miRTarBase - #MIRT088102 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SEPT2   
Synonyms DIFF6, NEDD-5, NEDD5, Pnutl3, hNedd5
Description septin 2
Transcript NM_001008491   
Other Transcripts NM_001008492 , NM_004404 , NM_006155   
Expression
Putative miRNA Targets on SEPT2
3'UTR of SEPT2
(miRNA target sites are highlighted)
>SEPT2|NM_001008491|3'UTR
   1 GGTGATGTGCACATATCAAGAAGTCAGAGAAAACACTTTCCTGGATAAAAAAGAAAACATTCCAGATGCATGATCCAGCT
  81 GTGTGTTTTCAATCCTTGGGAGGGTGCCATCCACATTTTAACAGTACCTGTGCCTGAGAATTTAATTTTTAAAAGACTTT
 161 GATGTGTTTTTGTATGAAGTACTTTTAACGTATGTATTTCATTGCTGTGTCACACTCTGTGTTTTGTGAGGTGAATGTCT
 241 TCCTTTTCTTTCTCCCTAACCACTAATGTTAGAATTGATTTCCAAGAATCGGCATGTATACTTAATACTGAATTTCTTTG
 321 ATTTAACTGACTTAACAACTGACTAACCATTGATGAGCACTCCTGATTTTTATCTAGAACATTCAGATTTACCATAATGT
 401 TCCTTAGTGGTAGAGGTGTGTGCCTAGTGATGTAGAAAGATACACTGACTTGGTGCAAGGCCATCTGCTTACCACATCAC
 481 ACCACTTGGAGATCTTTGCTTCCTTGCTTTTATGTTTGTACACAACACCTAAAACCAGTTTTGCTGCTATAATTCTATAC
 561 TGTTGATTCGTCTGCGATTTTATCTGTTAACCAAATAAAACATAATAGAATTTCCTAATGAGATATATCTTTATACTTAA
 641 ACAGCTTTTTTAGAGGTGAGTTTTAAAGAAGTCTCTTAATTCTGATGCTAGGTTGTTTTTAAAACCACTATGCAAAGAAC
 721 TCACCACAAGCCACCTTTTGTAGTGTTCTCCACTAATACTGGTTATCCTGTGCTACAGAGAAAATCAAAGCAGTCATAAG
 801 CTCCAGTTTTCGTATTGCAAATAAGACTCTTACCTACAAAATGAGATTCAGTGAACTAATTTGGTTTTTACTCAACCAAA
 881 TTAAAAATTTTTTTAAGGAAAATTAGCAGTTGGTCTATTCAGAATCAAACCTTTTTATATTTTATACTGCACTTTAGTGT
 961 ATTTTCTGTCACTGTAGGTATAGAAGATCTGCCTCCCCTGTGGAAATTGGGGTCTGTTGGTGGGCGTGCCCCTGAAGCCT
1041 GGCTTGGGTTGAAAAGTGTTCCCGCCCTAAGGCCTTGGTGCCCTGAACCTCTGATGCCTACCGGGTTCTCCTGATTTGAG
1121 TTTCCTTTAAATACTCCCTTTTTGAGTAATTTTCTGATGGGAGGAAAGTAGCAGTCATCATCTTTTTGTGTGCAGGCTGT
1201 CTCATTTATTTTTAGCCATTGTCGTTTCATTCATTTTGTGTAATATAAACCGTGTGTCATGTCAAAGTGAAAGACATTTC
1281 AAATCTGTAGCATAGGCTAGTGGGCAGGTCCGCACAGTCGAAGCCACACCTGGTCTGTTTTCTGTGCACTGTAGCCTTAG
1361 TGTCACCTTTCTTCTTGTGTCTCCTTATGGTACACTCCAGCGGTTGCCTTTTTTATCATTTCTACTGAAGTTGGGAAATT
1441 CAACCCCAGAAATTGACAGATGAAAGGAGACAATGGTTGTGTAGGGAGATGGAGAAAATGCTTAATCTGAGGATGAGACA
1521 GGGTTTTTTCATTTTTGTGGGGGCTAGAAAAAACATAAAATGAGGCAGTTAAATAATAATAGTTAATGAAGGTGTGCTAC
1601 AGAAAATAATCTGGTGTTCTTGCTAACTTTGCCCTTCACTGTTGCTTAATTGTGAACAGCCAAAAGCTATATGTTATGGC
1681 TTATTGTGTGAAGGTAACTAAGAAGTGGTGTTCCATGACTTCAGAGTACATCCATGCGGAGTCCATTATTTGAGTTTGAC
1761 ATTTAATAACTTTGCTGGAAAATCTGTAAAAAAGAAAAACAAGTTTGCTAGTGACTAAGCCCCGCATATGTGAGTGAAAG
1841 TACTTCAGGCACGCTGCCTCCTGGTAACAGCTATGCAGGGAGGGAGGACCCACACTGCTACACTTCTGATCCCCTTTGGT
1921 TTTACTACCCAAATCTAAATAGATACTTTTGATAATAGATAACTGCTCTTTTACTAAGACATAGTCTCTACCTATAGAAA
2001 TGTATTTTGAAAACACTTATTTTACACAGCAATTTTGTATCCATTTAAACTAACCTTTTATCAATAAAGCACTATTGTTT
2081 AGATATTAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||||| | | ||||||| 
Target 5' ctaAAACCAGT-TTTGCTGCTa 3'
529 - 549 166.00 -16.60
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               :|| ||   ||:|||| 
Target 5' actttGCCCTTCACTGTTGCTt 3'
1626 - 1647 133.00 -8.20
3
miRNA  3' gugUUUGGUAAU--ACACGACGAu 5'
             |: |: |||  | || |||| 
Target 5' agaAGTCTCTTAATTCTGATGCTa 3'
667 - 690 121.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26577484 35 COSMIC
COSN29065472 254 COSMIC
COSN29092966 691 COSMIC
COSN9997673 701 COSMIC
COSN9997674 703 COSMIC
COSN21894942 1206 COSMIC
COSN30050527 1312 COSMIC
