miRTarBase - #MIRT085215 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCNT2   
Synonyms CYCT2
Description cyclin T2
Transcript NM_001241   
Other Transcripts NM_058241   
Expression
Putative miRNA Targets on CCNT2
3'UTR of CCNT2
(miRNA target sites are highlighted)
>CCNT2|NM_001241|3'UTR
   1 TGCCAATCACGAGTACAGTACAAGCAGCCAGCATATGGACTACAAAGACACATTCGACATGCTGGACTCACTGTTAAGTG
  81 CCCAAGGAATGAACATGTAATAATTTGTTTAGGTCAATTTTTCCTTTACTTTTTTAATTTAAAAATTGTTAGAATGGAAA
 161 AATTCCTTCTGATCTAGCAGTGGTAACCCCTGCTGTTGCTGCCACTGCTTCAATATTTGTAAGTGCTGCTTTATTCTTCA
 241 TTCTGAAAAGAAGAGATTATAGTAAACAAGTCTTTATCTCCACATATGATAGTGTTATAAATACTGTAAAAGCATGGAAG
 321 GTGCAAAACTCAGTATTTCTACAATTGCAGCTAAGAACATTAGGATGAATGGCTGGCTGCTTCTAGGAATATAAGATGCC
 401 TCAAGCATTCATTATTTATGATTTGAATACTGTAGCTATTTTTTGTTGCTTGGCTTTTGAATGAGTGTAAATTGTTTTCT
 481 TTTGTGTATTTATACTTGTATGTATGATTTGCATGTTTCAATGATAAAGGGATAAAACAGTATACTGACAACTGTTTACA
 561 AGAAAGTGGAGAAAAATGTACATACATTTTTGTATGTTTAGATATTACCGTAAATACTCAGGATTGGAGCTGCTTGTAAG
 641 TATAACAATATACAGAATAACTTTATTTTATCTTGTCAGAGTCCATCACTAATCTAAAACAAAGGTGGCACTTTTTTATG
 721 TTAACCTTAAACTCTAGGCCTTACTGGAAGCCACTGATAGGGGACACTTCACTACCAGATGTGTGCAGTGCAACAGATGG
 801 TCATATACACTGTGAGGCACTGAAATTTTGCCTTCAGAGGTTCTGACCAGATTGGCTGCTGAAATAGCCCCTAACTTTCT
 881 GAAGGCTTGAAGAGGAAAAAATAAAGTTTACATACTCTTGATGTGAAGTGCATTTAAATGTTTGTTGGCTTGTTGCAGTT
 961 CTATGAAACAGAGCTGTTAATAATGGTTATGTGGATTACTGTGATTTGAAAACTAAATTCACAATAACTTACCTAGTAGA
1041 GATTTAGTGAGTTGTTTCCTTTAAAGAATTTTACACTACATATTTTAATAGTAAACAGGGATCACTTTTCCTTTAGCATT
1121 CAGAATGACACCATATTCTTAAATATACTCCTTCCCTGAAGCGTGTTTGTGTGTGATGCCATATTTCTTTTTCAGGTAAA
1201 TGTAGTCTTCCTTATAAAAATGAAATTAAACCTATGCTCTCAATTCTTTTATATTCTAACAATAAATAAAAAAGAAAAGA
1281 TTACTGACTGTGCATTGTACCTGTATTTATAGTTTATGGTTATCAGGAAGCTCTGTAAGAAAGAAAAGGTCAGCCTCCCA
1361 GGCAAACCAGTAGTGGAGGTTTTACATTTGTTTGCACATCTCAGTATATTTCTGTTGAGGTAAAGTTTGCACAGTCATCT
1441 GACTTCTGATCAAGCATTAGATTTTAACTTGTTTAGATTTTGTCTTAAACACCAGTAATATGGCTCTTGTTTATCAGCTA
1521 ATCTTGAATTTATTCTGTGGTAAATCTTTTGAGTTGTTGAGTATATTTGAGATTGATTGGATTCGACCTCTTGTTGAACT
1601 GAAAACTTAATTTTTTCTCTGTATTTTTGTTACAAAGCCACTGATACGTGCACAATTGTAATTAAGTATGTTGCAGTTGT
1681 AAATATTAGAGTTTAATCTCATGCTCTACCTTTATTTAGCAATTACCTAATTTGCCAGTAGCTTTATAATTTTTAAAGAT
1761 AATTGTTCATTATTTTGTCAATGTTATTTGAACTTGGGGTACTTAGGAGCCTCTTTGTAGGGACTGTGCCTAGGTAGCAT
1841 GTCCTAACATTTGTTCTGGTCTTGCATAACTTCAGTAATCTTTGTCATTATATGTAACTTTGTTGCTCTGTATGGCATAA
1921 TATTGTATCCATAAACATGGTAATTTTGATACAGTTATACTTTTACAGTGGTACATAATCCAAGGACTAGTATAGAATTA
2001 AGCTGAGTGCAAGATGAGGGAGGGAAGGGCTTTCTTGGTAATTTAGATGTGAAACCTCTACAGAGCTATCATGTAAAAAC
2081 TACATAAGGTGGTTGTGCTACTGTATAATTGGGGGTGATAATACCAGGAATTTTAATAAGATTTTGTAAAGAATATCCAG
2161 AAAAGTAGTGAACTTATTTTCAGTAGACATAGAAAACAATGTGAATATTTAAGGTCTGTGACTATAGTTAAACTTCACTA
2241 AGAATTTGCAGAATTGTTTTGAGATGTGTGAATAAAGGTAATTTTATTGAATCTTCATTGGTGCTAATGATGGACAGTTA
2321 AAAAGATAGCTAGTGTATATTGTTATGGGTCAGTACTTATTAGTACTTCCAAAATTGAATTTGAAATGCTATGTATTCAC
2401 TTTTCACTCTGTAAATGTAATTCTTTACAATGACTTTATTTATTAAAGGGCAGCCAGTTGTCATTTTTACAGGATTGTGT
2481 GAGCTATTCAAACTCTTCAACCCCTGAACAGGGTATTAAGCTTCCAAAATAATGATGGGGATAAATATGGAAATCCTTTT
2561 TAAGTTGTATTTCCATTAAACAAAAACCCTTATAATTCATACTATCATGAATTTGCTTTATCCATCTCATTTGCATAACA
2641 GTTCATCTGTCTGGTCCCATTAGGCTCTACCAAAGAAAGACTCTGATGAGTGGACATTATTACTGTGACTCTTGTAAGTA
2721 GCCATAAATAAACCAAAATAGTATCAAATTTAGGTATGAAATTCCACATGTGCAAAGTACTGTTAAGGTGATAACATTTT
2801 TGATGAGATTTAAAAAAATATTTGAAATATTAAAAAGCATTATCTTTAAACATCCTATAAAAGAGTGAGTCATTTTTAAG
2881 TTGTGTTTTCCCTAGATCACTGATTTGTTACCTTTACACAGAAGCACATTGCAAAGAAAGGCTTTATTTCTACCTCTTCC
2961 ATTCAGTTTTCCAATATTGAGCTGTGTCCCTCTGAATATTTGCCTTAGCTATTTCAAAATAGGTATTTTCAGAACCAAAG
3041 CAAAGGGTGGTTTGTTCACTGAAACATTCTTAGAGGCCTACTTAACGGGCGGCAGTATCCGGTAGTGGTAAAACCTCACA
3121 GTTTCCTAATTGCAGGTATGTAAATACCAAAAAAGTCCTGTTGTCAGCCCTAGGTTTATCTTTGAAAGCAGTTAAATGTG
3201 CACCTTGGTCTTCCTCCGTGTGTTCAGATTCCTTCTGGTTAAAGTTCTTATTCAGAGTCATCTAAAAGAAATTTCTAACA
3281 TGATGTATGGTTTCTTGAATGTCATGAGTGGCTGCGTATATTGCTTTGTAGCAACAGATTGTATTAATAATTAATAGAAT
3361 ACCTAATTTTTTTGGCCTATCCTCTTTGAACTAGAAATGACTACTTGAGGGCTATTTCAGAGAACCAATATGAAATGTTT
3441 TTGTTAGTACAAAATACCATTGCCTTAAAAGGTTTCAAGCACATTTTCTTTTCTATTTGAGAACTTAAATTGCTGACTTG
3521 TATTCGTTAAGCAACCTTAGAAATAAACCACTGCTTATATCTGCATGAATATTATGCATTTCATGAGTACAGTTAGTTGA
3601 TTAGATATTTCAGGGTTTTGCATTTTCTATAGACATGGGGACTTTTTTAACATGGTAACGTCTTAGGAAAACCATTCTCT
3681 CAAGGTATTACACCATTTCCAATTTTATCCAAATGAAAAGCATATCTGCTTAAATTTAGGATGTCTTTGCTGAGAATATT
3761 TGGAGGCTCTTGTTAGGAAGAATCATGGATTCAGTATTTCTAACCTGATTACTGCCTCAGAGGCTGTCTTGAAGGGAGAC
