miRTarBase - #MIRT096234 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CANX   
Synonyms CNX, IP90, P90
Description calnexin
Transcript NM_001024649   
Other Transcripts NM_001746   
Expression
Putative miRNA Targets on CANX
3'UTR of CANX
(miRNA target sites are highlighted)
>CANX|NM_001024649|3'UTR
   1 AACAATCTTAAGAGCTTGATCTGTGATTTCTTCTCCCTCCTCCCCTGCAAGAGTGGTCCTAGGAGAGGACCTGGCACACC
  81 TTAGGTTGACATTCAGAAAACTTCAAGACATCACCATCAGCAGGCTCCAGTTGAACACTAGTCTGTGTAACTTTAAACAT
 161 CTAGCAGTAAATACTTGCAGTTGTGATATAAAGGACCCTGTTTCTGTAGAAAAGAAAACATTTAACATAATGGTTGTGAA
 241 ATGTAACATGAAGCAAACTAACTTTTTTTTTTTTAACATCTTTGTTTTTAAAATAGAATGATAGAACTTTGCCAGTCTTT
 321 AAGATCTTGGCTTAATTTAATGTATTAATCTGTTTGTGCAAACATAATACCACCATTTAAAAATGTTAGGGAGATGAGTT
 401 GCAGTTTTTATAATAGATTTTTTTTAAAGTTTGGTATTGTAAAACATTCACACCTCTGTCCCTCAAAATTGATAATTACG
 481 TTTAAAGTGCAGTCATTTGTGGTTAGAATCTTGTTTTGTTTGCTTCCATTATTGAGTTCCTCCTAAGGAAATTGAGGAGA
 561 GGGACTGAATAGAAGCCCAAATTCATATAAAAGTTGCGTTTAAGTTGTATTAAAAATAGATATATAAGAAAAAATTCTTT
 641 CACTTGATGTTTGTTAGACCAGAAAGTGTGTGTGTTCTGTAGCTCAGTTCCCAGACAGCTTTTTAGGTAGTGGAGGAGGT
 721 GGCTTCATGTGGCACTTGGGCATTTATATTCCACTTGGGAGGGTCAGGCTGTGGCCTTCTGGAGCAGGTGGCTTGTTAAG
 801 GAATGCTAGCAGGGCATGGCACGTGAGCTCCGGAATAGATGTCTTCATCACTTCTTCCACTGTGTGTTGACACTGTTTTC
 881 CTTACCTATTTCCTCAGATCCCCAGCTTTCTCCTCTGCTATGCATTTTCTTCACAGTGCAGCTTGCAGTCCGTTGCTGAA
 961 AATGATTATAAGCCCTGCATAATGTTAAGCTTTATTGTGATTACGTGTATGTTTCTTCTTTCTTTTAAGCAGACCCATAC
1041 CTTTCCAGGGTCAAAGTACAGAATAGAATACATTGATACAAAGTACAGAAAAATACTTTGATTTTTATCCATTTCTTTTA
1121 CTCTGTGTAAAGACTTGAGAAGTCTAATTCACAGGCAAACCAATACAGAATTGACTGCAGTTGAACAGACTAGAAGTATT
1201 TGTGGGAGGAGTGACATGAAGCATGAGTTATCTGATTTTTTTTGTAGCTGCTATATATTTTAAGCCTTCATTTGCAATTC
1281 ATGTAACAGTTGTGTCATAAATTACACAATAAAGCAGTCCTGTTCAAATTTTTTTTTAACGTGGCTTGTAGAATTTTTAA
1361 AAAAGTGATCTTAGGTTTGTTTTTTCATGCGGGATGCAGATGGGTGCTATCAGAGCCTCTCCCACACCACTATAGTGTAA
1441 TAATGTTATTATTACTCTACACTGAAACGTATTCAGAGTTAGATATTATTTTAGCTTCAGTTGTTCTTTAGAGGCTTTCA
1521 AATGTACCGATGATACTGTTTCTTGCACTGAATATATAAACACTCCACAGTGTTTATATTGGGAAGATATTGGGAAGGAA
1601 ATATATTTGTAAAAGATGAAGGCTGTATCTATTTTTTTTTCTTTTTAAAGTTTGTTCACTTAAATTCTTTTGAGGATGGG
1681 ATGTATTTTTCTTGCTGTTCAGTGCTTTTTCCTTTTCATCTGTTGTTCTGTGGTCACAGTGACCTTAGCTACATAGCAGA
1761 CTTTCCCAAATGTATTGATTACAAATAAACAGTTGTTACTTAGCAAGACCTGAAAATATGTCTGCAGGTTTCTCCTTGAA
1841 GCAAATGTGTGGGATCATTGCATTTCCAGAAATCTGCCTCCTTCACCCTCCGTTGACAGTATATGTCATGCCTCACTTTC
1921 TTCTAGCTGAGCTTTAAATCATTAGAGCTTAAATTGTCAGATCGTTCATTGCCTTTCCAGGGTTATTTAGTAAAGTTTGT
2001 TGAAAACAAAAACGCCTTTTCTTGGTTCTTTTTTCAGTTATTTTGAAGGTCCAGCATCCTGATTAAATGTCTGACACATT
2081 AATGAATGACCAGCAGCAGCTTTCAGCTCTTAAAAAGACACTTATATTTTGATTTTACATGCTGGTTACCTGTTCCATTG
2161 TTGTCAAATGCCCACTCTCCATCAGATGTGTTCCTCCATTTTCTTATCCACAAAGTACTCCTCACTTTTCAATTTGTCAT
2241 GTTACTAAATGGTGTTACATTAAAGCCCTGTGTTAAGTGTCTGCTTTTGACTGAATTTCTTCATAGTAACCTTCAGTGTG