COSN23802926 1471 COSMIC
COSN17770476 1918 COSMIC
COSN31515800 1922 COSMIC
COSN30045388 2050 COSMIC
COSN22723299 2138 COSMIC
COSN28673252 2155 COSMIC
COSN26566607 2193 COSMIC
COSN30045389 2253 COSMIC
COSN26557300 2282 COSMIC
COSN30045390 2329 COSMIC
COSN21346701 2332 COSMIC
COSN21895814 2372 COSMIC
COSN17913160 2719 COSMIC
COSN17076522 2814 COSMIC
COSN16362557 2842 COSMIC
COSN31961812 2988 COSMIC
COSN30045391 3037 COSMIC
COSN5500991 3424 COSMIC
COSN6557559 3427 COSMIC
COSN26396541 3438 COSMIC
COSN19540447 3610 COSMIC
COSN30045392 3682 COSMIC
COSN20781832 3722 COSMIC
COSN30167056 3733 COSMIC
rs182193570 3110 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs141633203 1 dbSNP
rs1233953899 2 dbSNP
rs779394569 5 dbSNP
rs1052484753 8 dbSNP
rs201771016 12 dbSNP
rs1257954019 14 dbSNP
rs773364655 16 dbSNP
rs747113316 17 dbSNP
rs1049886511 18 dbSNP
rs1319592947 20 dbSNP
rs770956384 21 dbSNP
rs1322466716 23 dbSNP
rs776540722 24 dbSNP
rs1265436833 36 dbSNP
rs759563424 40 dbSNP
rs1207103920 45 dbSNP
rs765070526 47 dbSNP
rs1233928300 49 dbSNP
rs1471206205 51 dbSNP
rs1165264920 56 dbSNP
rs1255880738 66 dbSNP
rs1029270321 72 dbSNP
rs3217007 75 dbSNP
rs397722876 75 dbSNP
rs67006635 76 dbSNP
rs72543522 77 dbSNP
rs111967433 79 dbSNP
rs889446857 83 dbSNP
rs564891671 93 dbSNP
rs1019371351 101 dbSNP
rs966541849 114 dbSNP
rs1371411879 124 dbSNP
rs1477503837 126 dbSNP
rs999329969 134 dbSNP
rs1321354598 139 dbSNP
rs1171324653 144 dbSNP
rs1402318878 152 dbSNP
rs1468135154 157 dbSNP
rs1006836328 160 dbSNP
rs564617779 176 dbSNP
rs1372995088 177 dbSNP
rs1326336318 185 dbSNP
rs1169204407 187 dbSNP
rs1435230908 189 dbSNP
rs1347776543 194 dbSNP
rs745604366 197 dbSNP
rs990738588 200 dbSNP
rs1397481213 205 dbSNP
rs1292929506 214 dbSNP
rs532106842 215 dbSNP
rs970079600 218 dbSNP
rs1192154738 221 dbSNP
rs1488253187 231 dbSNP
rs1279509226 232 dbSNP
rs79517978 237 dbSNP
rs1202318941 239 dbSNP
rs928691147 241 dbSNP
rs1225994543 243 dbSNP
rs1037139509 244 dbSNP
rs200565216 244 dbSNP
rs74439673 245 dbSNP
rs868663059 249 dbSNP
rs201635419 254 dbSNP
rs565726177 254 dbSNP
rs77576057 255 dbSNP
rs960379932 257 dbSNP
rs991768968 261 dbSNP
rs1305645319 268 dbSNP
rs1428319751 271 dbSNP
rs548025955 272 dbSNP
rs569489019 274 dbSNP
rs916515376 279 dbSNP
rs947993477 282 dbSNP
rs1194525046 285 dbSNP
rs1043996574 286 dbSNP
rs571086780 289 dbSNP
rs935130951 299 dbSNP
rs1251092877 303 dbSNP
rs1203135593 304 dbSNP
rs757508607 307 dbSNP
rs1052537525 318 dbSNP
rs1032205845 325 dbSNP
rs1378006020 327 dbSNP
rs1349512157 335 dbSNP
rs901907579 335 dbSNP
rs1467348294 341 dbSNP
rs558396127 342 dbSNP
rs1416125931 354 dbSNP
rs1357884371 360 dbSNP
rs1286791252 375 dbSNP
rs1465847193 375 dbSNP
rs1357716248 378 dbSNP
rs577976187 378 dbSNP
rs1050407728 381 dbSNP
rs1012614270 387 dbSNP
rs1023510562 389 dbSNP
rs1411541638 396 dbSNP
rs1180065118 400 dbSNP
rs889407004 404 dbSNP
rs1256759375 414 dbSNP
rs1359550735 415 dbSNP
rs535217340 416 dbSNP
rs1299564262 418 dbSNP
rs1209147561 423 dbSNP
rs981381945 428 dbSNP
rs1265901726 436 dbSNP
rs1234572160 437 dbSNP
rs1035757003 439 dbSNP
rs1314066477 442 dbSNP
rs1321862527 442 dbSNP
rs961466704 443 dbSNP
rs1377644569 450 dbSNP
rs538975216 451 dbSNP
rs1290956210 453 dbSNP
rs553871542 456 dbSNP