3841 AGTAGGATTCACTGACTACCTTTACCCAGATGAGGGATCAACAAATCTCACACTTAAACTAAATGAGTTGACAGGACAAT
3921 AGGTGCTAATCTCATGTGCCCTAAGATGGACTTATTTAGATAGGGATTTTTGCATTGGAAAAGCAGCACATTCTCTGACC
4001 TTGGGTACCAAGCTATGATACTAATTTGAGAATCACATTCTGATACGTTAATATCAGAAATCAGTGAGCAACCTAATTGC
4081 TGTAAGCTGACATACATGGAAGCCGAAATCAAAAGGTTGCTTTTGTTAGTTTCCCTGGAGCATCTATTTTTGTAATACAT
4161 TTTGCCAGTGGGACTGAAAAGCTCAAAATGTTTTAGACCTAATATCATACATTAATTTTCTGCTCTGCAGTGTCAATTTG
4241 GGCACAGCCAGTTTTTACCTCTGTGGCACCTTCTTTATAATTTACTGTTACCTATTCTGCCTGACAGATTGATTAAGTAG
4321 GTTGATAAGATCCATCGAAGATTGAATGGCTAGGAGTAATTCTGTTCTCGTATAGGCAACTTAACTTCACTGTGGAATCC
4401 ATTTATCTCAAAGTTTGAGGGCTGTCTACTTTATTTTCAAGTTTGGGGCGGAAACTCAAAATCCCGAGCATTGCCACTTT
4481 AGTAGTTTGTTTGATTTGCCTATTGTTTAATAATGAGTACATTCTTATTAAGTGATGAGTACATTCTTAATTTTAAGGTA
4561 TGTTTTTTTCAAGCAGCTTCATTTTATTAGGAAAAATACATACTCATTTGTTGTAAACAGTGATTGTGGGGTTTCATTTT
4641 CTGAATGTACTCAAAACTCCCAACAACAATTGAACAGGATGTTTGCTAATAGAAAATCTAAAACAGGAATATGTGTATAT
4721 GGCATGAATTAGTCATTGACTTTAAGCTTCTTATCCATACAAGGAACTAATAAAATGTTTATTGACAACATAAATCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||| |::  || |||||||| 
Target 5' ttCAATATTTGTAAGTGCTGCTt 3'
209 - 231 160.00 -12.40
2
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |:|:||| | ||:|||| 
Target 5' ctgtAGCTATTTTTTGTTGCTt 3'
430 - 451 150.00 -12.00
3
miRNA  3' guGUUUGGUAAUAC-ACGACGau 5'
            :|| || |  || ||||||  
Target 5' ggTAACCCCTGCTGTTGCTGCca 3'
182 - 204 136.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM3116031 2 COSMIC
COSM1006716 11 COSMIC
COSM1006718 12 COSMIC
COSM3364283 15 COSMIC
COSM1006720 28 COSMIC
COSM475924 35 COSMIC
COSM3836862 48 COSMIC
COSM204560 56 COSMIC
COSM7143202 56 COSMIC
COSM7654951 56 COSMIC
COSM7543506 57 COSMIC
COSM243544 70 COSMIC
COSM8540609 87 COSMIC
COSM9576464 98 COSMIC
COSM9188536 99 COSMIC
COSN30148548 120 COSMIC
COSN26969704 123 COSMIC
COSN13936734 124 COSMIC
COSN30463913 125 COSMIC
COSN31480419 133 COSMIC
COSN31602287 136 COSMIC
COSN20053995 140 COSMIC
COSN30113788 147 COSMIC
COSN31502778 153 COSMIC
COSN31500779 158 COSMIC
COSN17076401 167 COSMIC
COSN19372814 187 COSMIC
COSN31488170 205 COSMIC
COSN19656704 234 COSMIC
COSN26633131 237 COSMIC
COSN21910518 501 COSMIC
COSN505828 511 COSMIC
COSN17076402 513 COSMIC
COSN17076403 520 COSMIC
COSN27204412 663 COSMIC
COSN30173363 688 COSMIC
COSN26560218 831 COSMIC
COSN31517824 1028 COSMIC
COSN6210316 1163 COSMIC
COSN20097178 1271 COSMIC
COSN26533999 1272 COSMIC
COSN8758368 1280 COSMIC
COSN28684563 1285 COSMIC
COSN31520621 1308 COSMIC
COSN21477355 1462 COSMIC
COSN16615756 1585 COSMIC
COSN21341610 1602 COSMIC
COSN30172383 1644 COSMIC
COSN8607496 1704 COSMIC
COSN1789405 1874 COSMIC
COSN31593805 2030 COSMIC
COSN19420188 2122 COSMIC
COSN24299466 2166 COSMIC
COSN30172285 2193 COSMIC
COSN30164439 2243 COSMIC
COSN31481939 2252 COSMIC
COSN31524279 2356 COSMIC
COSN30172611 2378 COSMIC
COSN31593527 2462 COSMIC
COSN1789406 2729 COSMIC
COSN25392593 2739 COSMIC
COSN17585956 3022 COSMIC
COSN23703996 3353 COSMIC
COSN9859850 3399 COSMIC
COSN21959051 3438 COSMIC
COSN9081750 3719 COSMIC
COSN25639104 3743 COSMIC
COSN31959792 3873 COSMIC
COSN1789407 4097 COSMIC
COSN9228044 4271 COSMIC
COSN26145445 4318 COSMIC
COSN8268571 4374 COSMIC
COSN20765937 4398 COSMIC
COSN22681130 4410 COSMIC
COSN24936643 4646 COSMIC
COSN26028597 4720 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1454746248 7 dbSNP
rs764257111 11 dbSNP
rs190052933 12 dbSNP
rs779129544 17 dbSNP
rs750864313 18 dbSNP
rs1246622106 19 dbSNP
rs1356833612 22 dbSNP
rs138728360 24 dbSNP
rs902705598 26 dbSNP
rs758906908 27 dbSNP
rs759833063 28 dbSNP
rs1393848936 30 dbSNP
rs573586469 31 dbSNP
rs1308490329 32 dbSNP
rs371710293 35 dbSNP
rs919436797 36 dbSNP
rs1380582115 44 dbSNP
rs1266031052 48 dbSNP
rs183192820 49 dbSNP
rs761745981 50 dbSNP
rs1205810020 52 dbSNP
rs755143305 53 dbSNP
rs1483042526 56 dbSNP
rs781377317 57 dbSNP
rs748295924 68 dbSNP
rs769900810 70 dbSNP
rs770113338 72 dbSNP
rs1410233347 77 dbSNP
rs774013841 80 dbSNP
rs1177596534 81 dbSNP
rs745669184 82 dbSNP
rs1358266574 86 dbSNP
rs143713034 88 dbSNP
rs142947931 92 dbSNP
rs775436813 95 dbSNP
rs774335259 98 dbSNP
rs765410703 99 dbSNP
rs1409142978 101 dbSNP
rs1286305037 104 dbSNP
rs1191744587 106 dbSNP
rs45569737 107 dbSNP
rs763488978 108 dbSNP
rs776259001 109 dbSNP
rs761363968 111 dbSNP
rs1208237547 114 dbSNP
rs764944183 117 dbSNP
rs1354493855 120 dbSNP
rs758859505 125 dbSNP
rs766955567 126 dbSNP
rs1250335032 128 dbSNP
rs1481691501 130 dbSNP
rs1022852244 132 dbSNP
rs1192176983 133 dbSNP
rs45492201 135 dbSNP