2321 TGTGTGTGACTATGTTCAATTAGTGGGTTGATCTTCGTATAATTGGCCACTATGTGAGAGTTCACTACTAGGCAGAAACT
2401 ATTATGGACAGTGAAATAATGACTTTTATCTCACCACGTGAGTTTGATGCAGTCTTTTCTGTCTAGCCCTTGCCTCTTCC
2481 TGCCCATGTGATTGCGGTGCAGTAGTTTCTGTTGTATAATAGTGTGGACAGCAGCTCAGAAAAGGAGGGAATGCTACTGA
2561 TAATTTGTAGATAATATTCTTTAAGACTTAGGGGAACCATTGAACTTTGAAATTTTTATTAGAAAATTATTTGTTCAGAA
2641 TCAGACTCCATTATTTTACATATACTTAAATACTTTAGGGGTATTTTTGAAAGTTAGCCCAGTTTTTTATGTGCTATTAA
2721 ATTTTTAGATTACATACTAAAGAAAAGTATGTACACAGAATGTAGTGCTCCTAGTTACTATTTTTTCTATTAAGAAATAG
2801 TTTAGTTCTGGTGTAAAATTTGTTTGAATGCTAAAAAAAAAAAAGCAGGACTGCATTATGGCACTTTTGCCTTGGTGGCC
2881 CACTTTCTCCATTTAAAACATTAGGATTTGTATTTTTCTGCTGCGTTTGTATGAAGACATATTTGATTGTTGTTTTCTCT
2961 TGATTTTAAAATAAAACCTCATGAGCCCTAGTAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGG----UAAUACAC-GACGAu 5'
             ||:||    :||| ||| ||||| 
Target 5' ttaAAGCCCTGTGTTAAGTGTCTGCTt 3'
2260 - 2286 133.00 -12.20
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |:: || | |||||:| 
Target 5' gatgtATTTTTCT-TGCTGTTc 3'
1680 - 1700 132.00 -6.60
3
miRNA  3' guGUUUGGUAAU-----AC--------ACGACGau 5'
            :||| |||||     ||        ||||||  
Target 5' ttTAAAACATTAGGATTTGTATTTTTCTGCTGCgt 3'
2892 - 2926 130.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30151318 34 COSMIC
COSN30174756 72 COSMIC
COSN30530215 105 COSMIC
COSN28162017 131 COSMIC
COSN31484304 144 COSMIC
COSN30128410 181 COSMIC
COSN23000113 261 COSMIC
COSN27340002 275 COSMIC
COSN22246427 598 COSMIC
COSN31529224 638 COSMIC
COSN6285503 643 COSMIC
COSN22251617 776 COSMIC
COSN31564624 785 COSMIC
COSN30539939 792 COSMIC
COSN14764560 805 COSMIC
COSN31526431 863 COSMIC
COSN8492470 881 COSMIC
COSN26648464 886 COSMIC
COSN31592044 1001 COSMIC
COSN31516193 1116 COSMIC
COSN28806860 1138 COSMIC
COSN31483124 1151 COSMIC
COSN26644015 1189 COSMIC
COSN21397536 1254 COSMIC
COSN26151045 1256 COSMIC
COSN4846657 1264 COSMIC
COSN31547461 1301 COSMIC
COSN31535069 1328 COSMIC
COSN31553292 1345 COSMIC
COSN31572069 1530 COSMIC
COSN30542298 1555 COSMIC
COSN24301397 1583 COSMIC
COSN31563005 1595 COSMIC
COSN29593704 1641 COSMIC
COSN20102274 1651 COSMIC
COSN20490452 1652 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1328373866 4 dbSNP
rs1428761525 5 dbSNP
rs772806133 6 dbSNP
rs1348661098 10 dbSNP
rs762698553 11 dbSNP
rs766069353 13 dbSNP
rs372523907 19 dbSNP
rs751157767 21 dbSNP
rs200489430 23 dbSNP
rs756569666 25 dbSNP
rs1444878876 27 dbSNP
rs764334946 29 dbSNP
rs754419547 32 dbSNP
rs1455183229 34 dbSNP
rs376853046 36 dbSNP
rs181704268 40 dbSNP
rs1319360171 43 dbSNP
rs745883773 45 dbSNP
rs201943117 48 dbSNP
rs1387557194 52 dbSNP
rs369412541 59 dbSNP
rs747165153 65 dbSNP
rs944181137 72 dbSNP
rs186409621 73 dbSNP
rs1301170965 74 dbSNP
rs1370093725 85 dbSNP
rs866118322 87 dbSNP
rs901633083 92 dbSNP
rs776237617 94 dbSNP
rs1348246475 95 dbSNP
rs1355106462 99 dbSNP
rs748124474 105 dbSNP
