rs1423888998 730 dbSNP
rs987055804 732 dbSNP
rs1193780467 753 dbSNP
rs1445958092 755 dbSNP
rs1259055060 756 dbSNP
rs1016184086 761 dbSNP
rs1490415643 764 dbSNP
rs9688412 769 dbSNP
rs971926938 770 dbSNP
rs923126549 772 dbSNP
rs545022854 773 dbSNP
rs1374187731 778 dbSNP
rs933150293 794 dbSNP
rs1324817271 795 dbSNP
rs143472323 797 dbSNP
rs1387354939 799 dbSNP
rs1365221228 800 dbSNP
rs1309319128 815 dbSNP
rs986312914 816 dbSNP
rs1372142821 817 dbSNP
rs1168493697 818 dbSNP
rs368472089 819 dbSNP
rs1371211635 842 dbSNP
rs947079897 843 dbSNP
rs1288184346 844 dbSNP
rs1042746188 851 dbSNP
rs1484277814 856 dbSNP
rs886089120 863 dbSNP
rs1003651207 866 dbSNP
rs902815588 879 dbSNP
rs1338019248 890 dbSNP
rs77383328 902 dbSNP
rs764966555 914 dbSNP
rs1344938051 916 dbSNP
rs547562806 919 dbSNP
rs1456592019 933 dbSNP
rs1337372761 941 dbSNP
rs374668262 945 dbSNP
rs190415128 950 dbSNP
rs567893724 955 dbSNP
rs1238822869 958 dbSNP
rs1443954709 962 dbSNP
rs1052661825 986 dbSNP
rs1409088250 988 dbSNP
rs1394292567 995 dbSNP
rs530208102 1002 dbSNP
rs1174204380 1004 dbSNP
rs771145276 1009 dbSNP
rs752223697 1013 dbSNP
rs1469915654 1018 dbSNP
rs896687799 1021 dbSNP
rs146259808 1022 dbSNP
rs570381635 1023 dbSNP
rs1405802089 1026 dbSNP
rs1024180648 1027 dbSNP
rs1473374825 1031 dbSNP
rs905280908 1038 dbSNP
rs1181576561 1046 dbSNP
rs1006685587 1056 dbSNP
rs1016231909 1077 dbSNP
rs1204831625 1081 dbSNP
rs1323005747 1081 dbSNP
rs967913491 1098 dbSNP
rs1397726455 1106 dbSNP
rs1166588950 1110 dbSNP
rs1350283783 1112 dbSNP
rs1448484494 1117 dbSNP
rs1298945652 1120 dbSNP
rs1331469952 1123 dbSNP
rs999593037 1128 dbSNP
rs1333747662 1129 dbSNP
rs10675828 1131 dbSNP
rs57780375 1131 dbSNP
rs33946993 1132 dbSNP
rs1453264555 1133 dbSNP
rs1283013380 1134 dbSNP
rs145575324 1134 dbSNP
rs1031531684 1136 dbSNP
rs1359061199 1136 dbSNP
rs199745112 1139 dbSNP
rs955496469 1140 dbSNP
rs1229299609 1141 dbSNP
rs200775535 1142 dbSNP
rs201628671 1144 dbSNP
rs961995793 1146 dbSNP
rs544823918 1149 dbSNP
rs1200702487 1155 dbSNP
rs1157608490 1156 dbSNP
rs1468962050 1157 dbSNP
rs1239573475 1164 dbSNP
rs1184812943 1170 dbSNP
rs1461274913 1170 dbSNP
rs1018276770 1172 dbSNP
rs993399957 1186 dbSNP
rs1283888602 1187 dbSNP
rs564494565 1190 dbSNP
rs1348364266 1192 dbSNP
rs1316905035 1195 dbSNP
rs1460872430 1204 dbSNP
rs954736008 1212 dbSNP
rs985978639 1219 dbSNP
rs1185496175 1230 dbSNP
rs181595648 1231 dbSNP
rs968503085 1232 dbSNP
rs555719970 1233 dbSNP
rs1185751378 1238 dbSNP
rs1317281406 1246 dbSNP
rs978476823 1251 dbSNP
rs924289285 1258 dbSNP
rs558591516 1262 dbSNP
rs139305333 1263 dbSNP
rs534757861 1274 dbSNP
rs144080938 1280 dbSNP
rs1444352965 1281 dbSNP
rs918175428 1283 dbSNP
rs9480532 1290 dbSNP
rs1383949483 1293 dbSNP
rs1191035687 1301 dbSNP
rs949630481 1301 dbSNP
rs1170866394 1313 dbSNP
rs1241596079 1316 dbSNP
rs1404896267 1321 dbSNP
rs1292721061 1325 dbSNP
rs1045246002 1326 dbSNP
rs1412316452 1327 dbSNP
rs1358433292 1331 dbSNP
rs907590257 1332 dbSNP
rs905331058 1333 dbSNP
rs1216251728 1335 dbSNP
rs775596521 1339 dbSNP
rs1342824578 1343 dbSNP
rs1269093689 1350 dbSNP
rs1427959361 1356 dbSNP
rs1449343883 1373 dbSNP
rs939134599 1375 dbSNP
rs574603561 1401 dbSNP
rs1364072731 1402 dbSNP
rs9478782 1415 dbSNP
rs1173252731 1416 dbSNP
rs1429619403 1417 dbSNP
rs1184885067 1419 dbSNP
rs1206283599 1419 dbSNP
rs1269927551 1419 dbSNP
rs1322705772 1419 dbSNP
rs1419339968 1419 dbSNP
rs1490143739 1419 dbSNP
rs35832236 1419 dbSNP
rs539056729 1419 dbSNP
rs67859789 1419 dbSNP
rs761076431 1419 dbSNP
rs763257020 1419 dbSNP
rs767787243 1419 dbSNP
rs1308010887 1420 dbSNP
rs80341229 1421 dbSNP
rs74377979 1422 dbSNP
rs1212318392 1439 dbSNP
rs1279152209 1439 dbSNP
rs1346824315 1439 dbSNP
rs1344555530 1440 dbSNP
rs1198844983 1441 dbSNP
rs1280783229 1443 dbSNP
rs543228320 1454 dbSNP
rs578061215 1480 dbSNP
rs1462775513 1485 dbSNP
rs894819464 1487 dbSNP
rs947944590 1488 dbSNP
rs1037731757 1490 dbSNP
rs903675342 1493 dbSNP
rs999329824 1497 dbSNP
rs1030852140 1509 dbSNP
rs897858314 1519 dbSNP
rs1252846272 1522 dbSNP
rs891163282 1525 dbSNP
rs1480809826 1529 dbSNP
rs201140784 1530 dbSNP
rs1232282451 1531 dbSNP
rs1202321820 1532 dbSNP
rs1214915835 1540 dbSNP