rs752086123 136 dbSNP
rs888237574 138 dbSNP
rs1344101412 139 dbSNP
rs1268331114 140 dbSNP
rs13425686 141 dbSNP
rs368199418 148 dbSNP
rs35021589 158 dbSNP
rs1236149510 165 dbSNP
rs1331614232 169 dbSNP
rs1324231561 172 dbSNP
rs575756832 178 dbSNP
rs1302829470 185 dbSNP
rs555491013 185 dbSNP
rs950608180 189 dbSNP
rs1039395213 190 dbSNP
rs899470242 191 dbSNP
rs770678298 193 dbSNP
rs1439245630 196 dbSNP
rs568722241 200 dbSNP
rs998108952 204 dbSNP
rs1029546609 207 dbSNP
rs956606474 209 dbSNP
rs1489658743 213 dbSNP
rs752760002 214 dbSNP
rs1267702332 218 dbSNP
rs1009433921 225 dbSNP
rs1483911240 226 dbSNP
rs774154076 241 dbSNP
rs1270539417 243 dbSNP
rs908985166 246 dbSNP
rs962982199 250 dbSNP
rs974373320 259 dbSNP
rs1276588830 273 dbSNP
rs926640710 279 dbSNP
rs138622899 282 dbSNP
rs1166132574 287 dbSNP
rs921658600 288 dbSNP
rs992375466 293 dbSNP
rs528588155 294 dbSNP
rs547152471 299 dbSNP
rs933550892 301 dbSNP
rs368205222 303 dbSNP
rs1356509308 308 dbSNP
rs919549441 309 dbSNP
rs1052053666 313 dbSNP
rs1403489554 316 dbSNP
rs929552100 317 dbSNP
rs1179264402 322 dbSNP
rs1329663721 345 dbSNP
rs1049259977 347 dbSNP
rs1400038506 348 dbSNP
rs1182274917 349 dbSNP
rs1448070950 353 dbSNP
rs1230853394 360 dbSNP
rs1203521258 377 dbSNP
rs1442839227 380 dbSNP
rs1280635879 385 dbSNP
rs1201773880 386 dbSNP
rs924077541 392 dbSNP
rs1262529818 395 dbSNP
rs1229118110 396 dbSNP
rs935533670 402 dbSNP
rs1375745413 403 dbSNP
rs1230384362 405 dbSNP
rs1341502050 412 dbSNP
rs941132263 412 dbSNP
rs1339260206 413 dbSNP
rs1468637298 415 dbSNP
rs1053834572 416 dbSNP
rs1039825474 421 dbSNP
rs899502082 431 dbSNP
rs997889843 433 dbSNP
rs758848532 435 dbSNP
rs1405317784 436 dbSNP
rs1012369517 445 dbSNP
rs1176326857 464 dbSNP
rs774980855 465 dbSNP
rs1045083593 468 dbSNP
rs906556677 470 dbSNP
rs892414663 475 dbSNP
rs1181541274 477 dbSNP
rs1248605587 480 dbSNP
rs1460781649 480 dbSNP
rs1209399458 487 dbSNP
rs1003189020 489 dbSNP
rs759269267 495 dbSNP
rs1457140813 501 dbSNP
rs1199088527 505 dbSNP
rs950582509 506 dbSNP
rs1223496917 507 dbSNP
rs1317537326 512 dbSNP
rs1004675690 522 dbSNP
rs1382655377 531 dbSNP
rs1321863071 532 dbSNP
rs34968802 534 dbSNP
rs1450121976 539 dbSNP
rs1016085922 543 dbSNP
rs1378297504 553 dbSNP
rs963096101 558 dbSNP
rs974489439 564 dbSNP
rs1157744288 578 dbSNP
rs1033687945 579 dbSNP
rs921584079 579 dbSNP
rs960777151 581 dbSNP
rs562092713 582 dbSNP
rs992154233 587 dbSNP
rs1248541105 593 dbSNP
rs1423619894 603 dbSNP
rs1486885721 606 dbSNP
rs1240362293 611 dbSNP
rs919247101 613 dbSNP
rs1294259545 614 dbSNP
rs1244210835 616 dbSNP
rs1359245281 627 dbSNP
rs951021877 637 dbSNP
rs1216769348 642 dbSNP
rs1466451249 648 dbSNP
rs1333839863 649 dbSNP
rs545325932 653 dbSNP
rs1436615913 656 dbSNP
rs1367022004 657 dbSNP
rs1398123519 658 dbSNP
rs529292963 661 dbSNP
rs1390627826 662 dbSNP
rs985423957 662 dbSNP
rs187480012 671 dbSNP
rs1172273496 680 dbSNP
rs1384728512 682 dbSNP
rs1322230671 693 dbSNP
rs909389194 696 dbSNP
rs375861354 697 dbSNP
rs376925647 697 dbSNP
rs569066801 718 dbSNP
rs954417841 721 dbSNP
rs988107303 726 dbSNP
rs1317259231 732 dbSNP
rs924222505 735 dbSNP
rs921048142 752 dbSNP
rs933713419 753 dbSNP
rs1490249504 757 dbSNP
rs1252195167 758 dbSNP
rs1252880314 759 dbSNP
rs1354443051 762 dbSNP
rs1209475907 764 dbSNP
rs1306234033 764 dbSNP
rs192617639 771 dbSNP
rs935450438 775 dbSNP
rs1053948124 776 dbSNP
rs1223565370 778 dbSNP
rs1346905054 780 dbSNP
rs915450639 782 dbSNP
rs1050770083 791 dbSNP
rs948098587 794 dbSNP
rs554571211 800 dbSNP
rs1370800042 802 dbSNP
rs1299619162 807 dbSNP
rs1045180582 810 dbSNP
rs1460303080 813 dbSNP
rs906498091 817 dbSNP
rs1003563846 818 dbSNP
rs767434147 831 dbSNP
rs886350718 851 dbSNP
rs1191660508 859 dbSNP
rs892112018 870 dbSNP
rs1480206533 871 dbSNP
rs945324317 871 dbSNP
rs1004796687 872 dbSNP
rs1179292181 874 dbSNP
rs1016033777 876 dbSNP
rs1479893401 876 dbSNP
rs1044004687 881 dbSNP
rs539572409 882 dbSNP
rs1326283718 886 dbSNP
rs1260638361 892 dbSNP
rs1222394451 896 dbSNP
rs1335938439 901 dbSNP
rs1308746384 903 dbSNP
rs1389438750 923 dbSNP
rs903688907 926 dbSNP
rs1303216520 928 dbSNP
rs1002488832 936 dbSNP
rs764618731 939 dbSNP
rs896603807 940 dbSNP
rs1162264628 946 dbSNP
rs183758332 964 dbSNP
rs16831178 969 dbSNP
rs1161625207 975 dbSNP
rs1028762320 983 dbSNP
rs1417696335 987 dbSNP
rs954489379 990 dbSNP
rs1184604876 1004 dbSNP
rs987165215 1025 dbSNP
rs1241865261 1029 dbSNP
rs1356751250 1044 dbSNP
rs1339704655 1045 dbSNP
rs1350824085 1046 dbSNP
rs1031116104 1050 dbSNP
rs1400555489 1055 dbSNP
