miRTarBase - #MIRT084462 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SOWAHC   
Synonyms ANKRD57, C2orf26
Description sosondowah ankyrin repeat domain family member C
Transcript NM_023016   
Expression
Putative miRNA Targets on SOWAHC
3'UTR of SOWAHC
(miRNA target sites are highlighted)
>SOWAHC|NM_023016|3'UTR
   1 AAATTGCTTCTTTTAGAAAATGCAAAGGTTTATTTGTCTTAATAAATTGAATACTAGGTGTTGTAAGGAAGTGAGACCAG
  81 AAGGACAAGCTAAATTATGCATTCTTACTTGAGGGATCGGAATGGATGGGGCGGAGTTCTCTTCAGGCTAGCCTTCTGGG
 161 AAAAGTGGATGTCTTTTTCAGAGATTCATCATACCTTGACCTGTACCTCTTCTCTGCCCTCCACTTCCCTGCCCTGGAGT
 241 CCGTTTCTGGAGACTAGAAATGTATCTAAATTGGGGGAACAGAATGAATGAATTAATGAATGAGAGTTCCTTTGCTTTAA
 321 CCATTCCTGGATGCCTGCAAAGTAAGGAATAATGCAGTTTTTATGTATCTGATTTTATAAGGGGTTACTCTTTCAAGAGT
 401 AACAAAAAAATGCAAACTGTAATGAAACTACATTGTATTTCTAAGTGTGAAAACGACAGGCTGCCCCGTTTTTACTAATT
 481 GCATTTGCATTTTAAGGTACTACTGAAGGTCAGATCAAAGTTGAAATGCAAAAATACTAATTAGAGAATAATGTGAATAA
 561 AATGGGAATCTTCTTGGTATTTTATGTGTATTGTAAGTAGCAGTTAAATTATTTTTTTAAAAGCAATTTCAGTTTTAATC
 641 ACTGAACAAAAGAAACAGGCAACATTCACTTCTGTAGTATGGTTTCCACCTATCTCTAACACCACTATTAAGGTACACCA
 721 GTGTTAAGGTACATTAATAACTACACAAAATTTTATTTAAAGAGAACACTTAGCAGCCTATGATAGTTTTCAATAAAATG
 801 TTGCCTCTCTTTCGGATTCTCACTAACTTTTGTTACTATTCTAAAAGTTTGAATTTGCTGGGGTGTTTATTCTGAGGATT
 881 ATTTAACCATTGTTCTATTTGGCATAACCCTATTTAATGGTGCTTAGAGCTGAATTACCTACAGAAACTGTTTCTGGTTT
 961 AAATAATTAGCACAAATTGGCCTAAGTATTCATGAGCCCATGTTTCTGTGAAGTAATTATTAAACCAACTTAATGATTCT
1041 TATGTAAGGTACACTTTTTATTTTAATACATTGGTAGTCTCTATGACTTGTAGCAATGTTTTACAAATGTTTAAAATGCT
1121 AAACTTAATTTTCCAAGCTTTTCTTGACAATTAGATACCTATCCTGTAGTTACTGAAAATCTGGGTAGTAAATCTACCCA
1201 ATTAAAATGGCACTTTATAAAAGGGAATAGAGAAGAGATGGGACTATTTCTATATTTAAATGCTGCTGGCTATTCCTTTG
1281 TATATAAATGAAAAATACCATTCATTAAAATTAAGTACTCGTTTAAGTATGGTTCTTAATTACATTTCATTCATTTATAT
1361 TAGAGTAAATGGCTTCATAACTACTTTAAAATTTAACCCACAAGCATATTAAATCTGTTTGTTATAAGATTGGAAACAAT
1441 TTTTGAGAGGGACTAATTTAAACAAGTCCTCCTTTAGTCTTTTGGGTCGCGTAGTTGCTGAAACCTAAGTACCTGCAGCC
1521 TACAGGATAAGGAAGTTCACAGCCTGCGGGGTGAATGAACCCATGTGTGAACTGCACAGAGCAATTCATAGAAAATGCAT
1601 AGAAATTTGTAACACTTTGGTCACATCTGTCTCTAGATGGTCATTGAATTTGTTTAAAGATGGATGAAAGGCCAGGCATG
1681 GTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCACTTGAGGCCAGGAGTTTGAAACCAGCCT
1761 GGCCAACATGGTGAAAACCTGTCTCTACTAAAAATACAAAAATTAGCCGAGCGTGGTGGTGCGTGCCTGTAGTCCCAGCT
1841 ACTTAGGAGGCTGAGGCATGAGAATCACTTAAACCTGAGAGGTGGAGGTTGCAGTTGAGCCAAGATCACGACACTGCACT
1921 CCAGCCTGGGCAACGGAGACTCTGTCTCAAAAAAAAAAAAAAAAAAGATGAATGAAAATATGAAATATATAAACTAGTAT
2001 CCATTTATTTGCATTTATTGTGGGATTTCAGATATGAACGGTGTAAATTTGAGAAGCACTTATGCATACATGTGGGTGAA
2081 AAACCAATCTAATTTTGTATAAATAAAAACAGGCTCCTGGAAGGTGAAAAGTAGTCATTTGTTCTAAATCTATACATATT
2161 ACTTGTATCTAGTGCAGAATAAGCTATAACATCCCATTGAGGAATCTTAAATTTCATAGACATGTAAAGCTGAAGTAACT
2241 CTAAAGAGCAGATGCTTCAGAACCATCAGAAGGTTCTGGTCAACAGTCAGTATTATCTCTTAAATGTATATGTTGGTCAC
2321 TAATTGCACAAAATCTATAATTTGCCAGGGCTTTAGAGATTGAGTCAATATGTCATTTACCATGGTTTTCCCACTGAAGG