rs556709126 1541 dbSNP
rs760714764 1545 dbSNP
rs1030244122 1553 dbSNP
rs1478720204 1555 dbSNP
rs1321004362 1572 dbSNP
rs1194099961 1578 dbSNP
rs1392382754 1578 dbSNP
rs954651486 1580 dbSNP
rs1018682329 1586 dbSNP
rs1455037974 1591 dbSNP
rs540356477 1610 dbSNP
rs1017449182 1616 dbSNP
rs1175802548 1625 dbSNP
rs974280213 1630 dbSNP
rs968930830 1639 dbSNP
rs757296564 1640 dbSNP
rs1402230363 1643 dbSNP
rs924351481 1651 dbSNP
rs1415556172 1653 dbSNP
rs1160078796 1655 dbSNP
rs1298050743 1657 dbSNP
rs1359177841 1659 dbSNP
rs560579761 1660 dbSNP
rs1406978283 1664 dbSNP
rs1176766911 1666 dbSNP
rs1279204696 1677 dbSNP
rs1243633400 1678 dbSNP
rs992498678 1688 dbSNP
rs1330778762 1689 dbSNP
rs916868877 1690 dbSNP
rs1239308933 1693 dbSNP
rs1276705494 1699 dbSNP
rs1345727156 1700 dbSNP
rs1248538492 1701 dbSNP
rs1305325390 1701 dbSNP
rs1409143083 1701 dbSNP
rs1156622899 1702 dbSNP
rs1182876265 1702 dbSNP
rs1205143072 1702 dbSNP
rs1241618581 1702 dbSNP
rs1263199437 1702 dbSNP
rs1385836846 1702 dbSNP
rs1421611145 1702 dbSNP
rs1446174431 1702 dbSNP
rs1485342580 1702 dbSNP
rs373753584 1702 dbSNP
rs58975454 1702 dbSNP
rs1239514500 1705 dbSNP
rs951646811 1706 dbSNP
rs983332513 1718 dbSNP
rs1489216952 1720 dbSNP
rs1360591927 1721 dbSNP
rs34400103 1723 dbSNP
rs1315018167 1725 dbSNP
rs1243250036 1726 dbSNP
rs1217116175 1727 dbSNP
rs1296403951 1727 dbSNP
rs949676672 1733 dbSNP
rs1266360175 1734 dbSNP
rs928823474 1739 dbSNP
rs1045702159 1740 dbSNP
rs572235022 1742 dbSNP
rs1365956029 1743 dbSNP
rs1162914223 1749 dbSNP
rs1456341532 1759 dbSNP
rs1377698320 1762 dbSNP
rs75672805 1776 dbSNP
rs1193319328 1777 dbSNP
rs761680304 1785 dbSNP
rs942191086 1788 dbSNP
rs1201098615 1790 dbSNP
rs1043424711 1806 dbSNP
rs1422017962 1821 dbSNP
rs1208377717 1829 dbSNP
rs903747422 1832 dbSNP
rs1252369588 1833 dbSNP
rs1299221071 1852 dbSNP
rs1390399612 1854 dbSNP
rs564976852 1860 dbSNP
rs1338475874 1873 dbSNP
rs935263590 1893 dbSNP
rs1052662145 1899 dbSNP
rs1345055897 1900 dbSNP
rs890992666 1901 dbSNP
rs1331889034 1904 dbSNP
rs1398575591 1908 dbSNP
rs1008723895 1909 dbSNP
rs1461081211 1915 dbSNP
rs541235082 1923 dbSNP
rs35630941 1931 dbSNP
rs1037784004 1934 dbSNP
rs1420833068 1934 dbSNP
rs1307137274 1935 dbSNP
rs769098395 1937 dbSNP
rs755823014 1947 dbSNP
rs897910578 1948 dbSNP
rs1197243455 1951 dbSNP
rs899833707 1956 dbSNP
rs1195726520 1957 dbSNP
rs993503118 1957 dbSNP
rs762362529 1960 dbSNP
rs1265091329 1971 dbSNP
rs1026963720 1978 dbSNP
rs767970737 1979 dbSNP
rs951593482 1979 dbSNP
rs1051777911 1981 dbSNP
rs890421400 1985 dbSNP
rs1337278918 1987 dbSNP
rs1329539429 1989 dbSNP
rs1445940151 1991 dbSNP
rs1397956459 1997 dbSNP
rs1353909070 1998 dbSNP
rs1469833909 1998 dbSNP
rs1428197652 2004 dbSNP
rs185915176 2005 dbSNP
rs1471397253 2008 dbSNP
rs190679040 2012 dbSNP
rs916304800 2013 dbSNP
rs561208063 2014 dbSNP
rs530177768 2020 dbSNP
rs979053040 2028 dbSNP
rs1239421598 2029 dbSNP
rs924947644 2034 dbSNP
rs1031471425 2036 dbSNP
rs550422041 2043 dbSNP
rs1225679664 2044 dbSNP
rs1352647802 2045 dbSNP
rs1159712087 2046 dbSNP
rs759126435 2048 dbSNP
rs1368396359 2056 dbSNP
rs935236851 2057 dbSNP
rs371895051 2059 dbSNP
rs1374618013 2066 dbSNP
rs75629254 2078 dbSNP
rs1452800080 2081 dbSNP
rs542571794 2088 dbSNP
rs1446268664 2089 dbSNP
rs1331871588 2096 dbSNP
rs1402092708 2104 dbSNP
rs77695522 2105 dbSNP
rs981075033 2111 dbSNP
rs1158377407 2112 dbSNP
rs1438180007 2117 dbSNP
rs144587020 2117 dbSNP
rs899906605 2117 dbSNP
rs1048348941 2135 dbSNP
rs1235800726 2143 dbSNP
rs201420009 2143 dbSNP
rs34575009 2143 dbSNP
rs1217957099 2144 dbSNP
rs1338611807 2146 dbSNP
rs144954483 2156 dbSNP
rs942241981 2157 dbSNP
rs1351188248 2159 dbSNP
rs1317151640 2160 dbSNP
rs550764095 2168 dbSNP
rs183918590 2171 dbSNP
rs1281940738 2174 dbSNP
rs534301098 2179 dbSNP
rs1259437750 2182 dbSNP
rs919391178 2187 dbSNP
rs570536288 2195 dbSNP
rs1367833471 2200 dbSNP
rs1164851185 2203 dbSNP
rs1180758755 2207 dbSNP
rs1013061703 2210 dbSNP
rs1256134004 2211 dbSNP
rs1475758047 2214 dbSNP
rs1422552157 2221 dbSNP
rs1190085071 2222 dbSNP
rs149053869 2234 dbSNP
rs747060312 2240 dbSNP
rs1293684269 2246 dbSNP
rs1222880831 2263 dbSNP
rs969090387 2273 dbSNP