rs1032034423 109 dbSNP
rs769785906 111 dbSNP
rs189975498 115 dbSNP
rs1189369088 116 dbSNP
rs762608998 117 dbSNP
rs1251717844 121 dbSNP
rs1433157006 122 dbSNP
rs1265289040 128 dbSNP
rs1208014256 138 dbSNP
rs765802032 141 dbSNP
rs1365976320 144 dbSNP
rs1468923584 146 dbSNP
rs1158715934 150 dbSNP
rs1395424154 162 dbSNP
rs1463097587 164 dbSNP
rs72809773 165 dbSNP
rs1011520237 166 dbSNP
rs879376573 172 dbSNP
rs1019379175 174 dbSNP
rs1309040594 179 dbSNP
rs1022862099 184 dbSNP
rs965091180 190 dbSNP
rs1320972142 200 dbSNP
rs1386749626 201 dbSNP
rs975287020 208 dbSNP
rs969889834 216 dbSNP
rs1428218161 221 dbSNP
rs1002669493 225 dbSNP
rs1466521288 234 dbSNP
rs1295001965 249 dbSNP
rs952686367 262 dbSNP
rs1267956138 263 dbSNP
rs1324485281 263 dbSNP
rs1451015095 263 dbSNP
rs397724671 263 dbSNP
rs530585026 263 dbSNP
rs984432793 263 dbSNP
rs766797346 271 dbSNP
rs1385835189 275 dbSNP
rs77294431 275 dbSNP
rs75878741 277 dbSNP
rs961517580 281 dbSNP
rs1320819662 285 dbSNP
rs973213216 296 dbSNP
rs919962315 299 dbSNP
rs918011713 305 dbSNP
rs949446019 314 dbSNP
rs1231878407 318 dbSNP
rs1299707234 325 dbSNP
rs1285758681 327 dbSNP
rs1333160810 332 dbSNP
rs1408476436 336 dbSNP
rs1370361482 345 dbSNP
rs952690544 355 dbSNP
rs1411905361 363 dbSNP
rs1288207090 364 dbSNP
rs564169084 365 dbSNP
rs1172122883 368 dbSNP
rs1478392645 369 dbSNP
rs1327165660 371 dbSNP
rs1431449800 372 dbSNP
rs1201514969 377 dbSNP
rs776200196 387 dbSNP
rs375900004 390 dbSNP
rs780805419 403 dbSNP
rs1045259381 404 dbSNP
rs1210743231 405 dbSNP
rs1250857340 406 dbSNP
rs1268837184 413 dbSNP
rs911440805 415 dbSNP
rs370981397 418 dbSNP
rs905345531 418 dbSNP
rs1488304736 426 dbSNP
rs1341719529 427 dbSNP
rs1054444207 428 dbSNP
rs181194158 435 dbSNP
rs1041250887 440 dbSNP
rs866242854 454 dbSNP
rs1227125544 457 dbSNP
rs934451957 459 dbSNP
rs1433501286 461 dbSNP
rs567394136 462 dbSNP
rs1289422976 471 dbSNP
rs1444797598 480 dbSNP
rs764606847 481 dbSNP
rs1409582280 484 dbSNP
rs900942917 518 dbSNP
rs947003756 521 dbSNP
rs1156979569 523 dbSNP
rs1455625384 528 dbSNP
rs1473531397 528 dbSNP
rs1411134156 533 dbSNP
rs1177642086 546 dbSNP
rs1471044340 547 dbSNP
rs14539 549 dbSNP
rs1159337753 557 dbSNP
rs1186428894 564 dbSNP
rs1461459967 565 dbSNP
rs1028188003 568 dbSNP
rs1206257520 579 dbSNP
rs1329137032 581 dbSNP
rs1269315900 582 dbSNP
rs905816008 586 dbSNP
rs1393067838 588 dbSNP
rs1003192490 598 dbSNP
rs528901989 599 dbSNP
rs983929435 600 dbSNP
rs1393359182 605 dbSNP
rs1318690371 620 dbSNP
rs1434464858 620 dbSNP
rs1389387516 621 dbSNP
rs149563069 624 dbSNP
rs752285763 639 dbSNP
rs896961023 641 dbSNP
rs1162403012 647 dbSNP
rs1288108927 659 dbSNP
rs536440692 663 dbSNP
rs994280465 672 dbSNP
rs1186197841 680 dbSNP
rs1026996706 686 dbSNP
rs1464052506 689 dbSNP
rs1242126806 691 dbSNP
rs1349243427 699 dbSNP
rs1230751609 700 dbSNP
rs868476341 704 dbSNP
