miRTarBase - #MIRT078282 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPS6KB1   
Synonyms PS6K, S6K, S6K-beta-1, S6K1, STK14A, p70 S6KA, p70(S6K)-alpha, p70-S6K, p70-alpha
Description ribosomal protein S6 kinase B1
Transcript NM_003161   
Expression
Putative miRNA Targets on RPS6KB1
3'UTR of RPS6KB1
(miRNA target sites are highlighted)
>RPS6KB1|NM_003161|3'UTR
   1 CAGAGCAATGCTTTTAATGAATTTAAGGCAAAAAAGGTGGAGAGGGAGATGTGTGAGCATCCTGCAAGGTGAAACGACTC
  81 AAAATGACAGTTTCAGAGAGTCAATGTCATTACATAGAACACTTCAGACACAGGAAAAATAAACGTGGATTTTAAAAAAT
 161 CAATCAATGGTGCAAAAAAAAACTTAAAGCAAAATAGTATTGCTGAACTCTTAGGCACATCAATTAATTGATTCCTCGCG
 241 ACATCTTCTCAACCTTATCAAGGATTTTCATGTTGATGACTCGAAACTGACAGTATTAAGGGTAGGATGTTGCTTCTGAA
 321 TCACTGTTGAGTTCTGATTGTGTTGAAGAAGGGTTATCCTTTCATTAGGCAAAGTACAAAATTGCCTATAATACTTGCAA
 401 CTAAGGACAAATTAGCATGCAAGCTTGGTCAAACTTTTTCCAGCAAAATGGAAGCAAAGACAAAAGAAACTTACCAATTG
 481 ATGTTTTACGTGCAAACAACCTGAATCTTTTTTTTATATAAATATATATTTTTCAAATAGATTTTTGATTCAGCTCATTA
 561 TGAAAAACATCCCAAACTTTAAAATGCGAAATTATTGGTTGGTGTGAAGAAAGCCAGACAACTTCTGTTTCTTCTCTTGG
 641 TGAAATAATAAAATGCAAATGAATCATTGTTAACCACAGCTGTGGCTCGTTTGAGGGATTGGGGTGGACCTGGGGTTTAT
 721 TTTCAGTAACCCAGCTGCAATACCTGTCTGTAATATGAGAAAAAAAAAATGAATCTATTTAATCATTTCTACTTGCAGTA
 801 CTGCTATGTGCTAAGCTTAACTGGAAGCCTTGGAATGGGCATAAGTTGTATGTCCTACATTTCATCATTGTCCCGGGCCT
 881 GCATTGCACTGGAAAAAAAAATCGCCACCTGTTCTTACACCAGTATTTGGTTCAAGACACCAAATGTCTTCAGCCCATGG
 961 CTGAAGAACAACAGAAGAGAGTCAGGATAAAAAATACATACTGTGGTCGGCAAGGTGAGGGAGATAGGGATATCCAGGGG
1041 AAGAGGGTGTTGCTGTGGCCCACTCTCTGTCTAATCTCTTTACAGCAAATTGGTAAGATTTTCAGTTTTACTTCTTTCTA
1121 CTGTTTCTGCTGTCTACCTTCCTTATATTTTTTTCCTCAACAGTTTTAAAAAGAAAAAAAGGTCTATTTTTTTTTCTCCT
1201 ATACTTGGGCTACATTTTTTGATTGTAAAAATATTTGATGGCCTTTTGATGAATGTCTTCCACAGTAAAGAAAACTTAGT
1281 GGCTTAATTTAGGAAACATGTTAACAGGACACTATGTTTTTGAAATTGTAACAAAATCTACATAAATGATTTACAGGTTA
1361 AAAGAATAAAAATAAAGGTAACTTTACCTTTCTTAAATATTTCCTGCCTTAAAGAGAGCATTTCCATGACTTTAGCTGGT
1441 GAAAGGGTTTAATATCTGCAGAGCTTTATAAAAATATATTTCAGTGCATACTGGTATAATAGATGATCATGCAGTTGCAG
1521 TTGAGTTGTATCACCTTTTTTGTTTGTCTTTTATAATGTCTTCAGTCTGAGTGTGCAAAGTCAATTTGTAATATTTTGCA
1601 ACCCTAGGATTTTTTTAAATAGATGCTGCTTGCTATGTTTTCAAACCTTTTTGAGCCATAGGATCCAAGCCATAAAATTC
1681 TTTATGCATGTTGAATTCAGTCAGAAAAGAGCAAGGCTTTGCTTTTTGAAATTGCAACTCAAATGAGATGGGATGAAATC
1761 CTATGACAGTAAGCAAAAACAGAACCATGAAAAATGATTGGACATACACCTTTTCAATTGTGGCAATAATTGAAAGAATC