rs979207089 2274 dbSNP
rs943348883 2280 dbSNP
rs1038993589 2281 dbSNP
rs904444819 2282 dbSNP
rs956421429 2283 dbSNP
rs988452516 2284 dbSNP
rs1402719655 2298 dbSNP
rs912453462 2299 dbSNP
rs1000080890 2302 dbSNP
rs1436143440 2305 dbSNP
rs1348675844 2308 dbSNP
rs1173121838 2322 dbSNP
rs1302312176 2325 dbSNP
rs1400022582 2330 dbSNP
rs1031523705 2333 dbSNP
rs771477559 2334 dbSNP
rs1481551102 2338 dbSNP
rs1269813386 2341 dbSNP
rs1313180496 2343 dbSNP
rs142087610 2344 dbSNP
rs1244962234 2347 dbSNP
rs1206521004 2352 dbSNP
rs1307641428 2355 dbSNP
rs1256874278 2360 dbSNP
rs1325268285 2361 dbSNP
rs568083500 2365 dbSNP
rs1219047771 2366 dbSNP
rs969784119 2367 dbSNP
rs1048501838 2368 dbSNP
rs980172397 2370 dbSNP
rs1016560209 2371 dbSNP
rs963605372 2372 dbSNP
rs151141284 2375 dbSNP
rs34297884 2380 dbSNP
rs1208868704 2382 dbSNP
rs1057445963 2384 dbSNP
rs1430294759 2385 dbSNP
rs11753272 2386 dbSNP
rs919442030 2387 dbSNP
rs1432442433 2390 dbSNP
rs929455489 2392 dbSNP
rs987600076 2394 dbSNP
rs911963782 2405 dbSNP
rs1178655251 2407 dbSNP
rs943430115 2411 dbSNP
rs188864447 2414 dbSNP
rs576618287 2417 dbSNP
rs1000597649 2422 dbSNP
rs141084163 2426 dbSNP
rs1208966230 2439 dbSNP
rs1310011949 2440 dbSNP
rs1429304015 2456 dbSNP
rs956675289 2459 dbSNP
rs987804112 2459 dbSNP
rs74392926 2460 dbSNP
rs1307670632 2463 dbSNP
rs1175482705 2470 dbSNP
rs1357445425 2471 dbSNP
rs1019703623 2472 dbSNP
rs867143288 2478 dbSNP
rs552968504 2484 dbSNP
rs572435829 2490 dbSNP
rs1347125607 2502 dbSNP
rs1053008134 2517 dbSNP
rs1397966475 2524 dbSNP
rs891662752 2527 dbSNP
rs1014496726 2529 dbSNP
rs1445987731 2537 dbSNP
rs1045523252 2540 dbSNP
rs1340779907 2544 dbSNP
rs533074071 2547 dbSNP
rs777076124 2553 dbSNP
rs1262085154 2555 dbSNP
rs1217863864 2557 dbSNP
rs1001255904 2563 dbSNP
rs751150015 2565 dbSNP
rs1384094162 2574 dbSNP
rs1312111169 2579 dbSNP
rs1394312666 2583 dbSNP
rs1364387030 2585 dbSNP
rs1289632244 2606 dbSNP
rs940102615 2615 dbSNP
rs541085067 2630 dbSNP
rs1233334442 2646 dbSNP
rs377342522 2647 dbSNP
rs1426492691 2682 dbSNP
rs1368939132 2690 dbSNP
rs754401495 2692 dbSNP
rs1421513841 2693 dbSNP
rs1263471197 2695 dbSNP
rs577714506 2715 dbSNP
rs948945143 2720 dbSNP
rs995072125 2721 dbSNP
rs1225110676 2723 dbSNP
rs1026508342 2724 dbSNP
rs1265742094 2725 dbSNP
rs1486325983 2737 dbSNP
rs115379488 2738 dbSNP
rs546377006 2743 dbSNP
rs1309305835 2744 dbSNP
rs1296629781 2747 dbSNP
rs1399621460 2753 dbSNP
rs190945822 2755 dbSNP
rs543041149 2757 dbSNP
rs1435040251 2761 dbSNP
rs1174315560 2768 dbSNP
rs965171446 2773 dbSNP
rs543897822 2777 dbSNP
rs1162567330 2778 dbSNP
rs1455985212 2790 dbSNP
rs974833191 2794 dbSNP
rs563914807 2795 dbSNP
rs1477298574 2796 dbSNP
rs1009741221 2798 dbSNP
rs1019269440 2799 dbSNP
rs965053986 2803 dbSNP
rs1291496886 2828 dbSNP
rs935975526 2832 dbSNP
rs975283556 2837 dbSNP
rs1028226749 2840 dbSNP
rs1218042935 2841 dbSNP
rs1316333544 2855 dbSNP
rs146905277 2860 dbSNP
rs1053058148 2861 dbSNP
rs913150614 2863 dbSNP
rs1386891111 2866 dbSNP
rs949957897 2869 dbSNP
rs1045982715 2877 dbSNP
rs56382018 2881 dbSNP
rs1331468126 2887 dbSNP
rs1307855558 2892 dbSNP
rs1353656693 2894 dbSNP
rs1178114574 2896 dbSNP
rs952648246 2897 dbSNP
rs983879360 2901 dbSNP
rs1197115782 2906 dbSNP
rs908380256 2912 dbSNP
rs1239281868 2926 dbSNP
rs34087413 2928 dbSNP
rs940111431 2934 dbSNP
rs1456483837 2935 dbSNP
rs139320536 2937 dbSNP
rs917236309 2938 dbSNP
rs1288613891 2939 dbSNP
rs74730079 2941 dbSNP
rs182705712 2942 dbSNP
rs547879762 2943 dbSNP
rs568007402 2944 dbSNP
rs866922685 2946 dbSNP
rs1414682537 2947 dbSNP
rs112278426 2953 dbSNP
rs993784534 2954 dbSNP
rs1025226870 2956 dbSNP
rs1237593824 2961 dbSNP
rs1381530416 2963 dbSNP
rs569593755 2966 dbSNP
rs1009316970 2969 dbSNP
rs1245051154 2970 dbSNP
rs1188267088 2977 dbSNP
rs1009123350 2978 dbSNP
rs538121473 2981 dbSNP
rs150452201 2982 dbSNP
rs1351294234 2985 dbSNP
rs76955048 2986 dbSNP
rs550256047 2990 dbSNP
rs926019422 2991 dbSNP
rs528904893 2992 dbSNP
rs957397992 2994 dbSNP
rs186969608 2996 dbSNP
rs913201480 2998 dbSNP
rs1361572522 3006 dbSNP
rs367982735 3011 dbSNP
rs539230633 3012 dbSNP
rs1228151770 3013 dbSNP
rs996443262 3014 dbSNP
rs1288122058 3016 dbSNP