rs866137408 705 dbSNP
rs1803234 720 dbSNP
rs1247161347 729 dbSNP
rs1361949512 737 dbSNP
rs1242908382 738 dbSNP
rs1267398853 740 dbSNP
rs1488689125 741 dbSNP
rs1018223093 743 dbSNP
rs1432857210 748 dbSNP
rs965629281 751 dbSNP
rs41285553 756 dbSNP
rs1425059514 760 dbSNP
rs369969678 769 dbSNP
rs1484023583 777 dbSNP
rs1166343538 781 dbSNP
rs527870998 783 dbSNP
rs936837897 786 dbSNP
rs552400468 791 dbSNP
rs1187731391 803 dbSNP
rs7566 805 dbSNP
rs531724836 806 dbSNP
rs1421494063 807 dbSNP
rs79607635 823 dbSNP
rs892737311 824 dbSNP
rs1204745747 825 dbSNP
rs945588012 828 dbSNP
rs1297881340 832 dbSNP
rs539324552 833 dbSNP
rs1365484313 839 dbSNP
rs558503316 845 dbSNP
rs1282564867 850 dbSNP
rs1405419928 851 dbSNP
rs1367230784 859 dbSNP
rs1305906253 861 dbSNP
rs1428745406 861 dbSNP
rs549884638 862 dbSNP
rs757110209 873 dbSNP
rs900826791 874 dbSNP
rs1428689393 879 dbSNP
rs1430957236 880 dbSNP
rs1307861159 882 dbSNP
rs1369059337 884 dbSNP
rs1423789464 885 dbSNP
rs996646185 898 dbSNP
rs1309112550 902 dbSNP
rs947114974 903 dbSNP
rs1028489578 907 dbSNP
rs144218225 914 dbSNP
rs1181885454 918 dbSNP
rs1481116681 921 dbSNP
rs1394299365 924 dbSNP
rs1213658217 930 dbSNP
rs1314940398 941 dbSNP
rs1208199823 950 dbSNP
rs1005808092 951 dbSNP
rs148801233 952 dbSNP
rs1224076827 953 dbSNP
rs938634536 964 dbSNP
rs1227921926 974 dbSNP
rs1286277518 990 dbSNP
rs961298415 997 dbSNP
rs1373707024 1002 dbSNP
rs1272261290 1005 dbSNP
rs759495964 1006 dbSNP
rs553775032 1008 dbSNP
rs1358103544 1013 dbSNP
rs1176483143 1014 dbSNP
rs1236774326 1018 dbSNP
rs1410386297 1043 dbSNP
rs1482232347 1047 dbSNP
rs1158976157 1049 dbSNP
rs1024966165 1050 dbSNP
rs749412590 1051 dbSNP
rs1183154702 1060 dbSNP
rs755249769 1061 dbSNP
rs994372412 1062 dbSNP
rs1483023068 1065 dbSNP
rs778816636 1066 dbSNP
rs980757668 1071 dbSNP
rs1027029203 1073 dbSNP
rs1325652104 1074 dbSNP
rs888565579 1085 dbSNP
rs1266174545 1103 dbSNP
rs926708777 1119 dbSNP
rs1166281092 1122 dbSNP
rs1388726681 1129 dbSNP
rs566013283 1135 dbSNP
rs6639 1138 dbSNP
rs1393968459 1144 dbSNP
rs1171734592 1145 dbSNP
rs989666816 1150 dbSNP
rs772199194 1153 dbSNP
rs914056460 1155 dbSNP
rs965736435 1156 dbSNP
rs185246993 1159 dbSNP
rs1304717040 1169 dbSNP
rs977046017 1172 dbSNP
rs879508588 1181 dbSNP
rs773705930 1182 dbSNP
rs1295616948 1186 dbSNP
rs1367113779 1195 dbSNP
rs747520242 1199 dbSNP
rs989689533 1201 dbSNP
rs1228953415 1205 dbSNP
rs915403210 1217 dbSNP
rs947146068 1232 dbSNP
rs1204519774 1236 dbSNP
rs1476170306 1236 dbSNP
rs922304184 1238 dbSNP
rs979828691 1239 dbSNP
rs1310419081 1245 dbSNP
rs932315021 1253 dbSNP
rs1049373770 1256 dbSNP
rs1315314052 1258 dbSNP
rs926962828 1281 dbSNP
rs1212113093 1297 dbSNP
rs771232263 1304 dbSNP
rs73342141 1310 dbSNP
rs1383309050 1312 dbSNP
rs1057055544 1317 dbSNP
rs1292205992 1324 dbSNP
rs183274640 1326 dbSNP
rs1014164616 1329 dbSNP