2401 CTTTAACTTTTCTGATAAAATAATATTTTAAATTTTCAAAAACCCATTCCTGAGGAGAACTACTTCTAGCATTCCTTTTC
2481 ATGATGTGCTTTTGTGCAGTAAGTAGCATTTTCGGCTACTTAACTTTACATTCCTCTTATTTTTCAGTTTCCAGTCAAGA
2561 TTATAAAAAGCAAATGATTGATATAATTTGATATTCATAGAGTTGTGCCTACCTTTAATGGAAAAATACATGTCAGATAC
2641 TTAGATGTTTATTGATATGAGACTATGTGGTTAAAAAACCCAAGTATGTCCATGTGTTTCTTATAAGGTACACTTGAAAC
2721 TAGTGAGTGTTTGTCACATTTCACTTTCATGGTATATAAAATGCAGTTTGCATATATAACTTGAATATCTGGTACTAGTT
2801 TTTTCACGCCTGCAATCTTGGAGTCTAGGTTGCCTTGTCTCTCCTATTTTTAAATAAGTGAAATTTGGGAGATTGTAAAA
2881 TCTGTAAAGTTTGTTTTGTGAAAATAAAATGTTCACAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   |||  ||||||| 
Target 5' tttctatatTTAAATGCTGCTg 3'
1247 - 1268 149.00 -10.70
2
miRNA  3' guGU-UUGG--UAAUACACGACGAu 5'
            || ||||  |||   || |||| 
Target 5' ggCATAACCCTATTTAATGGTGCTt 3'
901 - 925 126.00 -12.20
3
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                :||| ||||||| :| 
Target 5' tcctttTCATGATGTGCTTTTg 3'
2473 - 2494 120.00 -11.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1398752 4 COSMIC
COSN31485644 31 COSMIC
COSN31540828 55 COSMIC
COSN15626357 74 COSMIC
COSN31778172 92 COSMIC
COSN30527513 102 COSMIC
COSN32065707 115 COSMIC
COSN15626358 242 COSMIC
COSN15626359 253 COSMIC
COSN31530265 267 COSMIC
COSN28701919 295 COSMIC
COSN31596486 368 COSMIC
COSN30115495 620 COSMIC
COSN25975320 643 COSMIC
COSN17037512 649 COSMIC
COSN30136449 656 COSMIC
COSN30533413 694 COSMIC
COSN30511825 851 COSMIC
COSN30141861 884 COSMIC
COSN31543280 943 COSMIC
COSN30143021 987 COSMIC
COSN30122207 1152 COSMIC
COSN30530247 1176 COSMIC
COSN31517238 1251 COSMIC
COSN26635208 1291 COSMIC
COSN30123603 1352 COSMIC
COSN30528966 1460 COSMIC
COSN30528324 1492 COSMIC
COSN30142150 1592 COSMIC
COSN26664645 1630 COSMIC
COSN30140366 1644 COSMIC
COSN1777886 1645 COSMIC
COSN26571333 1679 COSMIC
COSN30127448 1707 COSMIC
COSN31589852 1733 COSMIC
COSN8553666 1844 COSMIC
COSN30512434 1940 COSMIC
COSN1777888 1989 COSMIC
COSN15626360 2042 COSMIC
COSN31490021 2052 COSMIC
COSN31570092 2061 COSMIC
COSN24922731 2108 COSMIC
COSN26504526 2117 COSMIC
COSN23835647 2187 COSMIC
COSN30173119 2252 COSMIC
COSN26563729 2287 COSMIC
COSN31551630 2400 COSMIC
COSN31485778 2402 COSMIC
COSN30114118 2435 COSMIC
COSN30124849 2454 COSMIC
COSN31533735 2547 COSMIC
COSN30139138 2642 COSMIC
COSN30119235 2674 COSMIC
COSN1777890 2749 COSMIC
COSN30533747 2830 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1367977438 8 dbSNP
rs953898350 16 dbSNP
rs147020337 17 dbSNP
rs1456265171 23 dbSNP
rs1356219247 24 dbSNP
rs1430533138 29 dbSNP
rs899536425 29 dbSNP
rs1459406047 33 dbSNP
rs1161372071 34 dbSNP
rs773994069 38 dbSNP
rs779274606 40 dbSNP
rs761395714 41 dbSNP
rs138108589 47 dbSNP
rs771698451 53 dbSNP
rs1487785302 60 dbSNP
rs1199876173 61 dbSNP
rs143655240 62 dbSNP
rs1205212639 64 dbSNP
rs776927279 73 dbSNP
rs1424271809 74 dbSNP
rs1234906235 87 dbSNP
rs1431632235 90 dbSNP
rs1312412055 91 dbSNP
rs1029947223 92 dbSNP
rs972975351 105 dbSNP
rs1352225698 109 dbSNP