1841 GATAAAAGTTCATCTTTGGACAGAAAGCCTTTAAAAAAAAAATCACTCCCTCTTCCCCCTCCTCCCTTATTGCAGCAGCC
1921 TACTGAGAACTTTGACTGTTGCTGGTAAATTAGAAGCTACAATAATAATTAAGGGCAGAAATTATACTTAAAAAGTGCAG
2001 ATCCTTGTTCTTTGACAATTTGTGATGTCTGAAAAAACAGAACCCGAAAAGCTATGGTGATATGTACAGGCATTATTTCA
2081 GACTGTAAATGGCTTGTGATACTCTTGATACTTGTTTTCAAATATGTTTACTAACTGTAGTGTTGACTGCCTGACCAAAT
2161 TCCAGTGAAACTTATACACCAAAATATTCTTCCTAGGTCCTATTTGCTAGTAACATGAGCACTGTGATTGGCTGGCTATA
2241 ACCACCCCAGTTAAACCATTTTCATAATTAGTAGTGCCAGCAATAGTGGCAAACACTGCAACTTTTCTGCATAAAAAGCA
2321 TTAATTGCACAGCTACCATCCACACAAATACATAGTTTTTCTGACTTCACATTTATTAAGTGAAATTTATTTCCCATGCT
2401 GTGGAAAGTTTATTGAGAACTTGTTTCATAAATGGATATCCCTACTATGACTGTGAAAACATGTCAAGTGTCACATTAGT
2481 GTCACAGACAGAAAGCACACACCTATGCAATATGGCTTATCTATATTTATTTGTAAAAATCCAAGCATAGTTTAAAATAT
2561 GATGTCGATATTACTAGTCTTGAGTTTCTAAGAGGGTTCTTTATGTTATACCAGGTAAGTGTATAAAAGAGATTAAGTGC
2641 TTTTTTTTCATCACTTGATTATTTTCTTTAAAATCAGCTATTACAGGATATTTTTTTATTTTATACATGCTGTTTTTTAA
2721 TTAAAATATAATCACTGAAGTTTACTAATTTGATTTTATAAGGTTTGTAGCATTACAGAATAACTAAACTGGGATTTATA
2801 AACCAGCTGTGATTAACAATGTAAAGTATTAATTATTGAACTTTGAACCAGATTTTTAGGAAAATTATGTTCTTTTTCCC
2881 CCTTTATGGTCTTAACTAATTTGAATCCTTCAAGAAGGATTTTTCCATACTATTTTTTAAGATAGAAGATAATTTGTGGG
2961 CAGGGGTGGAGGATGCATGTATGATACTCCATAAATTCAACATTCTTTACTATAGGTAATGAATGATTATAAACAAGATG
3041 CATCTTAGATAGTATTAATATACTGAGCCTTGGATTATATATTTAATATAGGACCTATTTTGAATATTCAGTTAATCATA
3121 TGGTTCCTAGCTTACAAGGGCTAGATCTAAGATTATTCCCATGAGAAATGTTGAATTTATGAAGAATAGATTTTAAGGCT
3201 TTGAAAATGGTTAATTTCTCAAAAACATCAATGTCCAAACATCTACCTTTTTTCATAGGAGTAGACACTAGCAAGCTGGA
3281 CAAACTATCACAAAAGTATTTGTCACACATAACCTGTGGTCTGTTGCTGATTAATACAGTACTTTTTCTTGTGTGATTCT
3361 TAACATTATAGCACAAGTATTATCTCAGTGGATTATCCGGAATAACATCTGAAAGATGGGTTCATCTATGTTTGTGTTTG
3441 CTCTTTAAACTATTGTTTCTCCTATCCCAAGTTCGCTTTGCATCTATCAGTAAATAAAATTCTTCAGCTGCCTTATTAGG
3521 AGTGCTATGAGGGTAACACCTGTTCTGCTTTTCATCTTGTATTTAGTTGACTGTATTATTTGATTTCGGATTGAATGAAT
3601 GTAAATAGAAATTAAATGCAAATTTGAATGAACATAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  | ||  ||||||| 
Target 5' tttttttaAATAGATGCTGCTt 3'
1610 - 1631 146.00 -9.60
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|| |::| :| ||:|||| 
Target 5' caTAACCTGTGGTCTGTTGCTg 3'
3308 - 3329 144.00 -12.50
3
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |:| | ||:  ||:|||| 
Target 5' ctgAGAACTTTGACTGTTGCTg 3'
1923 - 1944 139.00 -9.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31599270 6 COSMIC