rs1236350782 1056 dbSNP
rs1016966023 1063 dbSNP
rs964982003 1066 dbSNP
rs543129768 1081 dbSNP
rs775296876 1104 dbSNP
rs974934790 1112 dbSNP
rs1380454104 1119 dbSNP
rs923412608 1121 dbSNP
rs1338485666 1124 dbSNP
rs1057045 1131 dbSNP
rs35582507 1133 dbSNP
rs933744681 1134 dbSNP
rs1057046 1139 dbSNP
rs533625087 1141 dbSNP
rs555067786 1157 dbSNP
rs956938258 1162 dbSNP
rs760262047 1163 dbSNP
rs1451820861 1164 dbSNP
rs1243868673 1168 dbSNP
rs1363460891 1174 dbSNP
rs1446863248 1182 dbSNP
rs1292593061 1188 dbSNP
rs1266240009 1195 dbSNP
rs1183575948 1197 dbSNP
rs989752992 1201 dbSNP
rs188933185 1202 dbSNP
rs1485319459 1227 dbSNP
rs1292107307 1235 dbSNP
rs1247874169 1238 dbSNP
rs1285410874 1239 dbSNP
rs948213857 1244 dbSNP
rs981240200 1247 dbSNP
rs141432868 1250 dbSNP
rs567575680 1252 dbSNP
rs1314283139 1255 dbSNP
rs1227978907 1261 dbSNP
rs766490592 1264 dbSNP
rs3835806 1268 dbSNP
rs397897552 1268 dbSNP
rs1320311838 1269 dbSNP
rs1423571854 1271 dbSNP
rs199541612 1271 dbSNP
rs1188725866 1272 dbSNP
rs1360097260 1272 dbSNP
rs369701459 1277 dbSNP
rs372676768 1278 dbSNP
rs376149925 1280 dbSNP
rs1304032905 1285 dbSNP
rs1293127100 1286 dbSNP
rs1426931859 1287 dbSNP
rs781537209 1292 dbSNP
rs192369693 1298 dbSNP
rs1163357539 1306 dbSNP
rs1476000056 1311 dbSNP
rs1047055611 1313 dbSNP
rs903805350 1315 dbSNP
rs937929955 1320 dbSNP
rs1385425433 1321 dbSNP
rs1054908386 1323 dbSNP
rs1224347489 1326 dbSNP
rs887133394 1334 dbSNP
rs1290683486 1345 dbSNP
rs896301382 1358 dbSNP
rs1013638223 1359 dbSNP
rs753909478 1369 dbSNP
rs1419855038 1371 dbSNP
rs1290550327 1373 dbSNP
rs202233834 1385 dbSNP
rs1026316462 1387 dbSNP
rs940599895 1395 dbSNP
rs576956155 1401 dbSNP
rs1284158523 1404 dbSNP
rs1395207529 1409 dbSNP
rs886522506 1421 dbSNP
rs1385186691 1426 dbSNP
rs775061890 1429 dbSNP
rs1323264110 1430 dbSNP
rs11896922 1431 dbSNP
rs1308888145 1432 dbSNP
rs1016253334 1433 dbSNP
rs898982012 1434 dbSNP
rs1254734420 1444 dbSNP
rs1464649436 1444 dbSNP
rs965354094 1449 dbSNP
rs996029081 1462 dbSNP
rs546560644 1472 dbSNP
rs1030516141 1497 dbSNP
rs1267770028 1509 dbSNP
rs954824266 1510 dbSNP
rs150779494 1514 dbSNP
rs1009100030 1518 dbSNP
rs1195226863 1522 dbSNP
rs1030646181 1524 dbSNP
rs1263781200 1524 dbSNP
rs1225465382 1540 dbSNP
rs1343842645 1548 dbSNP
rs1176395147 1557 dbSNP
rs956386874 1565 dbSNP
rs1379367800 1566 dbSNP
rs139159787 1585 dbSNP
rs3769023 1586 dbSNP
rs969504823 1591 dbSNP
rs1407497554 1595 dbSNP
rs755707531 1596 dbSNP
rs980971636 1610 dbSNP
rs979537069 1612 dbSNP
rs928162066 1616 dbSNP
rs1282639192 1620 dbSNP
rs1357319610 1634 dbSNP
rs1424001151 1636 dbSNP
rs939432588 1638 dbSNP
rs983299806 1641 dbSNP
rs924955143 1648 dbSNP
rs908520768 1649 dbSNP
rs1230898061 1663 dbSNP
rs1337070138 1663 dbSNP
rs559228484 1667 dbSNP
rs1461680381 1669 dbSNP
rs1244934729 1676 dbSNP
rs937950178 1677 dbSNP
rs1054939375 1691 dbSNP
rs529899510 1702 dbSNP
rs1224475524 1704 dbSNP
rs917751024 1711 dbSNP
rs562056094 1719 dbSNP
rs941382909 1727 dbSNP
rs1037539543 1735 dbSNP
rs899093305 1741 dbSNP
rs1449820226 1742 dbSNP
rs886551489 1743 dbSNP
rs1330906824 1752 dbSNP
rs1318412884 1766 dbSNP
rs779453351 1767 dbSNP
rs1006285341 1769 dbSNP
rs1157794884 1772 dbSNP
rs1050272307 1777 dbSNP
rs529247126 1782 dbSNP
rs1299306677 1788 dbSNP
rs1312060974 1811 dbSNP
rs1181747518 1820 dbSNP
rs1008636196 1832 dbSNP
rs1482886569 1833 dbSNP
rs544281548 1840 dbSNP
rs1216622665 1845 dbSNP
rs892113850 1860 dbSNP
rs996437406 1867 dbSNP
rs1239852280 1874 dbSNP
rs1360691664 1892 dbSNP
rs538180607 1895 dbSNP
rs1317774849 1902 dbSNP
rs1030550476 1903 dbSNP
rs1198474398 1909 dbSNP
rs1379100333 1920 dbSNP
rs1270231943 1921 dbSNP
rs954941350 1922 dbSNP
rs1343049779 1924 dbSNP
rs1465889720 1926 dbSNP
rs1297259287 1932 dbSNP
rs1425059222 1934 dbSNP
rs1010444900 1946 dbSNP
rs1161454361 1951 dbSNP
rs1020441446 1952 dbSNP
rs562946765 1954 dbSNP
rs1476461584 1955 dbSNP
rs966886160 1955 dbSNP
rs1022520929 1959 dbSNP
rs924955404 1961 dbSNP
rs958998977 1961 dbSNP
rs969620493 1963 dbSNP
rs1002891867 1966 dbSNP
rs917865739 1969 dbSNP
rs1035181422 1980 dbSNP
rs1274381961 1981 dbSNP
rs369491585 1989 dbSNP
rs1359334700 1990 dbSNP
rs961173181 1991 dbSNP
rs982862837 1992 dbSNP
rs748793480 1993 dbSNP
rs533045212 1994 dbSNP
rs907674542 1994 dbSNP
rs1177053026 2000 dbSNP
rs974035010 2007 dbSNP
rs1463834347 2008 dbSNP
rs942120481 2017 dbSNP
rs1172520271 2019 dbSNP
rs551295291 2030 dbSNP
rs16855615 2039 dbSNP
rs1444652817 2050 dbSNP
rs527502614 2056 dbSNP
rs16855616 2061 dbSNP