rs918460598 1332 dbSNP
rs11552423 1337 dbSNP
rs555502467 1341 dbSNP
rs564131238 1342 dbSNP
rs201052762 1349 dbSNP
rs1024177877 1354 dbSNP
rs929907592 1360 dbSNP
rs1193970394 1372 dbSNP
rs969966922 1374 dbSNP
rs1263760896 1376 dbSNP
rs1449696067 1378 dbSNP
rs12054833 1381 dbSNP
rs1292165136 1386 dbSNP
rs759072913 1391 dbSNP
rs573515559 1392 dbSNP
rs1039734679 1395 dbSNP
rs1033662613 1401 dbSNP
rs1424879234 1404 dbSNP
rs901183240 1407 dbSNP
rs958388305 1410 dbSNP
rs1328772645 1432 dbSNP
rs115376279 1433 dbSNP
rs1404830208 1434 dbSNP
rs1031000398 1437 dbSNP
rs779001986 1438 dbSNP
rs1178819405 1442 dbSNP
rs114977196 1449 dbSNP
rs186072913 1450 dbSNP
rs545971791 1456 dbSNP
rs1396028580 1462 dbSNP
rs976881362 1467 dbSNP
rs969519563 1469 dbSNP
rs762507828 1470 dbSNP
rs922856192 1481 dbSNP
rs1431722035 1489 dbSNP
rs927000096 1493 dbSNP
rs1201289600 1499 dbSNP
rs1481902248 1503 dbSNP
rs10387 1510 dbSNP
rs909534750 1514 dbSNP
rs1301823307 1516 dbSNP
rs992942401 1527 dbSNP
rs918246096 1529 dbSNP
rs1223484817 1530 dbSNP
rs542417257 1532 dbSNP
rs1285654681 1533 dbSNP
rs1036737033 1539 dbSNP
rs774532512 1539 dbSNP
rs1382695882 1547 dbSNP
rs1206353038 1549 dbSNP
rs896870406 1556 dbSNP
rs1014051618 1557 dbSNP
rs1400194429 1561 dbSNP
rs1175757571 1562 dbSNP
rs3205295 1568 dbSNP
rs1469269152 1570 dbSNP
rs1381496517 1576 dbSNP
rs531792454 1576 dbSNP
rs191672196 1587 dbSNP
rs568582434 1591 dbSNP
rs757733815 1593 dbSNP
rs529271064 1601 dbSNP
rs559502011 1605 dbSNP
rs757273948 1607 dbSNP
rs1001442098 1615 dbSNP
rs909733691 1627 dbSNP
rs1246526803 1631 dbSNP
rs1034127469 1632 dbSNP
rs1240780380 1632 dbSNP
rs200739493 1632 dbSNP
rs183513154 1633 dbSNP
rs11552425 1642 dbSNP
rs1260373076 1642 dbSNP
rs1021054430 1644 dbSNP
rs1444682096 1645 dbSNP
rs565822699 1648 dbSNP
rs976933955 1649 dbSNP
rs1408303635 1650 dbSNP
rs386695662 1650 dbSNP
rs68137334 1650 dbSNP
rs745909899 1650 dbSNP
rs1135225 1651 dbSNP
rs745562437 1651 dbSNP
rs774120287 1651 dbSNP
rs55868831 1652 dbSNP
rs1135233 1653 dbSNP
rs56396231 1654 dbSNP
rs1401531027 1655 dbSNP
rs1323086136 1683 dbSNP
rs922775449 1707 dbSNP
rs188296106 1710 dbSNP
rs112003561 1718 dbSNP
rs1039767337 1722 dbSNP
rs901294953 1727 dbSNP
rs1438263113 1733 dbSNP
rs1303527122 1734 dbSNP
rs985721244 1740 dbSNP
rs1214312047 1744 dbSNP
rs1349859990 1754 dbSNP
rs1285448848 1755 dbSNP
rs745974745 1758 dbSNP
rs1225814560 1762 dbSNP
rs1226475817 1765 dbSNP
rs998276078 1782 dbSNP
rs193007848 1787 dbSNP
rs1246912020 1792 dbSNP
rs1385113366 1798 dbSNP
rs779184219 1804 dbSNP
rs573725317 1816 dbSNP
rs892446841 1827 dbSNP
rs1011179324 1836 dbSNP
rs1350714765 1843 dbSNP
rs1318805007 1848 dbSNP
rs1363424380 1850 dbSNP
rs748387528 1850 dbSNP
rs540646681 1862 dbSNP
rs1162564881 1863 dbSNP
rs560386963 1885 dbSNP
rs577234327 1887 dbSNP
rs1002332403 1892 dbSNP
rs1035191430 1893 dbSNP