rs78091761 459 dbSNP
rs542734399 460 dbSNP
rs1025371662 469 dbSNP
rs911448774 473 dbSNP
rs943704029 482 dbSNP
rs1188934667 488 dbSNP
rs553573281 491 dbSNP
rs991820730 494 dbSNP
rs1245807207 495 dbSNP
rs902167634 499 dbSNP
rs1217604078 500 dbSNP
rs1265510483 505 dbSNP
rs370907748 508 dbSNP
rs1489859957 509 dbSNP
rs1190574817 513 dbSNP
rs1300507551 513 dbSNP
rs1267929583 517 dbSNP
rs1023301437 529 dbSNP
rs35598584 535 dbSNP
rs969425360 539 dbSNP
rs979385795 541 dbSNP
rs1434808238 542 dbSNP
rs1321775716 550 dbSNP
rs367729766 550 dbSNP
rs774634857 553 dbSNP
rs1156732267 575 dbSNP
rs1379440270 579 dbSNP
rs1053529568 582 dbSNP
rs572068887 595 dbSNP
rs1456493109 600 dbSNP
rs987958601 606 dbSNP
rs1435064247 617 dbSNP
rs576678390 619 dbSNP
rs923382836 620 dbSNP
rs758790382 649 dbSNP
rs1448643273 651 dbSNP
rs1050902622 659 dbSNP
rs1195287036 659 dbSNP
rs544151742 663 dbSNP
rs889133275 666 dbSNP
rs1451775551 669 dbSNP
rs565533882 674 dbSNP
rs1003398499 678 dbSNP
rs1277388474 681 dbSNP
rs1307601279 686 dbSNP
rs1353427865 688 dbSNP
rs1206413745 690 dbSNP
rs1037975782 691 dbSNP
rs1295796195 696 dbSNP
rs898053623 696 dbSNP
rs1235930881 701 dbSNP
rs1288371737 709 dbSNP
rs1300910277 711 dbSNP
rs1320035535 712 dbSNP
rs1220982480 714 dbSNP
rs1372565027 719 dbSNP
rs1308723009 720 dbSNP
rs1428969500 725 dbSNP
rs993656879 732 dbSNP
rs1035684809 735 dbSNP
rs148695831 740 dbSNP
rs1175409890 741 dbSNP
rs961353120 742 dbSNP
rs1196386315 747 dbSNP
rs1420506704 752 dbSNP
rs1251836246 759 dbSNP
rs1035813670 775 dbSNP
rs1180855781 784 dbSNP
rs895948402 785 dbSNP
rs143520773 797 dbSNP
rs559081450 798 dbSNP
rs1440014613 799 dbSNP
rs1273158678 802 dbSNP
rs747479021 804 dbSNP
rs972832335 809 dbSNP
rs1180147567 812 dbSNP
rs146719983 814 dbSNP
rs769322827 821 dbSNP
rs1382963458 823 dbSNP
rs1404359856 825 dbSNP
rs547862940 826 dbSNP
rs985622856 828 dbSNP
rs1348528100 835 dbSNP
rs1336151446 837 dbSNP
rs1414819540 844 dbSNP
rs911361555 848 dbSNP
rs1170608874 850 dbSNP
rs1459955894 850 dbSNP
rs1329820558 868 dbSNP
rs1376640944 879 dbSNP
rs772657909 881 dbSNP
rs1311881153 882 dbSNP
rs114946435 886 dbSNP
rs1250235299 887 dbSNP
rs1354601376 888 dbSNP
rs1443505770 891 dbSNP
rs1227949345 894 dbSNP
rs1255844024 896 dbSNP
rs748773368 904 dbSNP
rs923638396 906 dbSNP
rs536821855 910 dbSNP
rs769597608 912 dbSNP
rs552055708 913 dbSNP
rs1227846081 915 dbSNP
rs988010989 919 dbSNP
rs893529951 923 dbSNP
rs1339826970 927 dbSNP
rs923104732 929 dbSNP
rs947901800 942 dbSNP
rs1388891465 945 dbSNP
rs1044929772 969 dbSNP
rs1455185041 980 dbSNP
rs906347694 984 dbSNP
rs933108417 985 dbSNP
rs1473386515 986 dbSNP
rs1368433099 992 dbSNP
rs1466573124 993 dbSNP
rs1248874275 998 dbSNP
rs1458070243 1003 dbSNP
rs770608896 1018 dbSNP
rs1292054270 1024 dbSNP
rs1036235631 1034 dbSNP
rs767575920 1036 dbSNP
rs1355517563 1037 dbSNP
rs1282406693 1038 dbSNP
rs181894474 1040 dbSNP
rs1230322486 1066 dbSNP
rs1200348431 1067 dbSNP
rs910606205 1068 dbSNP
rs1365748342 1085 dbSNP
rs942066484 1088 dbSNP
rs773988293 1100 dbSNP
rs1241012698 1102 dbSNP
rs1038094355 1111 dbSNP
rs1323606281 1114 dbSNP
rs534611665 1115 dbSNP
rs1413683325 1124 dbSNP
rs554166331 1126 dbSNP
rs1391106611 1130 dbSNP
rs898118126 1134 dbSNP
rs1474526508 1141 dbSNP
rs929558556 1142 dbSNP