rs1308615270 110 dbSNP
rs1409163128 111 dbSNP
rs1369982553 119 dbSNP
rs1467723684 120 dbSNP
rs1175790103 121 dbSNP
rs545187598 128 dbSNP
rs1033482802 132 dbSNP
rs1183470979 141 dbSNP
rs1483030865 150 dbSNP
rs1461495484 156 dbSNP
rs1201684965 158 dbSNP
rs4953847 162 dbSNP
rs564670087 164 dbSNP
rs981585534 168 dbSNP
rs1288788517 169 dbSNP
rs1227642689 174 dbSNP
rs1348571475 180 dbSNP
rs1326921050 182 dbSNP
rs915905931 188 dbSNP
rs1302536842 190 dbSNP
rs1468452688 192 dbSNP
rs1472515688 193 dbSNP
rs971401454 193 dbSNP
rs927498330 195 dbSNP
rs527385045 199 dbSNP
rs1423940791 200 dbSNP
rs927905961 202 dbSNP
rs4953848 206 dbSNP
rs867676580 213 dbSNP
rs946079369 215 dbSNP
rs1207942111 220 dbSNP
rs1307726401 226 dbSNP
rs1326992266 229 dbSNP
rs1285922373 237 dbSNP
rs1247053368 241 dbSNP
rs1341087780 244 dbSNP
rs1312130556 264 dbSNP
rs941114495 264 dbSNP
rs1271943237 266 dbSNP
rs866484998 267 dbSNP
rs4953849 276 dbSNP
rs1457104284 280 dbSNP
rs1383413028 282 dbSNP
rs899485137 283 dbSNP
rs1223197056 287 dbSNP
rs1458894244 291 dbSNP
rs997873382 292 dbSNP
rs759656781 294 dbSNP
rs4953850 295 dbSNP
rs933920640 301 dbSNP
rs1487356217 310 dbSNP
rs1051337462 319 dbSNP
rs889631777 325 dbSNP
rs1187666569 330 dbSNP
rs550070250 334 dbSNP
rs569929698 338 dbSNP
rs539068274 339 dbSNP
rs1264881644 343 dbSNP
rs1243943999 345 dbSNP
rs1367613918 347 dbSNP
rs1188062791 358 dbSNP
rs1007050637 359 dbSNP
rs1420413328 364 dbSNP
rs1434676697 365 dbSNP
rs552581811 375 dbSNP
rs528853654 376 dbSNP
rs898145059 391 dbSNP
rs1406406145 392 dbSNP
rs957806527 394 dbSNP
rs1161131957 395 dbSNP
rs183400209 398 dbSNP
rs535131671 402 dbSNP
rs554718767 424 dbSNP
rs1167515236 429 dbSNP
rs981698806 432 dbSNP
rs1303036109 433 dbSNP
rs1034927207 434 dbSNP
rs574999283 445 dbSNP
rs1433253264 448 dbSNP
rs751847593 453 dbSNP
rs1199323069 461 dbSNP
rs1023030181 464 dbSNP
rs1220308213 467 dbSNP
rs958935947 468 dbSNP
rs537215236 469 dbSNP
rs1289818772 478 dbSNP
rs1362215234 482 dbSNP
rs914685999 490 dbSNP
rs1337710966 498 dbSNP
rs1276964608 501 dbSNP
rs1437719056 503 dbSNP
rs557670850 509 dbSNP
rs527240718 514 dbSNP
rs927839419 527 dbSNP
rs946151205 528 dbSNP
rs1294738312 537 dbSNP
rs1412246367 538 dbSNP
rs1370588990 553 dbSNP
rs1002034456 556 dbSNP
rs577102705 561 dbSNP
rs1426902365 562 dbSNP
rs1172941462 567 dbSNP
rs909706502 569 dbSNP
rs386649134 570 dbSNP
rs116040486 571 dbSNP
rs6726252 572 dbSNP
rs1039452929 573 dbSNP
rs933869670 574 dbSNP
rs1436290590 577 dbSNP
rs1281047251 578 dbSNP
rs1051061501 582 dbSNP
rs866483698 589 dbSNP
rs889611504 594 dbSNP
rs1217673149 601 dbSNP
rs1281803085 611 dbSNP
rs1242552212 620 dbSNP
rs942579885 626 dbSNP
rs1464598263 628 dbSNP
rs1306858306 629 dbSNP
rs1038513217 635 dbSNP
rs1360502687 648 dbSNP
rs1245238552 650 dbSNP
rs781475664 658 dbSNP
rs1272686382 660 dbSNP
rs1445259319 668 dbSNP
rs933614966 674 dbSNP
rs1412170312 675 dbSNP
rs1050756871 681 dbSNP
rs1411243975 688 dbSNP
rs758028596 689 dbSNP