rs1215548945 3017 dbSNP
rs371826191 3018 dbSNP
rs952596366 3019 dbSNP
rs578094601 3025 dbSNP
rs937175784 3026 dbSNP
rs1038116736 3030 dbSNP
rs386706955 3030 dbSNP
rs540761402 3031 dbSNP
rs535697154 3032 dbSNP
rs554677610 3034 dbSNP
rs191865652 3035 dbSNP
rs866726125 3037 dbSNP
rs1472406448 3040 dbSNP
rs1009588672 3041 dbSNP
rs1478276266 3042 dbSNP
rs1415628417 3043 dbSNP
rs1475334383 3045 dbSNP
rs1192703965 3048 dbSNP
rs1019181449 3049 dbSNP
rs1397661955 3052 dbSNP
rs925953939 3054 dbSNP
rs1222217931 3057 dbSNP
rs1287149119 3059 dbSNP
rs936232240 3059 dbSNP
rs1466781167 3062 dbSNP
rs1249992709 3067 dbSNP
rs1277149348 3070 dbSNP
rs543981544 3072 dbSNP
rs996343640 3073 dbSNP
rs573751044 3076 dbSNP
rs577548791 3077 dbSNP
rs777949236 3078 dbSNP
rs1399908021 3080 dbSNP
rs527807176 3085 dbSNP
rs546097366 3087 dbSNP
rs1426592016 3088 dbSNP
rs1040561731 3089 dbSNP
rs1277869113 3089 dbSNP
rs900890231 3093 dbSNP
rs1200028166 3096 dbSNP
rs1457803627 3098 dbSNP
rs971403673 3102 dbSNP
rs981792711 3104 dbSNP
rs927223533 3106 dbSNP
rs559851012 3108 dbSNP
rs542633433 3109 dbSNP
rs919734573 3110 dbSNP
rs996559218 3113 dbSNP
rs1447690719 3114 dbSNP
rs1049376403 3115 dbSNP
rs929748062 3119 dbSNP
rs888151760 3122 dbSNP
rs761721464 3129 dbSNP
rs1311397481 3130 dbSNP
rs1352719078 3131 dbSNP
rs1485910454 3132 dbSNP
rs890815989 3133 dbSNP
rs1421079500 3136 dbSNP
rs943711480 3139 dbSNP
rs1041065102 3140 dbSNP
rs1439844358 3144 dbSNP
rs781672680 3147 dbSNP
rs562505347 3148 dbSNP
rs1256180072 3149 dbSNP
rs1033191671 3153 dbSNP
rs528790639 3155 dbSNP
rs1010347882 3156 dbSNP
rs548852847 3164 dbSNP
rs1414402872 3168 dbSNP
rs561392262 3170 dbSNP
rs138233626 3171 dbSNP
rs183991074 3172 dbSNP
rs958629974 3173 dbSNP
rs149587546 3177 dbSNP
rs1160166042 3182 dbSNP
rs989065804 3192 dbSNP
rs919785344 3193 dbSNP
rs770329967 3195 dbSNP
rs773186895 3199 dbSNP
rs762800747 3202 dbSNP
rs544155176 3203 dbSNP
rs58023690 3210 dbSNP
rs148301365 3211 dbSNP
rs368375978 3215 dbSNP
rs71554450 3215 dbSNP
rs1039380553 3230 dbSNP
rs1260710221 3231 dbSNP
rs1489076318 3238 dbSNP
rs1312360268 3240 dbSNP
rs1226824904 3245 dbSNP
rs1342545959 3246 dbSNP
rs1193373321 3251 dbSNP
rs374881300 3259 dbSNP
rs564350844 3273 dbSNP
rs1400335775 3278 dbSNP
rs566622134 3279 dbSNP
rs920900574 3281 dbSNP
rs1287022807 3283 dbSNP
rs1476787111 3285 dbSNP
rs1173795349 3286 dbSNP
rs1163396895 3287 dbSNP
rs866208381 3288 dbSNP
rs932239551 3292 dbSNP
rs532975018 3295 dbSNP
rs1488156382 3296 dbSNP
rs546736687 3297 dbSNP
rs555632413 3298 dbSNP
rs1042232186 3299 dbSNP
rs566577071 3309 dbSNP
rs1003342563 3314 dbSNP
rs1024138953 3317 dbSNP
rs998343620 3325 dbSNP
rs1330720011 3326 dbSNP
rs1434451995 3328 dbSNP
rs528970114 3330 dbSNP
rs1388464698 3331 dbSNP
rs958683364 3334 dbSNP
rs995414168 3335 dbSNP
rs1283631173 3341 dbSNP
rs1026852163 3342 dbSNP
rs1371703043 3342 dbSNP
rs951256432 3343 dbSNP
rs1434275119 3344 dbSNP
rs866824696 3355 dbSNP
rs568496985 3361 dbSNP
rs1200411784 3363 dbSNP
rs537427227 3367 dbSNP
rs557359173 3370 dbSNP
rs975544273 3373 dbSNP
rs1455094925 3375 dbSNP
rs920954750 3384 dbSNP
rs936308824 3385 dbSNP
rs1378991014 3386 dbSNP
rs1455720650 3387 dbSNP
rs1159478477 3393 dbSNP
rs1438156002 3395 dbSNP
rs200406865 3395 dbSNP
rs1403771748 3396 dbSNP
rs1378467863 3401 dbSNP
rs777600044 3402 dbSNP
rs1464789930 3406 dbSNP
rs1393808799 3408 dbSNP
rs1174709324 3415 dbSNP
rs1466843408 3418 dbSNP
rs1054743964 3419 dbSNP
rs922084789 3420 dbSNP
rs932178125 3421 dbSNP
rs754523430 3423 dbSNP
rs946251222 3424 dbSNP
rs1436326345 3433 dbSNP
rs1180634288 3441 dbSNP
rs1202017005 3445 dbSNP
rs1041895684 3455 dbSNP
rs941120898 3456 dbSNP
rs1239548498 3463 dbSNP
rs1037072962 3469 dbSNP
rs907342494 3475 dbSNP
rs950007797 3479 dbSNP
rs1375214595 3499 dbSNP
rs548440113 3505 dbSNP
rs1215113060 3509 dbSNP
rs1045701901 3513 dbSNP
rs905681615 3516 dbSNP
rs1468647807 3522 dbSNP
rs1001341131 3524 dbSNP
rs1456981915 3531 dbSNP
rs577419028 3535 dbSNP
rs1196188007 3537 dbSNP
rs1002984202 3540 dbSNP
rs1056272012 3541 dbSNP
rs1489247978 3543 dbSNP
rs201950520 3552 dbSNP
rs868327886 3552 dbSNP
rs894516662 3558 dbSNP
rs1347903305 3560 dbSNP
rs1491329533 3560 dbSNP