rs1450245459 1894 dbSNP
rs1046000960 1901 dbSNP
rs546041302 1902 dbSNP
rs564449987 1903 dbSNP
rs1054377244 1911 dbSNP
rs576221287 1914 dbSNP
rs377378185 1921 dbSNP
rs1414302283 1925 dbSNP
rs1361834880 1926 dbSNP
rs1470520106 1929 dbSNP
rs1259543527 1933 dbSNP
rs1214060245 1961 dbSNP
rs1362673878 1963 dbSNP
rs1162894407 1964 dbSNP
rs370879198 1965 dbSNP
rs1343447085 1970 dbSNP
rs1302266097 1974 dbSNP
rs1424951466 1981 dbSNP
rs1407280416 1992 dbSNP
rs951023892 2000 dbSNP
rs1010922403 2008 dbSNP
rs984011931 2014 dbSNP
rs758406513 2015 dbSNP
rs144960904 2016 dbSNP
rs529425881 2018 dbSNP
rs1479718912 2029 dbSNP
rs1268686167 2032 dbSNP
rs1200587511 2038 dbSNP
rs182647727 2064 dbSNP
rs147950214 2083 dbSNP
rs1249843912 2084 dbSNP
rs1335850654 2085 dbSNP
rs547473358 2090 dbSNP
rs1308179114 2091 dbSNP
rs140130673 2091 dbSNP
rs1220434146 2092 dbSNP
rs1281921796 2094 dbSNP
rs1321304668 2098 dbSNP
rs1358084897 2100 dbSNP
rs934091682 2112 dbSNP
rs1052505413 2118 dbSNP
rs1369377635 2121 dbSNP
rs892473830 2126 dbSNP
rs41285555 2133 dbSNP
rs1354643282 2134 dbSNP
rs962905426 2151 dbSNP
rs1468756479 2161 dbSNP
rs1429194899 2172 dbSNP
rs1135895 2175 dbSNP
rs1177700002 2178 dbSNP
rs1044003910 2181 dbSNP
rs1135903 2186 dbSNP
rs1203652021 2188 dbSNP
rs570004455 2195 dbSNP
rs747469601 2199 dbSNP
rs1135927 2204 dbSNP
rs918235636 2209 dbSNP
rs1135933 2211 dbSNP
rs140149869 2212 dbSNP
rs949832978 2215 dbSNP
rs186833378 2216 dbSNP
rs927159479 2219 dbSNP
rs1313761949 2224 dbSNP
rs1304545102 2225 dbSNP
rs1035622220 2240 dbSNP
rs1473921251 2242 dbSNP
rs937195317 2257 dbSNP
rs1389346156 2260 dbSNP
rs1332872552 2266 dbSNP
rs896629500 2270 dbSNP
rs1054664884 2275 dbSNP
rs112842867 2283 dbSNP
rs1404648650 2288 dbSNP
rs149884719 2292 dbSNP
rs1471221287 2303 dbSNP
rs1362466427 2305 dbSNP
rs1158804489 2311 dbSNP
rs1025359103 2315 dbSNP
rs145062176 2316 dbSNP
rs945926497 2316 dbSNP
rs1181900571 2320 dbSNP
rs1460938156 2324 dbSNP
rs529820660 2325 dbSNP
rs1170422947 2335 dbSNP
rs1204256390 2341 dbSNP
rs951056156 2343 dbSNP
rs983792658 2344 dbSNP
rs1016549410 2346 dbSNP
rs963961204 2358 dbSNP
rs1311017231 2360 dbSNP
rs376986405 2360 dbSNP
rs1029748346 2371 dbSNP
rs1315103153 2384 dbSNP
rs889834279 2391 dbSNP
rs1007072791 2400 dbSNP
rs1288721473 2402 dbSNP
rs1454630624 2405 dbSNP
rs765385174 2408 dbSNP
rs1296338824 2411 dbSNP
rs1444194219 2419 dbSNP
rs1385981839 2422 dbSNP
rs1364930477 2424 dbSNP
rs1425556790 2424 dbSNP
rs1017496079 2426 dbSNP
rs962956492 2429 dbSNP
rs1226736327 2433 dbSNP
rs1287845581 2436 dbSNP
rs1219852754 2438 dbSNP
rs1358262767 2439 dbSNP
rs1291941963 2451 dbSNP
rs1246341933 2457 dbSNP
rs552814991 2460 dbSNP
rs539407718 2469 dbSNP
rs1383217863 2471 dbSNP
rs933809517 2480 dbSNP
rs1340742147 2485 dbSNP
rs1424316552 2488 dbSNP
rs577177584 2490 dbSNP
rs144876317 2496 dbSNP
rs981477322 2497 dbSNP