rs750680438 1147 dbSNP
rs1451168772 1155 dbSNP
rs1287639774 1162 dbSNP
rs896000696 1165 dbSNP
rs1013478304 1168 dbSNP
rs115291710 1169 dbSNP
rs904925593 1170 dbSNP
rs536759086 1173 dbSNP
rs1275129394 1175 dbSNP
rs1435118643 1188 dbSNP
rs1400267559 1190 dbSNP
rs977004009 1213 dbSNP
rs1309330224 1214 dbSNP
rs1432114484 1219 dbSNP
rs924153431 1226 dbSNP
rs1168319879 1236 dbSNP
rs770870800 1245 dbSNP
rs956370635 1253 dbSNP
rs1427514005 1258 dbSNP
rs1333861760 1265 dbSNP
rs1192064022 1268 dbSNP
rs989139537 1271 dbSNP
rs1184471082 1272 dbSNP
rs555075327 1273 dbSNP
rs1000569450 1275 dbSNP
rs914875740 1278 dbSNP
rs1273886343 1281 dbSNP
rs1202160513 1283 dbSNP
rs1313802505 1289 dbSNP
rs1279066058 1294 dbSNP
rs1218341179 1298 dbSNP
rs947859699 1305 dbSNP
rs1045208674 1310 dbSNP
rs1307899526 1311 dbSNP
rs1351669746 1311 dbSNP
rs576715162 1315 dbSNP
rs939150259 1326 dbSNP
rs1177223584 1327 dbSNP
rs1032419160 1330 dbSNP
rs767285197 1331 dbSNP
rs1009496345 1332 dbSNP
rs1030226630 1334 dbSNP
rs1284945302 1341 dbSNP
rs1175481592 1343 dbSNP
rs995143457 1343 dbSNP
rs1484188351 1363 dbSNP
rs140368182 1369 dbSNP
rs760623443 1374 dbSNP
rs1209127521 1381 dbSNP
rs888436109 1383 dbSNP
rs1269574755 1386 dbSNP
rs1228485034 1390 dbSNP
rs1327788672 1391 dbSNP
rs1304222686 1392 dbSNP
rs1007014005 1400 dbSNP
rs1055478047 1401 dbSNP
rs986351000 1403 dbSNP
rs965542938 1405 dbSNP
rs1447702172 1409 dbSNP
rs910666048 1411 dbSNP
rs963786634 1420 dbSNP
rs368554333 1421 dbSNP
rs892759932 1435 dbSNP
rs1322735656 1438 dbSNP
rs1011329048 1444 dbSNP
rs1220375669 1446 dbSNP
rs764293099 1448 dbSNP
rs1276322727 1454 dbSNP
rs929278752 1455 dbSNP
rs1156989104 1457 dbSNP
rs1210400270 1459 dbSNP
rs1238793515 1473 dbSNP
rs1057333836 1479 dbSNP
rs754022147 1501 dbSNP
rs1181089698 1506 dbSNP
rs1249510794 1531 dbSNP
rs1031278490 1534 dbSNP
rs1464150098 1535 dbSNP
rs1487087782 1541 dbSNP
rs577510911 1547 dbSNP
rs948941444 1557 dbSNP
rs956969147 1558 dbSNP
rs990127978 1564 dbSNP
rs1245711959 1567 dbSNP
rs1192365039 1571 dbSNP
rs541338096 1573 dbSNP
rs757385769 1574 dbSNP
rs12621979 1579 dbSNP
rs1053499950 1591 dbSNP
rs1356446052 1595 dbSNP
rs892151361 1596 dbSNP
rs1287223183 1600 dbSNP
rs1459464663 1603 dbSNP
rs529623729 1606 dbSNP
rs1414216724 1614 dbSNP
rs1335141455 1626 dbSNP
rs1442696223 1656 dbSNP
rs1009215059 1664 dbSNP
rs1030280261 1670 dbSNP
rs1398357046 1683 dbSNP
rs954596807 1686 dbSNP
rs930609729 1689 dbSNP
rs766804768 1690 dbSNP
rs1341205547 1696 dbSNP
rs1401769086 1700 dbSNP
rs1488485806 1711 dbSNP
rs754331101 1712 dbSNP
rs1344058724 1714 dbSNP
rs888455161 1719 dbSNP
rs1300317958 1730 dbSNP
rs1017853758 1739 dbSNP
rs963205103 1740 dbSNP
rs973908688 1744 dbSNP
rs1263279812 1751 dbSNP
rs901232103 1756 dbSNP
rs998255198 1757 dbSNP
rs1422720000 1758 dbSNP
rs1245447139 1764 dbSNP
rs1031206641 1766 dbSNP
rs919318124 1768 dbSNP
rs1011198274 1772 dbSNP
rs1200645359 1776 dbSNP
rs1022931112 1783 dbSNP
rs969090083 1784 dbSNP
rs1196612765 1791 dbSNP
rs1490012509 1792 dbSNP
rs1277336117 1793 dbSNP
rs541546225 1798 dbSNP
rs11554056 1803 dbSNP
rs1034750904 1804 dbSNP
rs1235771878 1807 dbSNP
rs1158200910 1813 dbSNP
rs1312972738 1814 dbSNP
rs1361257440 1826 dbSNP
rs1403135993 1827 dbSNP
rs1352276288 1830 dbSNP
rs1401867652 1832 dbSNP