rs1468715365 700 dbSNP
rs934920994 704 dbSNP
rs1211034893 708 dbSNP
rs1055144876 711 dbSNP
rs144056800 713 dbSNP
rs148213551 714 dbSNP
rs755885184 733 dbSNP
rs1330425178 734 dbSNP
rs906906366 737 dbSNP
rs1221551147 744 dbSNP
rs1380644286 752 dbSNP
rs1003528432 760 dbSNP
rs1284284266 763 dbSNP
rs1433859565 768 dbSNP
rs529914027 770 dbSNP
rs746269244 774 dbSNP
rs543235438 777 dbSNP
rs563601913 778 dbSNP
rs532444474 779 dbSNP
rs552643948 790 dbSNP
rs1384564492 795 dbSNP
rs566083166 796 dbSNP
rs1407041830 799 dbSNP
rs866587198 802 dbSNP
rs572189609 808 dbSNP
rs967399940 810 dbSNP
rs564201167 811 dbSNP
rs1002788181 826 dbSNP
rs373625961 828 dbSNP
rs572858659 828 dbSNP
rs977477047 831 dbSNP
rs1190873284 833 dbSNP
rs1260526196 835 dbSNP
rs1465668872 835 dbSNP
rs950814049 839 dbSNP
rs141206349 842 dbSNP
rs1289955232 843 dbSNP
rs1017289566 848 dbSNP
rs1380087617 849 dbSNP
rs1299433263 850 dbSNP
rs954744893 854 dbSNP
rs1360966633 858 dbSNP
rs1286902156 860 dbSNP
rs987111114 861 dbSNP
rs911167723 863 dbSNP
rs1438447888 864 dbSNP
rs942630961 871 dbSNP
rs1038178864 874 dbSNP
rs779884941 875 dbSNP
rs1424141191 878 dbSNP
rs919766187 888 dbSNP
rs929672788 890 dbSNP
rs1235860258 893 dbSNP
rs548679961 893 dbSNP
rs962515246 897 dbSNP
rs1046879094 898 dbSNP
rs1185204956 903 dbSNP
rs1489751704 904 dbSNP
rs1247847972 906 dbSNP
rs1178325129 910 dbSNP
rs1411913648 919 dbSNP
rs920981065 927 dbSNP
rs933731400 931 dbSNP
rs986988712 932 dbSNP
rs1219575166 936 dbSNP
rs1228595610 940 dbSNP
rs772374979 944 dbSNP
rs906854088 954 dbSNP
rs1002566503 958 dbSNP
rs1055886649 967 dbSNP
rs894695372 973 dbSNP
rs1293157141 976 dbSNP
rs1012248763 987 dbSNP
rs924286587 989 dbSNP
rs1407840418 992 dbSNP
rs1021707450 999 dbSNP
rs1302525648 1004 dbSNP
rs1403050151 1012 dbSNP
rs1414740663 1052 dbSNP
rs967557446 1054 dbSNP
rs998889428 1055 dbSNP
rs1168740507 1056 dbSNP
rs1435334232 1069 dbSNP
rs1030404346 1071 dbSNP
rs568447283 1086 dbSNP
rs1426345545 1091 dbSNP
rs954857993 1097 dbSNP
rs1490005202 1098 dbSNP
rs1356975802 1100 dbSNP
rs986127774 1103 dbSNP
rs910556979 1106 dbSNP
rs1280022088 1107 dbSNP
rs963961489 1118 dbSNP
rs974400828 1121 dbSNP
rs1349808596 1139 dbSNP
rs1280734843 1150 dbSNP
rs368724536 1162 dbSNP
rs537681789 1164 dbSNP
rs1249297023 1173 dbSNP
rs1211945454 1186 dbSNP
rs557271962 1188 dbSNP
rs1324517782 1198 dbSNP
rs1282430668 1211 dbSNP
rs1046829008 1212 dbSNP
rs928345709 1213 dbSNP
rs1352323282 1226 dbSNP
rs1200142103 1240 dbSNP
rs559368595 1245 dbSNP
rs1439592600 1248 dbSNP
rs1026846810 1253 dbSNP
rs549930486 1263 dbSNP
rs1055428244 1271 dbSNP
rs1296621608 1273 dbSNP
rs1467804660 1276 dbSNP
rs1407217577 1283 dbSNP
rs1176175185 1285 dbSNP
rs750775157 1286 dbSNP
rs1414916519 1299 dbSNP
rs1006654463 1301 dbSNP
rs894134381 1302 dbSNP
rs1182226384 1305 dbSNP
rs1251645129 1312 dbSNP
rs1011827521 1319 dbSNP
rs768165634 1320 dbSNP
rs1201775789 1321 dbSNP
rs568126306 1322 dbSNP
rs903349828 1325 dbSNP
rs1430491543 1328 dbSNP