rs1276629709 2498 dbSNP
rs1460542144 2500 dbSNP
rs1372528481 2510 dbSNP
rs927074140 2518 dbSNP
rs958673930 2520 dbSNP
rs1265129491 2524 dbSNP
rs913947983 2528 dbSNP
rs1197004637 2530 dbSNP
rs1490102600 2532 dbSNP
rs1269155442 2533 dbSNP
rs1211202379 2536 dbSNP
rs990020472 2554 dbSNP
rs1462671925 2557 dbSNP
rs1228841993 2558 dbSNP
rs558025689 2561 dbSNP
rs1281838351 2563 dbSNP
rs1043782253 2564 dbSNP
rs945978586 2570 dbSNP
rs576355655 2571 dbSNP
rs1325803622 2573 dbSNP
rs938281582 2577 dbSNP
rs1389850660 2578 dbSNP
rs114544285 2588 dbSNP
rs1168550303 2595 dbSNP
rs1466132813 2597 dbSNP
rs1190340099 2613 dbSNP
rs1425677546 2620 dbSNP
rs1373397401 2628 dbSNP
rs1174089762 2634 dbSNP
rs1477672988 2637 dbSNP
rs896656273 2649 dbSNP
rs923142630 2651 dbSNP
rs1200587736 2657 dbSNP
rs1435683784 2659 dbSNP
rs993642959 2664 dbSNP
rs1195859022 2665 dbSNP
rs1458665244 2667 dbSNP
rs1026897572 2668 dbSNP
rs1261830454 2671 dbSNP
rs886895178 2677 dbSNP
rs1051505277 2680 dbSNP
rs1324755157 2683 dbSNP
rs1276944927 2684 dbSNP
rs750700687 2692 dbSNP
rs140788068 2698 dbSNP
rs1007367960 2709 dbSNP
rs1449091409 2711 dbSNP
rs1403922917 2715 dbSNP
rs1038534006 2718 dbSNP
rs1436798120 2721 dbSNP
rs1425656725 2722 dbSNP
rs898661124 2739 dbSNP
rs1327350877 2740 dbSNP
rs1362857273 2743 dbSNP
rs1233187315 2745 dbSNP
rs994420377 2749 dbSNP
rs1025857102 2750 dbSNP
rs191252409 2756 dbSNP
rs1273528149 2758 dbSNP
rs1443479118 2772 dbSNP
rs1281242621 2792 dbSNP
rs972024241 2798 dbSNP
rs1002558472 2810 dbSNP
rs1280368588 2812 dbSNP
rs1242519017 2816 dbSNP
rs1204469407 2819 dbSNP
rs777048039 2821 dbSNP
rs1451884418 2825 dbSNP
rs1359657956 2826 dbSNP
rs1267572871 2829 dbSNP
rs1034410354 2832 dbSNP
rs1336008926 2832 dbSNP
rs1383909136 2833 dbSNP
rs1394033037 2833 dbSNP
rs35136597 2833 dbSNP
rs1182433188 2834 dbSNP
rs1473452972 2844 dbSNP
rs1239733230 2846 dbSNP
rs1191589354 2854 dbSNP
rs532548014 2856 dbSNP
rs1463753700 2863 dbSNP
rs1219119971 2869 dbSNP
rs770112629 2871 dbSNP
rs1291201622 2873 dbSNP
rs1029545564 2879 dbSNP
rs1246797945 2879 dbSNP
rs1381343415 2880 dbSNP
rs955386216 2886 dbSNP
rs988030075 2888 dbSNP
rs913729221 2890 dbSNP
rs1450760961 2891 dbSNP
rs559899363 2896 dbSNP
rs555900257 2904 dbSNP
rs763303909 2927 dbSNP
rs926623243 2930 dbSNP
rs1415267225 2938 dbSNP
rs762696500 2938 dbSNP
rs923196525 2939 dbSNP
rs775702526 2943 dbSNP
rs933210275 2943 dbSNP
rs533358549 2944 dbSNP
rs1489940033 2947 dbSNP
rs1268451787 2952 dbSNP
rs1222521889 2960 dbSNP
rs551847501 2963 dbSNP
rs768223128 2965 dbSNP
rs911201592 2970 dbSNP
rs937993689 2979 dbSNP
rs1212787698 2981 dbSNP
rs942834473 2992 dbSNP
rs1278681262 2997 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUACA-CGACGAu 5'
             :| :: || ||| |||||| 
Target 5' ---GAUUUUUUUUGUAGCUGCUa 3'
1 - 20