rs992775846 1833 dbSNP
rs917530358 1834 dbSNP
rs1394145502 1835 dbSNP
rs371790024 1842 dbSNP
rs971779677 1844 dbSNP
rs1376678296 1856 dbSNP
rs1437096475 1859 dbSNP
rs1276471311 1860 dbSNP
rs530626671 1862 dbSNP
rs1238994965 1871 dbSNP
rs1254601988 1879 dbSNP
rs747490166 1887 dbSNP
rs1437743787 1909 dbSNP
rs1248920268 1924 dbSNP
rs1202512137 1930 dbSNP
rs1044612041 1931 dbSNP
rs1262691575 1933 dbSNP
rs552000696 1937 dbSNP
rs984731299 1946 dbSNP
rs1289056951 1950 dbSNP
rs910429479 1953 dbSNP
rs926124079 1954 dbSNP
rs1335973271 1957 dbSNP
rs1396346972 1972 dbSNP
rs942733646 1975 dbSNP
rs530339450 1977 dbSNP
rs1334210058 1978 dbSNP
rs148064815 1978 dbSNP
rs755525984 1980 dbSNP
rs878921357 1981 dbSNP
rs781640396 1989 dbSNP
rs1157458595 1999 dbSNP
rs1255289202 2007 dbSNP
rs1190071204 2009 dbSNP
rs1443293854 2019 dbSNP
rs1242762158 2022 dbSNP
rs186918759 2027 dbSNP
rs528421387 2031 dbSNP
rs936156098 2041 dbSNP
rs1268895105 2049 dbSNP
rs1204594451 2050 dbSNP
rs140657749 2054 dbSNP
rs1285825401 2055 dbSNP
rs934101056 2056 dbSNP
rs892205123 2057 dbSNP
rs1052520706 2062 dbSNP
rs1009265735 2064 dbSNP
rs1436892501 2069 dbSNP
rs566089054 2090 dbSNP
rs890418448 2091 dbSNP
rs1455511088 2097 dbSNP
rs1161596868 2103 dbSNP
rs892638559 2104 dbSNP
rs1383451808 2105 dbSNP
rs1390108936 2106 dbSNP
rs1165434336 2107 dbSNP
rs1445756692 2108 dbSNP
rs1011458575 2111 dbSNP
rs1182104773 2113 dbSNP
rs536605626 2114 dbSNP
rs1017491703 2117 dbSNP
rs191403383 2121 dbSNP
rs770412964 2125 dbSNP
rs1026385627 2126 dbSNP
rs1397876324 2131 dbSNP
rs1445289760 2135 dbSNP
rs139326997 2136 dbSNP
rs16843840 2136 dbSNP
rs1210421042 2140 dbSNP
rs950791912 2148 dbSNP
rs7568 2155 dbSNP
rs1378715712 2157 dbSNP
rs1365497693 2158 dbSNP
rs1269162660 2167 dbSNP
rs1242140283 2168 dbSNP
rs1332382502 2180 dbSNP
rs150093810 2187 dbSNP
rs1425897655 2188 dbSNP
rs1365465381 2190 dbSNP
rs1024261153 2198 dbSNP
rs1162089608 2223 dbSNP
rs951924122 2228 dbSNP
rs985005401 2240 dbSNP
rs1356354085 2242 dbSNP
rs1474542707 2246 dbSNP
rs970048611 2253 dbSNP
rs1200195546 2256 dbSNP
rs980776017 2270 dbSNP
rs910365507 2271 dbSNP
rs1342524274 2281 dbSNP
rs182764242 2284 dbSNP
rs1212499038 2290 dbSNP
rs922640041 2302 dbSNP
rs975990584 2302 dbSNP
rs543338295 2307 dbSNP
rs1186754358 2310 dbSNP
rs936192527 2319 dbSNP
rs1239160007 2321 dbSNP
rs913946221 2333 dbSNP
rs11554047 2334 dbSNP
rs1367986937 2335 dbSNP
rs368793774 2336 dbSNP
rs1473139372 2339 dbSNP
rs541722999 2340 dbSNP
rs945105088 2346 dbSNP
rs1051473109 2349 dbSNP
rs1480116907 2352 dbSNP
rs1266686217 2354 dbSNP
rs1184340079 2362 dbSNP
rs890126839 2364 dbSNP
rs1398076048 2365 dbSNP
rs943025856 2369 dbSNP
rs1465020331 2389 dbSNP
rs1331854402 2392 dbSNP
rs1202134384 2396 dbSNP
rs1398358380 2397 dbSNP
rs1263319542 2404 dbSNP
rs1393933257 2409 dbSNP
rs1333023110 2410 dbSNP
rs1289666480 2416 dbSNP
rs553361515 2422 dbSNP
rs1230826445 2439 dbSNP
rs1374649945 2446 dbSNP
rs1039386356 2456 dbSNP
rs1440408514 2463 dbSNP
rs1340568971 2471 dbSNP
rs1246298369 2472 dbSNP
rs1337553989 2474 dbSNP
rs1469474850 2477 dbSNP
rs899069386 2478 dbSNP
rs1427356185 2481 dbSNP
rs574098140 2483 dbSNP
rs1419635239 2487 dbSNP
rs1407100982 2488 dbSNP
rs1175284959 2489 dbSNP
rs1202704276 2499 dbSNP
rs1275720159 2499 dbSNP