rs1366994666 2069 dbSNP
rs1189819768 2075 dbSNP
rs184272363 2080 dbSNP
rs751037927 2084 dbSNP
rs911702252 2085 dbSNP
rs1316640232 2090 dbSNP
rs1256810880 2104 dbSNP
rs944557297 2104 dbSNP
rs1218367053 2106 dbSNP
rs865879913 2112 dbSNP
rs1298805987 2115 dbSNP
rs1259140284 2118 dbSNP
rs1385999416 2121 dbSNP
rs1051760218 2131 dbSNP
rs1307662320 2131 dbSNP
rs1439859492 2137 dbSNP
rs1399487863 2140 dbSNP
rs1170019889 2154 dbSNP
rs1470371987 2166 dbSNP
rs1174302251 2169 dbSNP
rs1431697082 2169 dbSNP
rs1206175585 2174 dbSNP
rs1432821510 2176 dbSNP
rs1052146301 2177 dbSNP
rs892228426 2184 dbSNP
rs1179338811 2198 dbSNP
rs1456790575 2201 dbSNP
rs1238149014 2215 dbSNP
rs890742345 2223 dbSNP
rs1462314173 2225 dbSNP
rs567256352 2227 dbSNP
rs1010695030 2234 dbSNP
rs1043394498 2235 dbSNP
rs904884926 2237 dbSNP
rs1199558596 2238 dbSNP
rs1270909935 2241 dbSNP
rs1002430710 2242 dbSNP
rs1476812711 2257 dbSNP
rs1317158866 2277 dbSNP
rs1020890994 2290 dbSNP
rs1237731238 2297 dbSNP
rs1376030671 2304 dbSNP
rs1035697446 2305 dbSNP
rs1419967174 2310 dbSNP
rs1411520753 2314 dbSNP
rs1465686374 2326 dbSNP
rs537994818 2330 dbSNP
rs1349566632 2331 dbSNP
rs1380215607 2334 dbSNP
rs1001031734 2336 dbSNP
rs1463054090 2340 dbSNP
rs1253394152 2341 dbSNP
rs1032130361 2350 dbSNP
rs1004344791 2354 dbSNP
rs959106348 2361 dbSNP
rs1214161991 2366 dbSNP
rs555879829 2373 dbSNP
rs962763527 2376 dbSNP
rs1315475488 2377 dbSNP
rs1425345465 2391 dbSNP
rs974154094 2392 dbSNP
rs1305068775 2393 dbSNP
rs1338649122 2394 dbSNP
rs1310610201 2396 dbSNP
rs921253600 2401 dbSNP
rs1339031938 2407 dbSNP
rs757012718 2408 dbSNP
rs541840599 2410 dbSNP
rs1395562402 2412 dbSNP
rs1385923204 2414 dbSNP
rs1300349714 2420 dbSNP
rs1399949677 2429 dbSNP
rs1418251937 2435 dbSNP
rs954200259 2443 dbSNP
rs970635402 2446 dbSNP
rs369225626 2461 dbSNP
rs1367268066 2464 dbSNP
rs1186186998 2484 dbSNP
rs1428653958 2491 dbSNP
rs556493530 2492 dbSNP
rs1190968108 2501 dbSNP
rs1364503401 2506 dbSNP
rs1487764636 2513 dbSNP
rs764830919 2529 dbSNP
rs1227010440 2539 dbSNP
rs1224480886 2546 dbSNP
rs944522517 2549 dbSNP
rs1052259797 2556 dbSNP
rs1264841177 2562 dbSNP
rs941832730 2563 dbSNP
rs1320776649 2567 dbSNP
rs1280182392 2568 dbSNP
rs577739448 2574 dbSNP
rs973643397 2583 dbSNP
rs540118078 2594 dbSNP
rs946436543 2599 dbSNP
rs932043211 2603 dbSNP
rs1043507676 2610 dbSNP
rs1407479757 2613 dbSNP
rs558511500 2618 dbSNP
rs1163256628 2621 dbSNP
rs1002279383 2625 dbSNP
rs573441943 2635 dbSNP
rs1242692936 2636 dbSNP
rs1477266822 2642 dbSNP
rs1269198173 2646 dbSNP
rs1476258794 2650 dbSNP
rs1449716653 2654 dbSNP
rs1266589675 2656 dbSNP
rs946305107 2657 dbSNP
rs751891816 2664 dbSNP
rs1041939849 2678 dbSNP
rs1413299049 2679 dbSNP
rs1216911738 2680 dbSNP
rs904693051 2681 dbSNP
rs773074491 2683 dbSNP
rs1439045304 2684 dbSNP
rs187188852 2685 dbSNP
rs1000401897 2697 dbSNP
rs1392428874 2698 dbSNP
rs1165489168 2700 dbSNP
rs755300150 2715 dbSNP
rs1015699412 2719 dbSNP
rs1167878831 2725 dbSNP
rs759847520 2729 dbSNP
rs1264499349 2730 dbSNP
rs898698663 2734 dbSNP
rs1034466615 2741 dbSNP
rs995523155 2748 dbSNP
rs1174040754 2749 dbSNP
rs1028846298 2751 dbSNP
rs544971288 2752 dbSNP
rs1376799545 2755 dbSNP
rs45471601 2761 dbSNP
rs757610587 2762 dbSNP
rs987215433 2766 dbSNP
rs1019646191 2770 dbSNP
rs879404239 2781 dbSNP
rs1024607890 2784 dbSNP
rs988084893 2792 dbSNP
rs1221095523 2796 dbSNP
rs1343162501 2803 dbSNP
rs970331213 2812 dbSNP
rs983774938 2812 dbSNP
rs765503456 2813 dbSNP
rs574047432 2814 dbSNP
rs1283996540 2816 dbSNP
rs1445403778 2819 dbSNP
rs1406098279 2822 dbSNP
rs983594998 2828 dbSNP
rs13391608 2838 dbSNP
rs1412355701 2839 dbSNP
rs1401094129 2845 dbSNP
rs979135177 2852 dbSNP
rs766192397 2876 dbSNP
rs926371936 2884 dbSNP
rs973291310 2895 dbSNP
rs1378392417 2902 dbSNP
rs1177856907 2905 dbSNP
rs781719917 2906 dbSNP
rs531066321 2907 dbSNP
rs1316793559 2912 dbSNP
rs1056528528 2916 dbSNP
rs896173641 2919 dbSNP
rs544732050 2925 dbSNP
rs921747355 2925 dbSNP
rs940266880 2926 dbSNP
rs1356369843 2927 dbSNP
rs1037261493 2929 dbSNP
rs1307543387 2935 dbSNP
rs1239987640 2943 dbSNP
rs562721787 2947 dbSNP
rs898646396 2962 dbSNP
rs1285411480 2965 dbSNP
rs1445225976 2970 dbSNP
rs775460544 2974 dbSNP
rs1028375946 2975 dbSNP
rs932075705 2978 dbSNP
rs1358325548 2983 dbSNP
rs1284832095 2984 dbSNP
rs1157849960 2998 dbSNP
rs1425176806 3000 dbSNP
rs1448693822 3004 dbSNP
rs1415920944 3012 dbSNP
rs1207704333 3023 dbSNP
rs1236697774 3043 dbSNP
rs987525459 3045 dbSNP
rs911904463 3047 dbSNP
rs773865278 3048 dbSNP