COSN30502324 15 COSMIC
COSN30616217 36 COSMIC
COSN31502066 47 COSMIC
COSN31553188 66 COSMIC
COSN20114256 76 COSMIC
COSN19661626 99 COSMIC
COSN30159841 109 COSMIC
COSN31598057 161 COSMIC
COSN18740286 183 COSMIC
COSN8603513 324 COSMIC
COSN32058694 339 COSMIC
COSN31548925 362 COSMIC
COSN19663701 399 COSMIC
COSN31553576 589 COSMIC
COSN30142416 593 COSMIC
COSN26553233 607 COSMIC
COSN1724575 655 COSMIC
COSN30705754 669 COSMIC
COSN31598552 681 COSMIC
COSN9671757 710 COSMIC
COSN30142833 724 COSMIC
COSN18740149 770 COSMIC
COSN19658147 770 COSMIC
COSN24400090 894 COSMIC
COSN30568764 902 COSMIC
COSN30588178 902 COSMIC
COSN16847681 907 COSMIC
COSN20093330 960 COSMIC
COSN31522211 1253 COSMIC
COSN16719086 1364 COSMIC
COSN31562826 1608 COSMIC
COSN22536566 1662 COSMIC
COSN31551014 1742 COSMIC
COSN20114259 1883 COSMIC
COSN30539957 2232 COSMIC
COSN31524256 2256 COSMIC
COSN31544922 2341 COSMIC
COSN31570507 2567 COSMIC
COSN31487068 2719 COSMIC
COSN20902460 2812 COSMIC
COSN22854521 3022 COSMIC
COSN26565087 3026 COSMIC
COSN31608516 3044 COSMIC
COSN31519482 3166 COSMIC
COSN24306270 3196 COSMIC
COSN16524932 3198 COSMIC
COSN6108288 3369 COSMIC
COSN16625924 3487 COSMIC
COSN8244683 3762 COSMIC
rs180515 127 GWAS
rs1051424 176 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760357009 3 dbSNP
rs764444772 5 dbSNP
rs1279874069 8 dbSNP
rs753992867 13 dbSNP
rs1226121748 22 dbSNP
rs1281337398 25 dbSNP
rs1266954954 27 dbSNP
rs777859625 30 dbSNP
rs1314440270 36 dbSNP
rs369442815 38 dbSNP
rs750489417 39 dbSNP
rs1288410292 40 dbSNP
rs758995304 44 dbSNP
rs749333926 46 dbSNP
rs1343801630 55 dbSNP
rs1398115454 68 dbSNP
rs386386367 72 dbSNP
rs1439281335 74 dbSNP
rs200620649 76 dbSNP
rs76853887 76 dbSNP
rs25548 77 dbSNP
rs67846207 77 dbSNP
rs1402545931 85 dbSNP
rs763955585 92 dbSNP
rs1168696057 97 dbSNP
rs144814059 105 dbSNP
rs1418795069 110 dbSNP
rs1167197193 116 dbSNP
rs180515 127 dbSNP
rs1355477424 129 dbSNP
rs1255263133 132 dbSNP
rs1177706086 133 dbSNP
rs1223985123 135 dbSNP
rs527419431 137 dbSNP
rs1459079836 141 dbSNP
rs1236300788 145 dbSNP
rs1197387453 146 dbSNP
rs1283339387 154 dbSNP
rs908270483 158 dbSNP
rs193186563 159 dbSNP
rs1223712851 164 dbSNP
rs1247177695 166 dbSNP
rs973755658 168 dbSNP
rs1312549588 172 dbSNP
rs1379689825 174 dbSNP
rs919878919 174 dbSNP
rs932556891 174 dbSNP
rs1051424 176 dbSNP
rs1295471531 182 dbSNP
rs1191762891 183 dbSNP