rs541382211 2504 dbSNP
rs1316646422 2508 dbSNP
rs1026099551 2512 dbSNP
rs865992625 2514 dbSNP
rs1218560282 2516 dbSNP
rs1259120228 2521 dbSNP
rs1481792705 2532 dbSNP
rs1222427906 2534 dbSNP
rs1381875905 2535 dbSNP
rs564819208 2539 dbSNP
rs73002132 2541 dbSNP
rs1404140276 2551 dbSNP
rs530548482 2555 dbSNP
rs1322672969 2562 dbSNP
rs545479031 2567 dbSNP
rs75573594 2575 dbSNP
rs1344542544 2576 dbSNP
rs1026080275 2578 dbSNP
rs951909091 2579 dbSNP
rs878928005 2580 dbSNP
rs1167366800 2584 dbSNP
rs1442428601 2591 dbSNP
rs1005954858 2597 dbSNP
rs1485221164 2617 dbSNP
rs1258425349 2622 dbSNP
rs1214346644 2625 dbSNP
rs1171218078 2626 dbSNP
rs1017891279 2635 dbSNP
rs1293004523 2641 dbSNP
rs776710601 2646 dbSNP
rs964539982 2651 dbSNP
rs976001999 2651 dbSNP
rs1171666836 2652 dbSNP
rs1382990489 2660 dbSNP
rs1361433506 2665 dbSNP
rs1287168394 2667 dbSNP
rs1459417659 2668 dbSNP
rs923150560 2673 dbSNP
rs1402516941 2676 dbSNP
rs1410086646 2677 dbSNP
rs1391635645 2693 dbSNP
rs955371368 2695 dbSNP
rs988117609 2697 dbSNP
rs1259109744 2698 dbSNP
rs1192396068 2699 dbSNP
rs528246163 2703 dbSNP
rs1295884718 2704 dbSNP
rs1270160324 2705 dbSNP
rs1222226063 2709 dbSNP
rs546879144 2714 dbSNP
rs1253436238 2715 dbSNP
rs1056801 2719 dbSNP
rs1307106800 2721 dbSNP
rs1293563783 2728 dbSNP
rs1406793152 2736 dbSNP
rs1346083217 2737 dbSNP
rs946824617 2740 dbSNP
rs1043814568 2741 dbSNP
rs1398432823 2744 dbSNP
rs1168255493 2747 dbSNP
rs926787371 2748 dbSNP
rs938146801 2751 dbSNP
rs1399949819 2760 dbSNP
rs1480441461 2762 dbSNP
rs1056653956 2771 dbSNP
rs138925679 2776 dbSNP
rs1489996773 2780 dbSNP
rs1253154352 2786 dbSNP
rs1231584326 2788 dbSNP
rs14351 2790 dbSNP
rs1225431345 2793 dbSNP
rs1047877726 2796 dbSNP
rs887444907 2798 dbSNP
rs1006424535 2806 dbSNP
rs1017317635 2810 dbSNP
rs964551109 2814 dbSNP
rs997322136 2827 dbSNP
rs750637193 2828 dbSNP
rs149426337 2830 dbSNP
rs1487970001 2844 dbSNP
rs1173593513 2845 dbSNP
rs988733335 2848 dbSNP
rs749230822 2849 dbSNP
rs1194329777 2859 dbSNP
rs1263709100 2866 dbSNP
rs1248854879 2867 dbSNP
rs913929885 2871 dbSNP
rs1431335729 2875 dbSNP
rs1175150578 2876 dbSNP
rs1262630697 2887 dbSNP
rs1201806444 2888 dbSNP
rs537574417 2899 dbSNP
rs979932305 2901 dbSNP
rs11554057 2902 dbSNP
rs1238241193 2907 dbSNP
rs1333827110 2915 dbSNP
rs1156399783 2921 dbSNP
rs73002137 2928 dbSNP
rs1419731360 2932 dbSNP
rs1334148901 2934 dbSNP
rs1290086317 2936 dbSNP
rs1364761449 2937 dbSNP
rs563578173 2938 dbSNP
rs1453655457 2941 dbSNP
rs1301093520 2944 dbSNP
rs571046474 2947 dbSNP
rs751993757 2948 dbSNP
rs1372097181 2951 dbSNP
rs1236786296 2953 dbSNP
rs938197927 2955 dbSNP
rs1242704860 2958 dbSNP
rs1181837329 2961 dbSNP
rs992307018 2966 dbSNP
rs918070636 2979 dbSNP
rs12620226 2980 dbSNP
rs1348421314 2983 dbSNP
rs189992633 2988 dbSNP
rs1246378935 2990 dbSNP
rs1381604539 2993 dbSNP
rs1312371819 2997 dbSNP
rs1487496456 3006 dbSNP
rs1326563406 3010 dbSNP
rs1047975092 3015 dbSNP
rs1359140630 3016 dbSNP
rs1267810429 3020 dbSNP
rs1425625356 3024 dbSNP
rs887444686 3027 dbSNP
rs1161740823 3048 dbSNP
rs1206169096 3052 dbSNP
rs147121392 3056 dbSNP
rs1176433839 3062 dbSNP
rs1379344523 3072 dbSNP
rs1192512912 3074 dbSNP
rs1039208744 3075 dbSNP
rs900229453 3076 dbSNP
rs111269907 3077 dbSNP
rs1347609358 3079 dbSNP