rs368847152 3560 dbSNP
rs1318237065 3561 dbSNP
rs1354379222 3561 dbSNP
rs1361792814 3561 dbSNP
rs1399102093 3561 dbSNP
rs1416062085 3561 dbSNP
rs1491333711 3561 dbSNP
rs58998570 3561 dbSNP
rs796389692 3561 dbSNP
rs1368203184 3566 dbSNP
rs1163855976 3569 dbSNP
rs1472603067 3569 dbSNP
rs1471937722 3580 dbSNP
rs1415900948 3584 dbSNP
rs1167459371 3585 dbSNP
rs2342858 3589 dbSNP
rs1214976983 3592 dbSNP
rs1445141778 3596 dbSNP
rs1465209739 3599 dbSNP
rs893176137 3600 dbSNP
rs1010354603 3608 dbSNP
rs1220915288 3609 dbSNP
rs1291034478 3609 dbSNP
rs1020701236 3618 dbSNP
rs1269910299 3622 dbSNP
rs1429257703 3623 dbSNP
rs1352072809 3631 dbSNP
rs1324315955 3634 dbSNP
rs995464509 3637 dbSNP
rs553330114 3638 dbSNP
rs1026903461 3644 dbSNP
rs1392609907 3648 dbSNP
rs1173077478 3651 dbSNP
rs1478718763 3661 dbSNP
rs951308886 3663 dbSNP
rs1419967317 3664 dbSNP
rs752240501 3669 dbSNP
rs1398580577 3674 dbSNP
rs1474404673 3676 dbSNP
rs1004509365 3680 dbSNP
rs966095221 3683 dbSNP
rs1391846920 3687 dbSNP
rs1019460868 3696 dbSNP
rs573381251 3702 dbSNP
rs976289269 3708 dbSNP
rs1311758687 3711 dbSNP
rs542184334 3712 dbSNP
rs1272773176 3716 dbSNP
rs1213134306 3718 dbSNP
rs865889369 3721 dbSNP
rs953647007 3728 dbSNP
rs187225918 3735 dbSNP
rs1293583820 3736 dbSNP
rs531074067 3742 dbSNP
rs1333370850 3745 dbSNP
rs1466347949 3746 dbSNP
rs1354120845 3747 dbSNP
rs141906692 3749 dbSNP
rs989146888 3752 dbSNP
rs913534739 3753 dbSNP
rs1434569405 3759 dbSNP
rs1407981251 3769 dbSNP
rs375474515 3778 dbSNP
rs1174186033 3788 dbSNP
rs1453657720 3790 dbSNP
rs538560043 3794 dbSNP
rs1179918885 3814 dbSNP
rs1457955638 3816 dbSNP
rs1231920355 3820 dbSNP
rs1202921509 3825 dbSNP
rs918231983 3829 dbSNP
rs1314291152 3838 dbSNP
rs111519214 3844 dbSNP
rs371091473 3845 dbSNP
rs1311582462 3846 dbSNP
rs928851139 3849 dbSNP
rs949728038 3853 dbSNP
rs938842498 3855 dbSNP
rs1045438574 3859 dbSNP
rs945220615 3869 dbSNP
rs937245610 3871 dbSNP
rs1055846007 3873 dbSNP
rs894567316 3876 dbSNP
rs893008543 3880 dbSNP
rs532896448 3881 dbSNP
rs527833659 3882 dbSNP
rs1159973576 3885 dbSNP
rs1419127796 3888 dbSNP
rs1418896914 3894 dbSNP
rs1048395935 3899 dbSNP
rs1406864202 3899 dbSNP
rs1172331500 3900 dbSNP
rs779362408 3901 dbSNP
rs1210551291 3902 dbSNP
rs887085830 3905 dbSNP
rs1041834604 3907 dbSNP
rs1004155929 3918 dbSNP
rs6914319 3926 dbSNP
rs997447417 3938 dbSNP
rs1302259485 3942 dbSNP
rs767081861 3943 dbSNP
rs1399961134 3947 dbSNP
rs1413905822 3949 dbSNP
rs1416434300 3951 dbSNP
rs1028951567 3952 dbSNP
rs953595654 3962 dbSNP
rs1339470388 3964 dbSNP
rs1006464319 3967 dbSNP
rs146279059 3979 dbSNP
rs1425208870 3981 dbSNP
rs1418073498 3988 dbSNP
rs1187739747 3995 dbSNP
rs17673180 3996 dbSNP
rs1266057673 4002 dbSNP
rs529063754 4006 dbSNP
rs972883201 4007 dbSNP
rs957780983 4017 dbSNP
rs1485796390 4020 dbSNP
rs549043173 4037 dbSNP
rs989198920 4048 dbSNP
rs918314593 4054 dbSNP
rs1223817671 4059 dbSNP
rs1335782223 4060 dbSNP
rs1292878638 4062 dbSNP
rs751368080 4062 dbSNP
rs1353321294 4064 dbSNP
rs1020658283 4072 dbSNP
rs1307645126 4075 dbSNP
rs966766885 4082 dbSNP
rs1231876965 4084 dbSNP
rs1255969526 4086 dbSNP
rs1346301588 4087 dbSNP
rs1382723248 4093 dbSNP
rs139373846 4096 dbSNP
rs1286641537 4103 dbSNP
rs538110645 4112 dbSNP
rs1458965338 4118 dbSNP
rs1394839056 4119 dbSNP
rs1163754597 4127 dbSNP
rs1258593097 4127 dbSNP
rs926979259 4128 dbSNP
rs1428477583 4129 dbSNP
rs928881396 4141 dbSNP
rs1260225297 4148 dbSNP
rs1266006332 4150 dbSNP
rs1468953786 4152 dbSNP
rs1488093521 4164 dbSNP
rs937237638 4168 dbSNP
rs1054401768 4169 dbSNP
rs1184934644 4171 dbSNP
rs1325825171 4182 dbSNP
rs1293336580 4187 dbSNP
rs1388077948 4188 dbSNP
rs938908528 4192 dbSNP
rs1041957501 4194 dbSNP
rs991625235 4194 dbSNP
rs916051759 4195 dbSNP
rs1168897687 4197 dbSNP
rs557399858 4201 dbSNP
rs1455031982 4202 dbSNP
rs372197249 4202 dbSNP
rs997563617 4202 dbSNP
rs1048444533 4205 dbSNP
rs75078842 4207 dbSNP
rs1459283810 4214 dbSNP
rs1196207971 4217 dbSNP
rs534132959 4217 dbSNP
rs185563456 4227 dbSNP
rs1249335978 4236 dbSNP
rs1236424199 4237 dbSNP
rs1016547112 4238 dbSNP
rs1359590850 4246 dbSNP
rs1302104962 4248 dbSNP
rs1231403478 4252 dbSNP
rs1337215111 4254 dbSNP