rs533044604 195 dbSNP
rs112530345 198 dbSNP
rs1441318040 204 dbSNP
rs1378362825 209 dbSNP
rs1177959779 213 dbSNP
rs1440621105 219 dbSNP
rs1268895694 220 dbSNP
rs1158181062 222 dbSNP
rs879781314 224 dbSNP
rs1407393058 227 dbSNP
rs550051953 238 dbSNP
rs1356317339 239 dbSNP
rs569896867 240 dbSNP
rs903253759 241 dbSNP
rs999301295 253 dbSNP
rs1323383397 254 dbSNP
rs1303570778 259 dbSNP
rs1378431335 260 dbSNP
rs1390204185 274 dbSNP
rs765153082 283 dbSNP
rs1054388295 284 dbSNP
rs1421237404 316 dbSNP
rs529278871 321 dbSNP
rs1278546382 340 dbSNP
rs1157945511 346 dbSNP
rs893105673 350 dbSNP
rs1378850002 353 dbSNP
rs549433144 364 dbSNP
rs1196063324 369 dbSNP
rs1013135643 373 dbSNP
rs1023151363 382 dbSNP
rs1218392820 390 dbSNP
rs1489455932 395 dbSNP
rs533401540 399 dbSNP
rs1216502221 401 dbSNP
rs1346254161 405 dbSNP
rs1277124073 412 dbSNP
rs1231109448 428 dbSNP
rs1330621337 433 dbSNP
rs566154604 438 dbSNP
rs971997936 442 dbSNP
rs1402127765 443 dbSNP
rs777877961 449 dbSNP
rs1297419402 450 dbSNP
rs1003032489 458 dbSNP
rs1319792954 460 dbSNP
rs1273754991 466 dbSNP
rs1334143385 473 dbSNP
rs1211737279 484 dbSNP
rs1170763937 490 dbSNP
rs1240149230 491 dbSNP
rs1015791882 495 dbSNP
rs1195388160 508 dbSNP
rs200194783 508 dbSNP
rs973777528 515 dbSNP
rs535142141 516 dbSNP
rs1193312657 518 dbSNP
rs1438419594 525 dbSNP
rs919598349 527 dbSNP
rs1281284425 529 dbSNP
rs558347521 550 dbSNP
rs571817883 553 dbSNP
rs11549046 574 dbSNP
rs985391897 576 dbSNP
rs1258872866 577 dbSNP
rs1220685191 586 dbSNP
rs537302041 588 dbSNP
rs1164254831 594 dbSNP
rs1342090481 595 dbSNP
rs1332072408 596 dbSNP
rs1417584379 598 dbSNP
rs1172119734 602 dbSNP
rs1463608753 624 dbSNP
rs1163503417 625 dbSNP
rs1422421208 625 dbSNP
rs1473318069 626 dbSNP
rs755463211 641 dbSNP
rs531765331 646 dbSNP
rs1239621983 648 dbSNP
rs1186045258 655 dbSNP
rs1461311322 660 dbSNP
rs1239337491 662 dbSNP
rs943897626 665 dbSNP
rs765745400 666 dbSNP
rs1456530496 667 dbSNP
rs1257634382 676 dbSNP
rs1042221923 680 dbSNP
rs869045371 684 dbSNP
rs923731723 690 dbSNP
rs557633832 698 dbSNP
rs35627972 701 dbSNP
rs1173426123 704 dbSNP
rs956924368 706 dbSNP
rs934770535 715 dbSNP
rs574295962 716 dbSNP
rs992720286 717 dbSNP
rs1377458880 739 dbSNP
rs1401878337 746 dbSNP
rs1333318965 747 dbSNP
rs1234889002 751 dbSNP
rs1471739715 755 dbSNP
rs1181798371 758 dbSNP
rs1443873879 760 dbSNP
rs201868081 760 dbSNP
rs774332974 760 dbSNP