rs999005307 1332 dbSNP
rs1030477972 1346 dbSNP
rs1478135964 1352 dbSNP
rs1268749678 1353 dbSNP
rs1171603179 1354 dbSNP
rs1238276281 1355 dbSNP
rs1399644045 1357 dbSNP
rs1411101229 1358 dbSNP
rs553201032 1363 dbSNP
rs954789076 1364 dbSNP
rs1008064587 1370 dbSNP
rs1383872285 1374 dbSNP
rs6594049 1382 dbSNP
rs1407979205 1385 dbSNP
rs1304705271 1387 dbSNP
rs1159602767 1403 dbSNP
rs1453714442 1407 dbSNP
rs1331509771 1416 dbSNP
rs963749854 1416 dbSNP
rs1189033613 1431 dbSNP
rs1444862020 1445 dbSNP
rs540634214 1449 dbSNP
rs115335761 1452 dbSNP
rs1466051231 1453 dbSNP
rs951294452 1454 dbSNP
rs924373383 1466 dbSNP
rs1204415441 1469 dbSNP
rs771688836 1472 dbSNP
rs982583358 1477 dbSNP
rs551599222 1489 dbSNP
rs938403100 1490 dbSNP
rs1314686811 1491 dbSNP
rs150708724 1492 dbSNP
rs1270279558 1495 dbSNP
rs915570900 1498 dbSNP
rs543648629 1500 dbSNP
rs1319395670 1505 dbSNP
rs6594050 1508 dbSNP
rs948968379 1516 dbSNP
rs1197221765 1517 dbSNP
rs1424803962 1518 dbSNP
rs532298563 1523 dbSNP
rs1476226536 1526 dbSNP
rs1044665191 1529 dbSNP
rs1450951909 1529 dbSNP
rs1192280740 1530 dbSNP
rs1445202035 1543 dbSNP
rs928795864 1544 dbSNP
rs938874908 1545 dbSNP
rs1047785924 1548 dbSNP
rs903424948 1549 dbSNP
rs1291169624 1550 dbSNP
rs775891529 1554 dbSNP
rs1344599092 1556 dbSNP
rs1271122365 1557 dbSNP
rs1427707955 1558 dbSNP
rs934930151 1561 dbSNP
rs546141413 1564 dbSNP
rs1038109322 1565 dbSNP
rs1364337298 1575 dbSNP
rs1391389188 1577 dbSNP
rs900543546 1587 dbSNP
rs1385953781 1588 dbSNP
rs1167070436 1596 dbSNP
rs1051847264 1610 dbSNP
rs996753070 1621 dbSNP
rs1028267313 1626 dbSNP
rs1268199134 1634 dbSNP
rs955167547 1639 dbSNP
rs1439745932 1643 dbSNP
rs1008489925 1645 dbSNP
rs1436152800 1647 dbSNP
rs879026315 1647 dbSNP
rs559652437 1651 dbSNP
rs1340094022 1656 dbSNP
rs531307056 1661 dbSNP
rs1224601116 1662 dbSNP
rs548268757 1663 dbSNP
rs955984046 1665 dbSNP
rs1018132920 1672 dbSNP
rs989953367 1683 dbSNP
rs1356270712 1687 dbSNP
rs1407888306 1688 dbSNP
rs568588805 1690 dbSNP
rs1404002196 1700 dbSNP
rs899144965 1707 dbSNP
rs1176902600 1710 dbSNP
rs1184295676 1718 dbSNP
rs1427197152 1719 dbSNP
rs530902738 1729 dbSNP
rs550622597 1733 dbSNP
rs570711340 1735 dbSNP
rs914228085 1753 dbSNP
rs994813689 1760 dbSNP
rs1233557509 1768 dbSNP
rs1264365658 1769 dbSNP
rs1448345038 1776 dbSNP
rs1026329138 1779 dbSNP
rs539613517 1786 dbSNP
rs1265373412 1788 dbSNP
rs1247064542 1790 dbSNP
rs763502161 1793 dbSNP
rs1447078343 1804 dbSNP
rs764673163 1805 dbSNP
rs1323409228 1807 dbSNP
rs1368915390 1809 dbSNP
rs1457399247 1810 dbSNP
rs553264463 1813 dbSNP
rs1439494389 1814 dbSNP
rs982697921 1815 dbSNP
rs368289006 1817 dbSNP
rs1035525758 1819 dbSNP
rs938836570 1821 dbSNP
rs751725111 1823 dbSNP
rs567035416 1824 dbSNP
rs1161237063 1827 dbSNP
rs1401223995 1828 dbSNP
rs1048370611 1830 dbSNP
rs1158130235 1839 dbSNP
rs907913945 1842 dbSNP
rs1184564322 1843 dbSNP
rs1461107958 1845 dbSNP
rs1241714235 1861 dbSNP
rs942107378 1867 dbSNP
rs533923691 1884 dbSNP