rs962621316 4258 dbSNP
rs1391244304 4261 dbSNP
rs901085654 4269 dbSNP
rs1304894906 4273 dbSNP
rs1435907871 4274 dbSNP
rs993657850 4277 dbSNP
rs1394964107 4281 dbSNP
rs1171890964 4313 dbSNP
rs996730112 4314 dbSNP
rs553408936 4315 dbSNP
rs1290328161 4316 dbSNP
rs573389766 4316 dbSNP
rs1181367907 4317 dbSNP
rs893618746 4318 dbSNP
rs1212707157 4320 dbSNP
rs1010691650 4322 dbSNP
rs190535478 4323 dbSNP
rs1352207089 4331 dbSNP
rs553920131 4339 dbSNP
rs1237889424 4343 dbSNP
rs990236000 4345 dbSNP
rs371303428 4347 dbSNP
rs112890400 4349 dbSNP
rs945954815 4354 dbSNP
rs1311578041 4357 dbSNP
rs1402886475 4359 dbSNP
rs180866537 4369 dbSNP
rs1034657881 4372 dbSNP
rs563782582 4373 dbSNP
rs532942059 4384 dbSNP
rs1189864363 4386 dbSNP
rs933405999 4386 dbSNP
rs1486294673 4387 dbSNP
rs1050496161 4389 dbSNP
rs1208641102 4394 dbSNP
rs916102356 4399 dbSNP
rs1448601836 4402 dbSNP
rs369801410 4406 dbSNP
rs889104796 4406 dbSNP
rs952867169 4406 dbSNP
rs539981986 4433 dbSNP
rs560178043 4434 dbSNP
rs1194261846 4437 dbSNP
rs1379604770 4448 dbSNP
rs374818875 4451 dbSNP
rs940079099 4452 dbSNP
rs1291757464 4457 dbSNP
rs528949689 4458 dbSNP
rs1433530056 4460 dbSNP
rs898039476 4463 dbSNP
rs1041448976 4466 dbSNP
rs1399003755 4469 dbSNP
rs1397037093 4471 dbSNP
rs1165923223 4480 dbSNP
rs1398788046 4480 dbSNP
rs1461054544 4482 dbSNP
rs1160975994 4489 dbSNP
rs369328503 4494 dbSNP
rs932573012 4498 dbSNP
rs150561888 4502 dbSNP
rs1476367501 4505 dbSNP
rs531675676 4506 dbSNP
rs1242598139 4507 dbSNP
rs893679391 4517 dbSNP
rs867944464 4520 dbSNP
rs1213943820 4533 dbSNP
rs1034069701 4534 dbSNP
rs1271697975 4537 dbSNP
rs958462451 4540 dbSNP
rs1216663593 4543 dbSNP
rs1340748310 4544 dbSNP
rs1323321789 4545 dbSNP
rs1042186204 4554 dbSNP
rs1270119573 4563 dbSNP
rs1428806136 4566 dbSNP
rs1372456736 4570 dbSNP
rs1440998788 4573 dbSNP
rs1304880153 4578 dbSNP
rs1376779237 4587 dbSNP
rs989792973 4588 dbSNP
rs1392501231 4595 dbSNP
rs1162478896 4605 dbSNP
rs1222457453 4615 dbSNP
rs902269861 4620 dbSNP
rs551697726 4621 dbSNP
rs570784525 4626 dbSNP
rs967311983 4627 dbSNP
rs1035118794 4633 dbSNP
rs751715332 4636 dbSNP
rs1193673301 4646 dbSNP
rs1221024633 4656 dbSNP
rs556164765 4657 dbSNP
rs2095375 4659 dbSNP
rs1013150208 4677 dbSNP
rs923090550 4678 dbSNP
rs1023164308 4682 dbSNP
rs1272663931 4687 dbSNP
rs1213335438 4694 dbSNP
rs1350616320 4702 dbSNP
rs1304292509 4705 dbSNP
rs1214377290 4716 dbSNP
rs952921050 4725 dbSNP
rs984255834 4727 dbSNP
rs1468498244 4728 dbSNP
rs1327884415 4731 dbSNP
rs908673701 4736 dbSNP
rs1178749563 4739 dbSNP
rs1427774826 4748 dbSNP
rs1231924673 4751 dbSNP
rs961771164 4763 dbSNP
rs1453256407 4764 dbSNP
rs910615600 4767 dbSNP
rs1178584036 4769 dbSNP
rs942114036 4772 dbSNP
rs35402534 4785 dbSNP
rs1037675654 4788 dbSNP
rs1202815556 4790 dbSNP
rs1422881650 4791 dbSNP
rs1281639118 4805 dbSNP
rs1162435056 4824 dbSNP
rs1210329583 4829 dbSNP
rs897857136 4837 dbSNP
rs1396205888 4845 dbSNP
rs1309149369 4847 dbSNP
rs546640698 4847 dbSNP
rs1224564459 4849 dbSNP
rs976837789 4859 dbSNP
rs139538503 4860 dbSNP
rs1330053053 4876 dbSNP
rs1354492884 4881 dbSNP
rs932633545 4892 dbSNP
rs1440575351 4898 dbSNP
rs1046708963 4902 dbSNP
rs183968353 4903 dbSNP
rs915166691 4915 dbSNP
rs149695373 4918 dbSNP
rs1356949000 4920 dbSNP
rs1042627074 4922 dbSNP
rs1419331657 4929 dbSNP
rs1233047999 4931 dbSNP
rs1180527800 4934 dbSNP
rs1476382660 4939 dbSNP
rs1258909064 4942 dbSNP
rs1187869759 4943 dbSNP
rs1482529193 4950 dbSNP
rs1262601130 4956 dbSNP
rs188304339 4958 dbSNP
rs1316606518 4959 dbSNP
rs1282411141 4960 dbSNP
rs1003728309 4975 dbSNP
rs1226424667 4983 dbSNP
rs1056203203 4984 dbSNP
rs780996862 4988 dbSNP
rs575425013 5016 dbSNP
rs1414113221 5028 dbSNP
rs538197694 5030 dbSNP
rs1290156237 5032 dbSNP
rs1021287351 5034 dbSNP
rs1011864877 5037 dbSNP
rs1027238239 5038 dbSNP
rs888704265 5045 dbSNP
rs1156500032 5049 dbSNP
rs558009552 5056 dbSNP
rs1419047415 5057 dbSNP
rs1187630866 5069 dbSNP
rs577601931 5071 dbSNP
rs1016193352 5078 dbSNP
rs961547899 5079 dbSNP
rs1419622316 5091 dbSNP
rs1475303807 5092 dbSNP
rs977277612 5093 dbSNP
rs1416685552 5097 dbSNP
rs1246199124 5099 dbSNP
rs1029746603 5105 dbSNP
rs1411152153 5107 dbSNP