rs10167500 3052 dbSNP
rs10709967 3057 dbSNP
rs746540724 3057 dbSNP
rs78777122 3058 dbSNP
rs904801665 3064 dbSNP
rs528679986 3070 dbSNP
rs936231783 3079 dbSNP
rs1020015028 3080 dbSNP
rs956038366 3081 dbSNP
rs988032541 3082 dbSNP
rs1410737488 3086 dbSNP
rs544873994 3087 dbSNP
rs560029760 3088 dbSNP
rs967838391 3091 dbSNP
rs894616423 3092 dbSNP
rs1297321949 3093 dbSNP
rs527439771 3100 dbSNP
rs1454971301 3101 dbSNP
rs17258232 3102 dbSNP
rs1374248488 3112 dbSNP
rs1162675099 3115 dbSNP
rs926515028 3121 dbSNP
rs1413095357 3125 dbSNP
rs1046091041 3126 dbSNP
rs1478905049 3133 dbSNP
rs1261353560 3136 dbSNP
rs191651086 3138 dbSNP
rs937737429 3139 dbSNP
rs1489045655 3146 dbSNP
rs184461066 3148 dbSNP
rs1219931957 3149 dbSNP
rs753918552 3149 dbSNP
rs1321665452 3151 dbSNP
rs1004588231 3154 dbSNP
rs1279657079 3163 dbSNP
rs1219977499 3169 dbSNP
rs549877096 3171 dbSNP
rs1014992212 3173 dbSNP
rs917547734 3174 dbSNP
rs757698606 3179 dbSNP
rs1291588286 3198 dbSNP
rs1435614925 3199 dbSNP
rs1355077804 3205 dbSNP
rs568784998 3207 dbSNP
rs1467293602 3216 dbSNP
rs1421739043 3218 dbSNP
rs994735839 3219 dbSNP
rs1433989409 3229 dbSNP
rs1427639500 3238 dbSNP
rs771133211 3242 dbSNP
rs1461583755 3252 dbSNP
rs114242025 3254 dbSNP
rs1239369060 3254 dbSNP
rs774453227 3258 dbSNP
rs953158470 3261 dbSNP
rs987556829 3269 dbSNP
rs1256871321 3273 dbSNP
rs931600910 3274 dbSNP
rs1182543688 3277 dbSNP
rs372539493 3280 dbSNP
rs1477119198 3281 dbSNP
rs967852690 3283 dbSNP
rs1050346570 3284 dbSNP
rs889984623 3286 dbSNP
rs1373944310 3287 dbSNP
rs538655236 3288 dbSNP
rs1449085853 3295 dbSNP
rs552062290 3298 dbSNP
rs1430676913 3301 dbSNP
rs1041153032 3304 dbSNP
rs891760509 3309 dbSNP
rs1010248198 3316 dbSNP
rs767885381 3317 dbSNP
rs1381462963 3319 dbSNP
rs1397614816 3341 dbSNP
rs370765290 3348 dbSNP
rs570752784 3348 dbSNP
rs66921545 3348 dbSNP
rs200482849 3350 dbSNP
rs201293627 3352 dbSNP
rs199956718 3353 dbSNP
rs1328873284 3355 dbSNP
rs967953363 3361 dbSNP
rs1236985614 3365 dbSNP
rs950256423 3366 dbSNP
rs1000811107 3370 dbSNP
rs1484013924 3372 dbSNP
rs1433752699 3373 dbSNP
rs750737423 3376 dbSNP
rs959251287 3380 dbSNP
rs1311193218 3382 dbSNP
rs1324223270 3382 dbSNP
rs1376104385 3385 dbSNP
rs906313060 3385 dbSNP
rs1306342856 3388 dbSNP
rs1396725744 3403 dbSNP
rs992297361 3408 dbSNP
rs1381598908 3411 dbSNP
rs16831181 3415 dbSNP
rs960995974 3419 dbSNP
rs569535849 3421 dbSNP
rs188858589 3429 dbSNP
rs755795491 3435 dbSNP
rs1465732210 3438 dbSNP
rs1338907545 3442 dbSNP
rs534544503 3452 dbSNP
rs1036048761 3453 dbSNP
rs1418368150 3456 dbSNP
rs1380271961 3462 dbSNP
rs1187618418 3472 dbSNP
rs898797652 3473 dbSNP
rs1253638304 3479 dbSNP
rs1180854082 3484 dbSNP
rs553610573 3494 dbSNP
rs1488422174 3496 dbSNP
rs994766530 3500 dbSNP
rs1214228053 3501 dbSNP
rs1352867323 3502 dbSNP
rs144154293 3510 dbSNP
rs1252994339 3516 dbSNP
rs1245600769 3518 dbSNP
rs1323506093 3524 dbSNP
rs779798705 3527 dbSNP
rs1028877200 3529 dbSNP
rs1270182355 3532 dbSNP
rs1300407869 3539 dbSNP
rs1398597133 3541 dbSNP
rs953274670 3542 dbSNP
rs1164409513 3550 dbSNP
rs1459902837 3551 dbSNP
rs1366144179 3557 dbSNP
rs1163489637 3558 dbSNP
rs972365204 3559 dbSNP
rs1477924720 3562 dbSNP
rs1264943932 3564 dbSNP
rs1191218045 3568 dbSNP
rs1481718435 3574 dbSNP
rs919633477 3576 dbSNP
rs1263714465 3579 dbSNP
rs1423365705 3579 dbSNP
rs45528139 3587 dbSNP
rs1168125699 3591 dbSNP
rs1280402026 3595 dbSNP
rs967505401 3599 dbSNP
rs1326148084 3600 dbSNP
rs574208710 3603 dbSNP
rs925983828 3606 dbSNP
rs754572481 3608 dbSNP
rs1346002691 3616 dbSNP
rs957561805 3626 dbSNP
rs1465741721 3627 dbSNP
rs991446554 3628 dbSNP
rs140664834 3629 dbSNP
rs944222315 3630 dbSNP
rs1276303007 3631 dbSNP
rs556638011 3634 dbSNP
rs1477296959 3637 dbSNP
rs1325624712 3640 dbSNP
rs1200769649 3643 dbSNP
rs577579213 3649 dbSNP
rs572062656 3653 dbSNP
rs1266651837 3658 dbSNP
rs181699676 3660 dbSNP
rs891877578 3661 dbSNP
rs1196921692 3663 dbSNP
rs185613485 3672 dbSNP
rs1036489970 3676 dbSNP
rs1292609585 3682 dbSNP
rs898835796 3688 dbSNP
rs1303400849 3693 dbSNP
rs1448173081 3696 dbSNP
rs1490965744 3698 dbSNP
rs1043058489 3709 dbSNP
rs930336927 3717 dbSNP
rs1408967588 3723 dbSNP
rs904550923 3726 dbSNP
rs748100135 3734 dbSNP
rs1050081862 3737 dbSNP
rs1476953986 3738 dbSNP
rs1394402544 3747 dbSNP
rs889059175 3749 dbSNP
rs1441481875 3755 dbSNP
rs1240052973 3757 dbSNP
rs148699735 3759 dbSNP
rs1261712676 3761 dbSNP
rs1429462937 3769 dbSNP
rs572002638 3770 dbSNP
rs558367609 3779 dbSNP
rs1202539065 3780 dbSNP
rs1018791056 3781 dbSNP