rs1457603694 1888 dbSNP
rs1320087381 1889 dbSNP
rs1363308561 1895 dbSNP
rs534643416 1896 dbSNP
rs1221642681 1903 dbSNP
rs1361111520 1904 dbSNP
rs1315253446 1908 dbSNP
rs947157629 1910 dbSNP
rs554265440 1911 dbSNP
rs1340378312 1912 dbSNP
rs1431375604 1920 dbSNP
rs201019601 1935 dbSNP
rs934877729 1936 dbSNP
rs1399083175 1937 dbSNP
rs1387182030 1939 dbSNP
rs1164405234 1940 dbSNP
rs376283534 1940 dbSNP
rs1444239189 1942 dbSNP
rs1383707332 1943 dbSNP
rs1330192600 1946 dbSNP
rs1188717752 1948 dbSNP
rs1208518960 1948 dbSNP
rs1491223083 1948 dbSNP
rs746426703 1948 dbSNP
rs773962454 1948 dbSNP
rs1214304179 1949 dbSNP
rs1361164220 1949 dbSNP
rs1406727014 1949 dbSNP
rs201947767 1949 dbSNP
rs373767394 1949 dbSNP
rs61290403 1949 dbSNP
rs796297128 1949 dbSNP
rs878951769 1949 dbSNP
rs1267033444 1950 dbSNP
rs1463272256 1955 dbSNP
rs1184891927 1956 dbSNP
rs1256307557 1962 dbSNP
rs1052008819 1964 dbSNP
rs1303848149 1967 dbSNP
rs1424243313 1968 dbSNP
rs1423144077 1970 dbSNP
rs1185280252 1973 dbSNP
rs890622257 1974 dbSNP
rs943554991 1989 dbSNP
rs1172946436 1991 dbSNP
rs1429531863 1996 dbSNP
rs574516298 1997 dbSNP
rs1386726974 2000 dbSNP
rs1185222487 2007 dbSNP
rs558727322 2008 dbSNP
rs1481714153 2023 dbSNP
rs1268964158 2025 dbSNP
rs530734127 2037 dbSNP
rs1039219522 2040 dbSNP
rs536756499 2041 dbSNP
rs1192133323 2043 dbSNP
rs1008020889 2057 dbSNP
rs767651239 2063 dbSNP
rs1293179301 2064 dbSNP
rs1225203463 2071 dbSNP
rs1346136484 2078 dbSNP
rs1401632560 2084 dbSNP
rs1283994954 2086 dbSNP
rs955931020 2088 dbSNP
rs139136813 2098 dbSNP
rs1011731394 2100 dbSNP
rs1462692945 2114 dbSNP
rs1354254472 2119 dbSNP
rs1168851269 2121 dbSNP
rs1021355020 2125 dbSNP
rs1430665669 2126 dbSNP
rs1198045009 2137 dbSNP
rs1479144602 2142 dbSNP
rs994928161 2144 dbSNP
rs577127199 2147 dbSNP
rs546003590 2151 dbSNP
rs1309723535 2157 dbSNP
rs1351656494 2160 dbSNP
rs1177354495 2162 dbSNP
rs1480112852 2166 dbSNP
rs750595260 2170 dbSNP
rs1228097204 2176 dbSNP
rs1286917511 2179 dbSNP
rs1326616201 2180 dbSNP
rs1205400267 2183 dbSNP
rs1324145112 2188 dbSNP
rs969673367 2202 dbSNP
rs1221635505 2212 dbSNP
rs559710939 2217 dbSNP
rs1211849745 2229 dbSNP
rs549809329 2233 dbSNP
rs979752927 2236 dbSNP
rs542246993 2239 dbSNP
rs1004124351 2241 dbSNP
rs72938300 2242 dbSNP
rs960572199 2260 dbSNP
rs187848115 2269 dbSNP
rs1013141367 2274 dbSNP
rs749070351 2284 dbSNP
rs1176292389 2285 dbSNP
rs1483382053 2291 dbSNP
rs1364962185 2294 dbSNP
rs1159266379 2296 dbSNP
rs1418143437 2296 dbSNP
rs1022810628 2309 dbSNP
rs1409541230 2322 dbSNP
rs1185176360 2337 dbSNP
rs1481522467 2338 dbSNP
rs550686577 2340 dbSNP
rs973460691 2345 dbSNP
rs1177005743 2350 dbSNP
rs1201628910 2352 dbSNP
rs1377305666 2358 dbSNP
rs1464556701 2359 dbSNP
rs192062107 2363 dbSNP
rs1316536854 2365 dbSNP
rs968405636 2365 dbSNP
rs567777044 2372 dbSNP
rs1046645 2376 dbSNP
rs931935095 2379 dbSNP
rs924279278 2383 dbSNP
rs35994763 2384 dbSNP
rs955741200 2390 dbSNP
rs553373882 2393 dbSNP
rs1394784245 2400 dbSNP