rs1456842488 3083 dbSNP
rs1030200097 3084 dbSNP
rs1395698518 3087 dbSNP
rs891631395 3092 dbSNP
rs1269107690 3096 dbSNP
rs535727597 3099 dbSNP
rs1305418689 3109 dbSNP
rs182193570 3110 dbSNP
rs1376497253 3111 dbSNP
rs1365401453 3132 dbSNP
rs1321958478 3145 dbSNP
rs979431451 3148 dbSNP
rs1224525808 3152 dbSNP
rs1167423446 3162 dbSNP
rs1476844856 3165 dbSNP
rs1033619316 3166 dbSNP
rs1319945535 3180 dbSNP
rs138473405 3182 dbSNP
rs1265922823 3189 dbSNP
rs1244803184 3199 dbSNP
rs1469739317 3202 dbSNP
rs188967521 3205 dbSNP
rs1196580397 3207 dbSNP
rs992193903 3209 dbSNP
rs1271777440 3218 dbSNP
rs1439997158 3221 dbSNP
rs193244496 3224 dbSNP
rs1283346338 3237 dbSNP
rs1224710985 3241 dbSNP
rs1345395720 3243 dbSNP
rs918126230 3245 dbSNP
rs1444744130 3247 dbSNP
rs1355343098 3253 dbSNP
rs929453978 3259 dbSNP
rs772224749 3262 dbSNP
rs12078 3268 dbSNP
rs1164729005 3272 dbSNP
rs1419254660 3279 dbSNP
rs941710641 3281 dbSNP
rs745530618 3286 dbSNP
rs1177203453 3287 dbSNP
rs540097588 3296 dbSNP
rs1463451924 3303 dbSNP
rs1329803602 3311 dbSNP
rs1422911652 3318 dbSNP
rs1400020405 3329 dbSNP
rs561863455 3330 dbSNP
rs1300066524 3333 dbSNP
rs759396671 3334 dbSNP
rs1462355186 3335 dbSNP
rs933092128 3343 dbSNP
rs1293964515 3345 dbSNP
rs1336933539 3352 dbSNP
rs547222026 3354 dbSNP
rs60368538 3356 dbSNP
rs550876509 3364 dbSNP
rs11554053 3368 dbSNP
rs147260409 3378 dbSNP
rs1444888237 3386 dbSNP
rs1385206047 3389 dbSNP
rs1337496898 3402 dbSNP
rs1206206967 3408 dbSNP
rs1469303542 3414 dbSNP
rs183676517 3419 dbSNP
rs1021980056 3421 dbSNP
rs1401197843 3425 dbSNP
rs904460246 3427 dbSNP
rs6672 3433 dbSNP
rs15936 3437 dbSNP
rs776710775 3438 dbSNP
rs1033673217 3440 dbSNP
rs188670532 3441 dbSNP
rs959361938 3444 dbSNP
rs1218615779 3462 dbSNP
rs1318012043 3463 dbSNP
rs376110460 3466 dbSNP
rs546924557 3472 dbSNP
rs369097653 3474 dbSNP
rs1361879071 3476 dbSNP
rs1315915267 3479 dbSNP
rs1410842931 3494 dbSNP
rs568301307 3501 dbSNP
rs535762554 3502 dbSNP
rs191970272 3509 dbSNP
rs1802156 3514 dbSNP
rs769782843 3520 dbSNP
rs1447562398 3521 dbSNP
rs1431434278 3524 dbSNP
rs1313635829 3529 dbSNP
rs1156629673 3534 dbSNP
rs1357376431 3537 dbSNP
rs148744125 3539 dbSNP
rs963691706 3543 dbSNP
rs974985624 3546 dbSNP
rs377019554 3549 dbSNP
rs868275306 3554 dbSNP
rs1263269857 3557 dbSNP
rs574897049 3558 dbSNP
rs1186550025 3563 dbSNP
rs1216146366 3563 dbSNP
rs932938028 3577 dbSNP
rs539026565 3581 dbSNP
rs1051522718 3588 dbSNP
rs1259009818 3593 dbSNP
rs1292941230 3596 dbSNP
rs1244391039 3598 dbSNP
rs1320101479 3599 dbSNP
rs1297847320 3601 dbSNP
rs1215179336 3607 dbSNP
rs912962454 3609 dbSNP
rs114896886 3616 dbSNP
rs1192168000 3617 dbSNP
rs3755394 3621 dbSNP
rs1366016614 3624 dbSNP
rs904344562 3629 dbSNP
rs1456090384 3637 dbSNP
rs569582950 3641 dbSNP
rs141398757 3643 dbSNP
rs895161043 3653 dbSNP
rs1192195405 3658 dbSNP
rs1804071 3660 dbSNP
rs561896214 3665 dbSNP
rs1414128163 3668 dbSNP
rs1025036459 3670 dbSNP
rs14258 3678 dbSNP
rs1258811903 3707 dbSNP
rs1417893647 3708 dbSNP
rs1205487254 3710 dbSNP
rs9053 3710 dbSNP
rs759907543 3711 dbSNP
rs1443044195 3715 dbSNP
rs137865127 3718 dbSNP
rs3834167 3718 dbSNP
rs1432792087 3723 dbSNP
rs767803150 3737 dbSNP
rs1005364580 3747 dbSNP
rs1272924260 3754 dbSNP
rs1366558665 3755 dbSNP