rs902979435 3784 dbSNP
rs1001159991 3786 dbSNP
rs998951927 3793 dbSNP
rs576827804 3797 dbSNP
rs534519881 3798 dbSNP
rs1442405003 3803 dbSNP
rs1033621705 3805 dbSNP
rs1440903626 3809 dbSNP
rs1162300265 3811 dbSNP
rs1335854915 3812 dbSNP
rs1365654198 3817 dbSNP
rs1426067561 3819 dbSNP
rs1033549936 3825 dbSNP
rs1421402285 3827 dbSNP
rs200891150 3832 dbSNP
rs1384216314 3838 dbSNP
rs1382536898 3839 dbSNP
rs1947112 3840 dbSNP
rs777729294 3842 dbSNP
rs1469748592 3845 dbSNP
rs190472437 3853 dbSNP
rs531555131 3858 dbSNP
rs1189804047 3859 dbSNP
rs1316082779 3869 dbSNP
rs1484826403 3871 dbSNP
rs961110317 3875 dbSNP
rs1257206044 3879 dbSNP
rs1022904108 3881 dbSNP
rs972480172 3882 dbSNP
rs549578000 3886 dbSNP
rs1284581306 3890 dbSNP
rs1222703117 3894 dbSNP
rs1356356070 3896 dbSNP
rs1238127253 3913 dbSNP
rs1445299569 3913 dbSNP
rs919580545 3918 dbSNP
rs564982225 3920 dbSNP
rs1298552163 3922 dbSNP
rs760744710 3923 dbSNP
rs746756935 3926 dbSNP
rs986077212 3929 dbSNP
rs1401670565 3932 dbSNP
rs1486491295 3935 dbSNP
rs911484809 3939 dbSNP
rs1405892151 3941 dbSNP
rs1414566068 3942 dbSNP
rs944321492 3946 dbSNP
rs1474330556 3949 dbSNP
rs180865919 3951 dbSNP
rs940148119 3954 dbSNP
rs1041230129 3955 dbSNP
rs1240725814 3956 dbSNP
rs1254512053 3958 dbSNP
rs1461198698 3960 dbSNP
rs185296854 3961 dbSNP
rs1182582750 3965 dbSNP
rs1333680264 3967 dbSNP
rs920375171 3985 dbSNP
rs565720229 3991 dbSNP
rs763667053 3992 dbSNP
rs946098444 3994 dbSNP
rs534210140 3996 dbSNP
rs1338073078 4001 dbSNP
rs549676885 4002 dbSNP
rs567728377 4004 dbSNP
rs1437058517 4006 dbSNP
rs1156357213 4010 dbSNP
rs763083703 4013 dbSNP
rs1043174625 4015 dbSNP
rs1325581285 4016 dbSNP
rs1459993530 4022 dbSNP
rs1417412114 4023 dbSNP
rs1171572367 4036 dbSNP
rs1050104417 4038 dbSNP
rs1186335285 4042 dbSNP
rs1417753031 4042 dbSNP
rs1478627529 4045 dbSNP
rs904503457 4047 dbSNP
rs937363743 4048 dbSNP
rs768789926 4052 dbSNP
rs1399796158 4054 dbSNP
rs776244094 4055 dbSNP
rs1305439418 4057 dbSNP
rs1337614678 4063 dbSNP
rs1219638245 4071 dbSNP
rs1369623181 4072 dbSNP
rs1040655242 4082 dbSNP
rs903098022 4083 dbSNP
rs999127769 4087 dbSNP
rs1237984563 4088 dbSNP
rs1032831737 4090 dbSNP
rs1467344954 4093 dbSNP
rs1353021200 4095 dbSNP
rs45453394 4096 dbSNP
rs1013961280 4100 dbSNP
rs774240840 4105 dbSNP
rs190398711 4106 dbSNP
rs1454237054 4114 dbSNP
rs1238206593 4125 dbSNP
rs993849965 4134 dbSNP
rs1479441002 4135 dbSNP
rs116241689 4138 dbSNP
rs45490697 4143 dbSNP
rs1277943696 4145 dbSNP
rs767971470 4150 dbSNP
rs1243332968 4155 dbSNP
rs1310043985 4163 dbSNP
rs1462395514 4168 dbSNP
rs1371444000 4169 dbSNP
rs577715058 4175 dbSNP
rs1297891025 4182 dbSNP
rs1466755320 4183 dbSNP
rs1174913465 4191 dbSNP
rs1361210281 4191 dbSNP
rs1172193512 4193 dbSNP
rs1434608582 4195 dbSNP
rs1249216520 4204 dbSNP
rs144666815 4206 dbSNP
rs1416859030 4210 dbSNP
rs1249217562 4211 dbSNP
rs1161189708 4212 dbSNP
rs1484042704 4219 dbSNP
rs1427178188 4227 dbSNP
rs111705714 4229 dbSNP
rs1209948525 4236 dbSNP
rs965637987 4237 dbSNP
rs1176911231 4241 dbSNP
rs1408494367 4243 dbSNP
rs1288151074 4252 dbSNP
rs1241272411 4259 dbSNP
rs977028422 4260 dbSNP
rs1297884733 4269 dbSNP
rs1374130487 4270 dbSNP
rs913371563 4272 dbSNP
rs1306410554 4276 dbSNP
rs1016301282 4278 dbSNP
rs961643086 4280 dbSNP
rs946213117 4282 dbSNP
rs1414613893 4283 dbSNP
rs778295320 4291 dbSNP
rs920066405 4292 dbSNP
rs750900687 4295 dbSNP
rs1345469816 4307 dbSNP
rs1224454287 4309 dbSNP
rs1265405547 4312 dbSNP
rs1362664254 4314 dbSNP
rs1164901523 4317 dbSNP
rs930390989 4321 dbSNP
rs1325162322 4323 dbSNP
rs1201999908 4326 dbSNP
rs1186946933 4332 dbSNP
rs1488534119 4337 dbSNP
rs1250473041 4338 dbSNP
rs1203257790 4350 dbSNP
rs373281385 4354 dbSNP
rs1485519386 4356 dbSNP
rs985841767 4370 dbSNP
rs1480663204 4371 dbSNP
rs1337210096 4372 dbSNP
rs910220088 4378 dbSNP
rs1266639787 4384 dbSNP
rs926070354 4387 dbSNP
rs944409956 4396 dbSNP
rs1320719452 4410 dbSNP
rs1380984871 4410 dbSNP
rs553736992 4413 dbSNP
rs572136480 4414 dbSNP
rs1384925163 4418 dbSNP
rs761078691 4422 dbSNP
rs542529667 4423 dbSNP
rs1055797801 4425 dbSNP
rs376974226 4427 dbSNP
rs761432422 4427 dbSNP
rs1425451178 4437 dbSNP
rs892943821 4441 dbSNP
rs370201450 4448 dbSNP
rs766638383 4450 dbSNP
rs1408053277 4451 dbSNP
rs1210504872 4456 dbSNP
rs540482045 4466 dbSNP
rs753590834 4467 dbSNP
rs1012962624 4469 dbSNP
rs1044420368 4470 dbSNP
rs949291774 4471 dbSNP
rs1463553191 4472 dbSNP
rs13389642 4481 dbSNP
rs576117967 4488 dbSNP
rs896953487 4503 dbSNP
rs750108199 4506 dbSNP
rs1345371507 4508 dbSNP