rs912105217 2401 dbSNP
rs1288910145 2406 dbSNP
rs1046646 2413 dbSNP
rs943645931 2414 dbSNP
rs1452488334 2419 dbSNP
rs556635716 2421 dbSNP
rs943943377 2427 dbSNP
rs1053068739 2430 dbSNP
rs1330145068 2437 dbSNP
rs772230258 2438 dbSNP
rs891608016 2439 dbSNP
rs1011385411 2452 dbSNP
rs1021302631 2455 dbSNP
rs546770067 2459 dbSNP
rs7421781 2461 dbSNP
rs1001119460 2469 dbSNP
rs920763424 2472 dbSNP
rs1204499189 2476 dbSNP
rs778818242 2481 dbSNP
rs930711580 2482 dbSNP
rs1283973842 2484 dbSNP
rs1248379473 2488 dbSNP
rs1360514341 2491 dbSNP
rs1314794095 2500 dbSNP
rs567200985 2514 dbSNP
rs886426360 2515 dbSNP
rs535765869 2516 dbSNP
rs183330686 2517 dbSNP
rs1230439583 2518 dbSNP
rs1358008221 2518 dbSNP
rs747714276 2526 dbSNP
rs1424897683 2530 dbSNP
rs963851286 2532 dbSNP
rs895694877 2534 dbSNP
rs34784982 2540 dbSNP
rs1476241312 2552 dbSNP
rs117575907 2571 dbSNP
rs973575167 2577 dbSNP
rs1476810466 2579 dbSNP
rs375730061 2580 dbSNP
rs1261112140 2583 dbSNP
rs921971333 2584 dbSNP
rs1490566850 2592 dbSNP
rs1023183179 2596 dbSNP
rs1208311035 2598 dbSNP
rs1204392715 2599 dbSNP
rs537009038 2616 dbSNP
rs1249565604 2619 dbSNP
rs1339180819 2622 dbSNP
rs968563684 2632 dbSNP
rs932049822 2635 dbSNP
rs771552349 2639 dbSNP
rs1191570219 2644 dbSNP
rs77125936 2645 dbSNP
rs955807230 2662 dbSNP
rs1411299151 2663 dbSNP
rs1170549864 2664 dbSNP
rs1167175377 2666 dbSNP
rs911865681 2667 dbSNP
rs1431410884 2670 dbSNP
rs987512144 2674 dbSNP
rs746630891 2675 dbSNP
rs188392467 2678 dbSNP
rs1480777666 2689 dbSNP
rs1246233046 2691 dbSNP
rs1196943728 2693 dbSNP
rs1439836752 2694 dbSNP
rs752951822 2695 dbSNP
rs539689269 2700 dbSNP
rs1198455776 2704 dbSNP
rs552880524 2705 dbSNP
rs1276333387 2711 dbSNP
rs1429224216 2722 dbSNP
rs1224694193 2724 dbSNP
rs935371681 2727 dbSNP
rs1053424454 2728 dbSNP
rs1443911423 2728 dbSNP
rs1368020989 2730 dbSNP
rs975062088 2731 dbSNP
rs1408058508 2732 dbSNP
rs920753357 2732 dbSNP
rs1042873711 2740 dbSNP
rs1437553441 2744 dbSNP
rs1424477204 2754 dbSNP
rs930826153 2759 dbSNP
rs1170961552 2771 dbSNP
rs770074183 2773 dbSNP
rs1233713681 2775 dbSNP
rs1178280928 2783 dbSNP
rs1456685772 2791 dbSNP
rs776043448 2798 dbSNP
rs1384764161 2799 dbSNP
rs1299134754 2808 dbSNP
rs939465337 2809 dbSNP
rs1275895426 2812 dbSNP
rs905744968 2816 dbSNP
rs1350920028 2834 dbSNP
rs1278545136 2835 dbSNP
rs1056834159 2838 dbSNP
rs113001438 2840 dbSNP
rs1337163870 2842 dbSNP
rs1451819275 2872 dbSNP
rs1357397553 2874 dbSNP
rs1013249997 2875 dbSNP
rs895446826 2878 dbSNP
rs1222023977 2886 dbSNP
rs1408843243 2891 dbSNP
rs1004565372 2898 dbSNP
rs35340131 2906 dbSNP
rs1264699683 2908 dbSNP
rs367647773 2917 dbSNP
rs796559578 2917 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   |||  ||||||| 
Target 5' uuucuauauUUAAAUGCUGCUg 3'
5 - 26