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000247461.4 | 3UTR | GAUUUUUUUUGUAGCUGCUAUAUAUUUUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.651 9.4e-4 0.738 1.0e-4 20 Click to see details
GSE21032 Prostate cancer 0.287 4.3e-3 0.229 1.9e-2 83 Click to see details
GSE32688 Pancreatic cancer -0.343 2.7e-2 -0.236 9.7e-2 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.379 3.7e-2 0.359 4.6e-2 23 Click to see details
GSE19536 Breast cancer -0.168 4.7e-2 -0.151 6.7e-2 100 Click to see details
GSE27834 Pluripotent stem cells -0.356 8.8e-2 -0.397 6.4e-2 16 Click to see details
GSE14794 Lymphoblastoid cells 0.136 1.0e-1 0.096 1.8e-1 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.286 1.1e-1 -0.239 1.6e-1 20 Click to see details
GSE17306 Multiple myeloma 0.176 1.1e-1 0.063 3.3e-1 49 Click to see details
GSE19783 ER- ER- breast cancer -0.135 1.2e-1 -0.144 1.0e-1 79 Click to see details
GSE21849 B cell lymphoma -0.18 1.8e-1 -0.032 4.3e-1 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.128 2.7e-1 -0.028 4.5e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.13 2.7e-1 -0.117 2.9e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.111 3.0e-1 0.075 3.6e-1 25 Click to see details
GSE28544 Breast cancer -0.06 3.9e-1 -0.454 1.3e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.034 3.9e-1 0.065 3.0e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.073 4.1e-1 0.210 2.6e-1 12 Click to see details
GSE17498 Multiple myeloma 0.019 4.5e-1 0.002 5.0e-1 40 Click to see details
GSE28260 Renal cortex and medulla 0.029 4.6e-1 -0.049 4.4e-1 13 Click to see details
GSE38226 Liver fibrosis -0.01 4.8e-1 -0.090 3.5e-1 21 Click to see details
GSE38226 Liver fibrosis -0.01 4.8e-1 -0.090 3.5e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.92 0 -0.883 0 9 Click to see details
LUSC -0.361 0.01 -0.408 0.01 38 Click to see details
THCA -0.277 0.02 -0.247 0.03 59 Click to see details
STAD 0.369 0.02 0.386 0.01 32 Click to see details
KIRC 0.163 0.09 0.083 0.25 68 Click to see details
KICH 0.258 0.11 0.272 0.09 25 Click to see details
HNSC -0.16 0.16 -0.059 0.36 42 Click to see details
PCPG -0.837 0.18 -0.500 0.33 3 Click to see details
COAD -0.365 0.19 -0.595 0.06 8 Click to see details
LUAD -0.247 0.22 -0.357 0.13 12 Click to see details
PAAD -0.538 0.23 -0.800 0.1 4 Click to see details
KIRP 0.127 0.24 0.146 0.21 32 Click to see details
BLCA -0.151 0.27 -0.158 0.27 18 Click to see details
ESCA 0.164 0.31 0.164 0.31 11 Click to see details
LIHC -0.046 0.38 -0.025 0.43 49 Click to see details
CESC 0.273 0.41 0.500 0.33 3 Click to see details
UCEC 0.039 0.44 -0.002 0.5 19 Click to see details
BRCA -0.013 0.45 -0.030 0.39 84 Click to see details
PRAD -0.009 0.48 0.068 0.32 50 Click to see details
PRAD -0.009 0.48 0.068 0.32 50 Click to see details
PRAD -0.009 0.48 0.068 0.32 50 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*