rs1015583951 4509 dbSNP
rs543606114 4510 dbSNP
rs995742433 4511 dbSNP
rs1027161802 4512 dbSNP
rs1465788193 4513 dbSNP
rs993969432 4513 dbSNP
rs1026808193 4517 dbSNP
rs1406095911 4525 dbSNP
rs888199864 4529 dbSNP
rs115392960 4543 dbSNP
rs376461739 4544 dbSNP
rs377082541 4547 dbSNP
rs985624077 4547 dbSNP
rs1017924989 4548 dbSNP
rs910336459 4557 dbSNP
rs1200838389 4559 dbSNP
rs1452528892 4560 dbSNP
rs1251177593 4561 dbSNP
rs1193132905 4562 dbSNP
rs746630400 4562 dbSNP
rs1275458025 4563 dbSNP
rs965810047 4563 dbSNP
rs965427785 4565 dbSNP
rs1294373391 4570 dbSNP
rs1307750443 4571 dbSNP
rs1369477933 4574 dbSNP
rs924278254 4578 dbSNP
rs1302030046 4584 dbSNP
rs1446953573 4587 dbSNP
rs1337158542 4592 dbSNP
rs934587179 4594 dbSNP
rs1390474687 4596 dbSNP
rs1402582226 4606 dbSNP
rs1205931526 4619 dbSNP
rs1432753383 4623 dbSNP
rs1394455664 4627 dbSNP
rs1054267295 4646 dbSNP
rs976976451 4647 dbSNP
rs948598042 4651 dbSNP
rs1179853244 4654 dbSNP
rs528376183 4655 dbSNP
rs907327450 4660 dbSNP
rs1213526017 4661 dbSNP
rs967508259 4663 dbSNP
rs978919073 4664 dbSNP
rs1352142369 4670 dbSNP
rs1037451491 4677 dbSNP
rs1237832172 4687 dbSNP
rs541703716 4689 dbSNP
rs1340741073 4690 dbSNP
rs926155371 4691 dbSNP
rs1412768436 4700 dbSNP
rs937424396 4701 dbSNP
rs897117983 4706 dbSNP
rs996162073 4708 dbSNP
rs1027276497 4720 dbSNP
rs1185747766 4720 dbSNP
rs1420432187 4727 dbSNP
rs547549140 4731 dbSNP
rs561988006 4734 dbSNP
rs1190503329 4735 dbSNP
rs917229385 4738 dbSNP
rs1161678026 4739 dbSNP
rs1257274709 4741 dbSNP
rs1007091937 4744 dbSNP
rs778498234 4746 dbSNP
rs529710931 4750 dbSNP
rs1305469408 4758 dbSNP
rs1343993810 4763 dbSNP
rs181199141 4775 dbSNP
rs1289844614 4778 dbSNP
rs1362133510 4789 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.724 1.5e-4 0.777 2.8e-5 20 Click to see details
GSE21032 Prostate cancer 0.342 7.8e-4 0.270 6.8e-3 83 Click to see details
GSE19783 ER- ER- breast cancer 0.229 2.1e-2 0.216 2.8e-2 79 Click to see details
GSE28260 Renal cortex and medulla -0.534 3.0e-2 -0.412 8.1e-2 13 Click to see details
GSE38226 Liver fibrosis -0.407 3.4e-2 -0.264 1.2e-1 21 Click to see details
GSE19536 Breast cancer 0.172 4.4e-2 0.123 1.1e-1 100 Click to see details
GSE19350 CNS germ cell tumors 0.425 8.4e-2 0.077 4.1e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.244 1.5e-1 -0.205 1.9e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.164 1.8e-1 -0.148 2.1e-1 32 Click to see details
GSE28544 Breast cancer -0.189 1.9e-1 -0.530 3.9e-3 24 Click to see details
GSE17306 Multiple myeloma -0.122 2.0e-1 -0.148 1.6e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.089 3.4e-1 0.095 3.3e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.111 3.4e-1 0.126 3.2e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.084 3.4e-1 -0.074 3.6e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.046 3.6e-1 0.056 3.3e-1 64 Click to see details
GSE17498 Multiple myeloma 0.024 4.4e-1 -0.033 4.2e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells 0.028 4.5e-1 0.171 2.2e-1 23 Click to see details
GSE14794 Lymphoblastoid cells 0.012 4.6e-1 0.002 4.9e-1 90 Click to see details
GSE21849 B cell lymphoma 0.01 4.8e-1 0.143 2.3e-1 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.008 4.8e-1 0.197 1.7e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.008 4.8e-1 0.197 1.7e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.981 0.01 1.000 0.5 4 Click to see details
BRCA -0.151 0.09 -0.208 0.03 84 Click to see details
ESCA -0.437 0.09 -0.527 0.05 11 Click to see details
PCPG -0.944 0.11 -1.000 0.5 3 Click to see details
HNSC 0.183 0.12 0.181 0.13 42 Click to see details
KIRC 0.141 0.13 0.204 0.05 68 Click to see details
KICH -0.174 0.2 -0.108 0.3 25 Click to see details
UCEC 0.195 0.21 0.109 0.33 19 Click to see details
LUSC 0.132 0.21 0.228 0.08 38 Click to see details
KIRP 0.14 0.22 0.168 0.18 32 Click to see details
THCA 0.097 0.23 0.070 0.3 59 Click to see details
CHOL -0.261 0.25 -0.133 0.37 9 Click to see details
STAD 0.114 0.27 0.123 0.25 32 Click to see details
LIHC 0.088 0.27 0.076 0.3 49 Click to see details
LUAD 0.168 0.3 0.119 0.36 12 Click to see details
BLCA 0.126 0.31 0.040 0.44 18 Click to see details
COAD -0.203 0.31 -0.476 0.12 8 Click to see details
CESC 0.201 0.44 0.500 0.33 3 Click to see details
PRAD -0.023 0.44 0.101 0.24 50 Click to see details
PRAD -0.023 0.44 0.101 0.24 50 Click to see details
PRAD -0.023 0.44 0.101 0.24 50 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1