rs1234585536 3756 dbSNP
rs1398191093 3760 dbSNP
rs1016467056 3761 dbSNP
rs1281975886 3765 dbSNP
rs1397559552 3776 dbSNP
rs963878425 3779 dbSNP
rs8613 3781 dbSNP
rs1802155 3794 dbSNP
rs558099347 3799 dbSNP
rs1430538458 3804 dbSNP
rs1198604480 3809 dbSNP
rs764352607 3811 dbSNP
rs922148734 3814 dbSNP
rs753953659 3815 dbSNP
rs954378617 3818 dbSNP
rs562724490 3821 dbSNP
rs1205583779 3824 dbSNP
rs530943381 3825 dbSNP
rs1324199466 3841 dbSNP
rs545916977 3854 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.772 3.3e-5 0.859 6.2e-7 20 Click to see details
GSE21032 Prostate cancer 0.355 5.0e-4 0.239 1.5e-2 83 Click to see details
GSE38226 Liver fibrosis -0.507 9.5e-3 -0.462 1.7e-2 21 Click to see details
GSE21849 B cell lymphoma 0.352 3.1e-2 0.279 7.1e-2 29 Click to see details
GSE14794 Lymphoblastoid cells -0.19 3.6e-2 -0.159 6.7e-2 90 Click to see details
GSE32688 Pancreatic cancer -0.311 4.2e-2 -0.290 5.4e-2 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.322 5.8e-2 0.233 1.3e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.301 8.1e-2 0.359 4.6e-2 23 Click to see details
GSE21687 Ependynoma primary tumors 0.123 1.7e-1 0.178 8.0e-2 64 Click to see details
GSE19783 ER+ ER+ breast cancer -0.206 1.9e-1 -0.176 2.3e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.197 2.6e-1 -0.165 3.0e-1 13 Click to see details
GSE28544 Breast cancer -0.131 2.7e-1 -0.145 2.5e-1 24 Click to see details
GSE17498 Multiple myeloma 0.092 2.9e-1 0.076 3.2e-1 40 Click to see details
GSE19783 ER- ER- breast cancer -0.063 2.9e-1 -0.141 1.1e-1 79 Click to see details
GSE19536 Breast cancer -0.055 2.9e-1 -0.120 1.2e-1 100 Click to see details
GSE17306 Multiple myeloma -0.07 3.2e-1 -0.059 3.4e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.154 3.2e-1 -0.175 2.9e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.096 3.3e-1 -0.008 4.9e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.107 3.5e-1 0.015 4.8e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.051 4.0e-1 0.073 3.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.051 4.0e-1 0.073 3.6e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.483 0 -0.521 0 42 Click to see details
STAD -0.449 0 -0.644 0 32 Click to see details
BRCA 0.202 0.03 0.193 0.04 84 Click to see details
LIHC -0.221 0.06 -0.220 0.06 49 Click to see details
BLCA -0.354 0.07 -0.385 0.06 18 Click to see details
CESC -0.972 0.08 -1.000 0.5 3 Click to see details
ESCA 0.463 0.08 0.691 0.01 11 Click to see details
PRAD -0.166 0.12 -0.187 0.1 50 Click to see details
PAAD -0.679 0.16 -0.400 0.3 4 Click to see details
LUAD -0.291 0.18 -0.476 0.06 12 Click to see details
KICH -0.188 0.18 -0.144 0.25 25 Click to see details
KIRC 0.109 0.19 0.089 0.24 68 Click to see details
UCEC 0.208 0.2 0.211 0.19 19 Click to see details
CHOL -0.275 0.24 -0.400 0.14 9 Click to see details
LUSC 0.079 0.32 0.180 0.14 38 Click to see details
PCPG -0.47 0.34 -0.500 0.33 3 Click to see details
COAD -0.068 0.44 -0.333 0.21 8 Click to see details
KIRP 0.003 0.49 0.007 0.48 32 Click to see details
THCA -0.002 0.49 -0.021 0.44 59 Click to see details
THCA -0.002 0.49 -0.021 0.44 59 Click to see details
THCA -0.002 0.49 -0.021 0.44 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*