rs1335666050 5109 dbSNP
rs145487988 5117 dbSNP
rs985468798 5118 dbSNP
rs1319903472 5122 dbSNP
rs985889638 5125 dbSNP
rs559866977 5133 dbSNP
rs535863300 5134 dbSNP
rs573684331 5138 dbSNP
rs1311402255 5139 dbSNP
rs978017569 5140 dbSNP
rs973918489 5141 dbSNP
rs1394726402 5142 dbSNP
rs139481696 5146 dbSNP
rs77778010 5151 dbSNP
rs773238321 5153 dbSNP
rs1171739657 5154 dbSNP
rs377289783 5155 dbSNP
rs531512783 5171 dbSNP
rs894900949 5172 dbSNP
rs947772872 5173 dbSNP
rs369643441 5174 dbSNP
rs1273686085 5180 dbSNP
rs887418170 5182 dbSNP
rs1252585145 5193 dbSNP
rs1209078966 5194 dbSNP
rs1006239653 5203 dbSNP
rs1208503394 5208 dbSNP
rs1259285201 5212 dbSNP
rs564503357 5215 dbSNP
rs1252778467 5218 dbSNP
rs1228081994 5225 dbSNP
rs527561254 5226 dbSNP
rs981891195 5233 dbSNP
rs926727183 5236 dbSNP
rs998369387 5238 dbSNP
rs181122408 5239 dbSNP
rs954123529 5240 dbSNP
rs985519470 5246 dbSNP
rs1371356763 5259 dbSNP
rs374245443 5266 dbSNP
rs1167961375 5268 dbSNP
rs1022330108 5270 dbSNP
rs147966653 5274 dbSNP
rs1434594380 5281 dbSNP
rs1299055694 5284 dbSNP
rs894003711 5286 dbSNP
rs978447082 5288 dbSNP
rs1175654068 5289 dbSNP
rs1454751796 5291 dbSNP
rs1394775452 5292 dbSNP
rs923877777 5307 dbSNP
rs1377580966 5312 dbSNP
rs939225972 5333 dbSNP
rs535595517 5337 dbSNP
rs1252433102 5354 dbSNP
rs1196117807 5365 dbSNP
rs1317972849 5368 dbSNP
rs1272372884 5371 dbSNP
rs1043227832 5372 dbSNP
rs1433029521 5380 dbSNP
rs1270803571 5385 dbSNP
rs902946256 5388 dbSNP
rs1370175633 5395 dbSNP
rs1231907150 5397 dbSNP
rs998454112 5406 dbSNP
rs1029959050 5414 dbSNP
rs1282380754 5418 dbSNP
rs749642147 5421 dbSNP
rs549064765 5425 dbSNP
rs992012542 5431 dbSNP
rs141836407 5439 dbSNP
rs1308205731 5440 dbSNP
rs916383847 5452 dbSNP
rs1369304922 5472 dbSNP
rs947823258 5482 dbSNP
rs1048778250 5489 dbSNP
rs887471824 5490 dbSNP
rs1007466872 5497 dbSNP
rs1170843016 5499 dbSNP
rs1455567540 5503 dbSNP
rs377709964 5505 dbSNP
rs1017391057 5514 dbSNP
rs1193313396 5527 dbSNP
rs963571536 5529 dbSNP
rs569138991 5537 dbSNP
rs185766027 5540 dbSNP
rs1190001382 5542 dbSNP
rs973273037 5548 dbSNP
rs533351705 5551 dbSNP
rs1277345151 5566 dbSNP
rs1198203847 5568 dbSNP
rs1352453678 5578 dbSNP
rs1260930170 5585 dbSNP
rs769072986 5592 dbSNP
rs1349020069 5602 dbSNP
rs1454221855 5605 dbSNP
rs1036400004 5619 dbSNP
rs1192375825 5623 dbSNP
rs919309051 5628 dbSNP
rs555657264 5629 dbSNP
rs143788517 5630 dbSNP
rs1158320006 5635 dbSNP
rs1383114756 5640 dbSNP
rs867602513 5652 dbSNP
rs1402616726 5657 dbSNP
rs1319070464 5672 dbSNP
rs1455791546 5675 dbSNP
rs113410820 5691 dbSNP
rs190529387 5692 dbSNP
rs1166772705 5696 dbSNP
rs1475515677 5697 dbSNP
rs774157739 5706 dbSNP
rs927984301 5707 dbSNP
rs1184856706 5720 dbSNP
rs111663052 5735 dbSNP
rs1448222257 5739 dbSNP
rs889941031 5742 dbSNP
rs1207730546 5764 dbSNP
rs1438788980 5770 dbSNP
rs1326585476 5775 dbSNP
rs938241410 5781 dbSNP
rs1055406668 5783 dbSNP
rs1356332809 5785 dbSNP
rs1282937990 5788 dbSNP
rs1007009838 5794 dbSNP
rs1371606217 5795 dbSNP
rs1319912498 5799 dbSNP
rs766213258 5801 dbSNP
rs1042580536 5802 dbSNP
rs1327722270 5806 dbSNP
rs1405730192 5807 dbSNP
rs1413070677 5808 dbSNP
rs4869730 5809 dbSNP
rs1373174702 5810 dbSNP
rs549854226 5812 dbSNP
rs540079343 5813 dbSNP
rs998572026 5814 dbSNP
rs968491679 5827 dbSNP
rs1254466818 5840 dbSNP
rs1214780962 5841 dbSNP
rs151086762 5845 dbSNP
rs1288093643 5847 dbSNP
rs1205281880 5848 dbSNP
rs1216849471 5853 dbSNP
rs890161422 5855 dbSNP
rs1031385886 5862 dbSNP
rs1007416297 5865 dbSNP
rs553770066 5868 dbSNP
rs963342638 5873 dbSNP
rs1214991861 5881 dbSNP
rs759170842 5885 dbSNP
rs960669623 5890 dbSNP
rs1435947493 5896 dbSNP
rs1455053758 5901 dbSNP
rs1181566955 5910 dbSNP
rs1362355334 5915 dbSNP
rs1167470255 5917 dbSNP
rs1471359388 5934 dbSNP
rs181842251 5940 dbSNP
rs1417391715 5946 dbSNP
rs1396290187 5947 dbSNP
rs916436299 5952 dbSNP
rs1477462066 5954 dbSNP
rs1327963931 5955 dbSNP
rs533703111 5958 dbSNP
rs969179383 5958 dbSNP
rs560355900 5962 dbSNP
rs542771879 5968 dbSNP
rs1203196432 5981 dbSNP
rs1395160864 5992 dbSNP
rs1350155431 6001 dbSNP
rs1218889298 6015 dbSNP
rs982230502 6018 dbSNP
rs908970601 6021 dbSNP
rs959390533 6036 dbSNP
rs771849143 6037 dbSNP