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000356454.3 | 3UTR | GACUAUUUCUAUAUUUAAAUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000356454.3 | 3UTR | ACUAUUUCUAUAUUUAAAUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000356454.3 | 3UTR | ACUAUUUCUAUAUUUAAAUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000356454.3 | 3UTR | ACUAUUUCUAUAUUUAAAUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.363 1.0e-4 0.184 3.3e-2 100 Click to see details
GSE19783 ER- ER- breast cancer 0.35 7.8e-4 0.177 5.9e-2 79 Click to see details
GSE21032 Prostate cancer -0.329 1.2e-3 -0.255 1.0e-2 83 Click to see details
GSE14794 Lymphoblastoid cells -0.28 3.8e-3 -0.282 3.5e-3 90 Click to see details
GSE28260 Renal cortex and medulla 0.58 1.9e-2 0.615 1.3e-2 13 Click to see details
GSE32688 Pancreatic cancer 0.355 2.3e-2 0.215 1.2e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.326 5.6e-2 -0.142 2.5e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.197 5.9e-2 -0.152 1.2e-1 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.304 7.9e-2 -0.387 3.4e-2 23 Click to see details
GSE17306 Multiple myeloma -0.156 1.4e-1 -0.119 2.1e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.319 1.6e-1 0.161 3.1e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.156 2.6e-1 -0.138 2.8e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.103 3.2e-1 -0.023 4.6e-1 24 Click to see details
GSE38226 Liver fibrosis -0.087 3.5e-1 -0.156 2.5e-1 21 Click to see details
GSE27834 Pluripotent stem cells -0.101 3.5e-1 -0.144 3.0e-1 16 Click to see details
GSE17498 Multiple myeloma -0.048 3.8e-1 0.064 3.5e-1 40 Click to see details
GSE28544 Breast cancer -0.05 4.1e-1 0.438 1.6e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.045 4.2e-1 0.050 4.1e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.033 4.5e-1 -0.223 1.7e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.033 4.5e-1 -0.223 1.7e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.033 4.5e-1 -0.223 1.7e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.487 0 0.455 0 42 Click to see details
THCA -0.381 0 -0.272 0.02 59 Click to see details
BLCA 0.623 0 0.662 0 18 Click to see details
LIHC -0.313 0.01 -0.182 0.11 49 Click to see details
BRCA -0.238 0.01 -0.186 0.05 84 Click to see details
CHOL -0.409 0.14 -0.467 0.1 9 Click to see details
ESCA 0.358 0.14 0.518 0.05 11 Click to see details
LUAD -0.27 0.2 -0.378 0.11 12 Click to see details
PAAD -0.554 0.22 -0.400 0.3 4 Click to see details
KICH -0.13 0.27 -0.109 0.3 25 Click to see details
KIRP -0.105 0.28 -0.157 0.2 32 Click to see details
COAD 0.198 0.32 -0.095 0.41 8 Click to see details
PCPG 0.436 0.36 0.500 0.33 3 Click to see details
CESC 0.293 0.41 0.500 0.33 3 Click to see details
UCEC -0.041 0.43 -0.189 0.22 19 Click to see details
PRAD 0.023 0.44 0.120 0.2 50 Click to see details
STAD 0.02 0.46 -0.107 0.28 32 Click to see details
KIRC 0.013 0.46 0.029 0.41 68 Click to see details
LUSC 0.004 0.49 -0.076 0.33 38 Click to see details
LUSC 0.004 0.49 -0.076 0.33 38 Click to see details
LUSC 0.004 0.49 -0.076 0.33 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*