rs1036043746 6043 dbSNP
rs141020773 6056 dbSNP
rs772642039 6057 dbSNP
rs60539437 6058 dbSNP
rs1413592699 6059 dbSNP
rs1422589719 6065 dbSNP
rs1179374035 6075 dbSNP
rs924168788 6077 dbSNP
rs1251467318 6080 dbSNP
rs11155689 6092 dbSNP
rs1007060525 6096 dbSNP
rs1332176911 6114 dbSNP
rs1281170599 6115 dbSNP
rs1043877595 6118 dbSNP
rs187328515 6119 dbSNP
rs1286593693 6127 dbSNP
rs1273214995 6133 dbSNP
rs1224478114 6139 dbSNP
rs59644096 6141 dbSNP
rs1195795772 6150 dbSNP
rs943012729 6155 dbSNP
rs540960318 6159 dbSNP
rs960970271 6163 dbSNP
rs1013482966 6167 dbSNP
rs1023498460 6182 dbSNP
rs899041378 6184 dbSNP
rs969239287 6188 dbSNP
rs994799696 6198 dbSNP
rs1476497674 6211 dbSNP
rs984599073 6214 dbSNP
rs1257455622 6217 dbSNP
rs909012413 6227 dbSNP
rs961842042 6231 dbSNP
rs141971005 6235 dbSNP
rs886295868 6244 dbSNP
rs1003615564 6245 dbSNP
rs1035075601 6251 dbSNP
rs1267305199 6251 dbSNP
rs959463584 6251 dbSNP
rs1167213882 6255 dbSNP
rs1313336408 6256 dbSNP
rs192095982 6264 dbSNP
rs34794572 6281 dbSNP
rs549103532 6289 dbSNP
rs1290070191 6290 dbSNP
rs932966175 6295 dbSNP
rs531216247 6297 dbSNP
rs1387416757 6298 dbSNP
rs1319024159 6300 dbSNP
rs978408929 6311 dbSNP
rs911478898 6313 dbSNP
rs1164707558 6315 dbSNP
rs1391796930 6317 dbSNP
rs924094416 6319 dbSNP
rs1189262364 6320 dbSNP
rs1353202461 6322 dbSNP
rs1246407584 6328 dbSNP
rs942894875 6337 dbSNP
rs1206656521 6340 dbSNP
rs531665540 6343 dbSNP
rs765072522 6344 dbSNP
rs903996320 6345 dbSNP
rs934191898 6346 dbSNP
rs935450262 6350 dbSNP
rs986946947 6354 dbSNP
rs551955220 6361 dbSNP
rs896518382 6362 dbSNP
rs1294940006 6370 dbSNP
rs571710614 6374 dbSNP
rs1442568284 6383 dbSNP
rs1391931829 6386 dbSNP
rs534555958 6390 dbSNP
rs1293262374 6392 dbSNP
rs1456873530 6396 dbSNP
rs1013536710 6400 dbSNP
rs911599839 6403 dbSNP
rs943128645 6406 dbSNP
rs750872043 6407 dbSNP
rs898870084 6409 dbSNP
rs1433940737 6413 dbSNP
rs1267837962 6419 dbSNP
rs145629596 6420 dbSNP
rs1047668254 6424 dbSNP
rs1190413101 6425 dbSNP
rs567304518 6428 dbSNP
rs1428043930 6429 dbSNP
rs1340851146 6433 dbSNP
rs1271797035 6434 dbSNP
rs1234999890 6437 dbSNP
rs1016122478 6438 dbSNP
rs962175677 6439 dbSNP
rs536268517 6448 dbSNP
rs1056314449 6449 dbSNP
rs556165580 6450 dbSNP
rs1368819568 6452 dbSNP
rs895198168 6459 dbSNP
rs954403380 6460 dbSNP
rs576205272 6465 dbSNP
rs1431227174 6466 dbSNP
rs910189040 6468 dbSNP
rs942948297 6472 dbSNP
rs1249036675 6473 dbSNP
rs370591463 6475 dbSNP
rs1360801455 6476 dbSNP
rs1380060499 6479 dbSNP
rs980074131 6480 dbSNP
rs1328725122 6491 dbSNP
rs1230527995 6493 dbSNP
rs925503485 6494 dbSNP
rs935488754 6495 dbSNP
rs1052569449 6500 dbSNP
rs868655384 6501 dbSNP
rs1336301218 6503 dbSNP
rs896584106 6504 dbSNP
rs545083457 6505 dbSNP
rs1485641700 6509 dbSNP
rs1159585839 6510 dbSNP
rs1203488891 6511 dbSNP
rs558755420 6517 dbSNP
rs1263873161 6521 dbSNP
rs1450010218 6523 dbSNP
rs1442498687 6526 dbSNP
rs551309152 6531 dbSNP
rs1465945793 6536 dbSNP
rs949443351 6537 dbSNP
rs1228145521 6546 dbSNP
rs1192994978 6547 dbSNP
rs1286465633 6548 dbSNP
rs373905726 6553 dbSNP
rs201943325 6555 dbSNP
rs78799831 6555 dbSNP
rs397779852 6556 dbSNP
rs113572228 6557 dbSNP
rs1045064813 6572 dbSNP
rs905184922 6583 dbSNP
rs1006125723 6585 dbSNP
rs1176472809 6590 dbSNP
rs1389626892 6590 dbSNP
rs114171659 6593 dbSNP
rs897698909 6594 dbSNP
rs1407231410 6595 dbSNP
rs1290125314 6596 dbSNP
rs752482404 6600 dbSNP
rs1385138046 6601 dbSNP
rs1164940957 6603 dbSNP
rs1473056014 6604 dbSNP
rs993741855 6606 dbSNP
rs541346861 6612 dbSNP
rs1439499481 6617 dbSNP
rs1326846596 6619 dbSNP
rs1303374098 6629 dbSNP
rs974543016 6633 dbSNP
rs1292397976 6642 dbSNP
rs561012931 6674 dbSNP
rs1236996070 6675 dbSNP
rs529905193 6676 dbSNP
rs1282546239 6686 dbSNP
rs920241259 6689 dbSNP
rs1030129233 6692 dbSNP
rs182836009 6693 dbSNP
rs1433092351 6696 dbSNP
rs1343235272 6701 dbSNP
rs1325234000 6703 dbSNP
rs1389901082 6705 dbSNP
rs1161198097 6711 dbSNP
rs1390185663 6713 dbSNP
rs1431104267 6713 dbSNP
rs1187555016 6721 dbSNP
rs1447236069 6722 dbSNP
rs930296981 6722 dbSNP
rs1199997978 6728 dbSNP
rs1465439780 6732 dbSNP
rs1288344511 6736 dbSNP
rs1047869243 6737 dbSNP
rs138168139 6738 dbSNP
rs531702507 6739