rs747438523 761 dbSNP
rs1476253348 770 dbSNP
rs1406805523 771 dbSNP
rs745659146 776 dbSNP
rs768894684 779 dbSNP
rs372223764 780 dbSNP
rs1329303593 783 dbSNP
rs1372117366 784 dbSNP
rs1381434270 792 dbSNP
rs1407752846 793 dbSNP
rs748902570 794 dbSNP
rs1355672741 795 dbSNP
rs770581490 797 dbSNP
rs554972705 800 dbSNP
rs1222563888 804 dbSNP
rs1356261891 804 dbSNP
rs571782225 805 dbSNP
rs1453481314 816 dbSNP
rs772039820 817 dbSNP
rs775404045 818 dbSNP
rs1204852649 827 dbSNP
rs760578335 833 dbSNP
rs1258550811 837 dbSNP
rs763809638 842 dbSNP
rs1185556694 846 dbSNP
rs1367900624 852 dbSNP
rs1472435339 855 dbSNP
rs1168482235 857 dbSNP
rs1391943966 858 dbSNP
rs776419630 859 dbSNP
rs540744135 860 dbSNP
rs1311341223 862 dbSNP
rs1237921437 865 dbSNP
rs1375515087 873 dbSNP
rs1274989804 874 dbSNP
rs563890999 875 dbSNP
rs1231430776 878 dbSNP
rs1347688458 879 dbSNP
rs1259866411 885 dbSNP
rs1026710035 893 dbSNP
rs1424372738 893 dbSNP
rs1361613835 894 dbSNP
rs1160965284 897 dbSNP
rs1438447102 903 dbSNP
rs1407907813 904 dbSNP
rs1191772902 905 dbSNP
rs577763718 909 dbSNP
rs1199032249 912 dbSNP
rs765983242 922 dbSNP
rs953715679 931 dbSNP
rs1287980224 936 dbSNP
rs1214344803 939 dbSNP
rs1019982421 944 dbSNP
rs1195242638 958 dbSNP
rs751187196 960 dbSNP
rs978380003 961 dbSNP
rs1273862364 965 dbSNP
rs1400297504 973 dbSNP
rs1341502396 990 dbSNP
rs923811296 994 dbSNP
rs1418256753 996 dbSNP
rs1188881710 1006 dbSNP
rs936486435 1009 dbSNP
rs1257316226 1010 dbSNP
rs543292701 1026 dbSNP
rs1198961310 1028 dbSNP
rs1478304938 1029 dbSNP
rs757519178 1034 dbSNP
rs1265630041 1037 dbSNP
rs560659468 1037 dbSNP
rs948757850 1047 dbSNP
rs527750175 1048 dbSNP
rs907157350 1053 dbSNP
rs1309906394 1059 dbSNP
rs938952808 1063 dbSNP
rs1037659898 1065 dbSNP
rs897338419 1070 dbSNP
rs1393687920 1072 dbSNP
rs1275943429 1088 dbSNP
rs1415863360 1092 dbSNP
rs1313088767 1104 dbSNP
rs1303904823 1112 dbSNP
rs1450902584 1113 dbSNP
rs1354615045 1114 dbSNP
rs995655335 1121 dbSNP
rs529199355 1124 dbSNP
rs1412622120 1132 dbSNP
rs1426005259 1135 dbSNP
rs1026763869 1136 dbSNP
rs549366970 1137 dbSNP
rs1414313634 1146 dbSNP
rs1187406833 1148 dbSNP
rs889532382 1148 dbSNP
rs1280032523 1150 dbSNP
rs1242457444 1159 dbSNP
rs1006605534 1174 dbSNP
rs1458729840 1175 dbSNP
rs1255734980 1180 dbSNP
rs1226596185 1181 dbSNP
rs1019285696 1185 dbSNP
rs1226288422 1185 dbSNP
rs1268528340 1187 dbSNP
rs1313959790 1187 dbSNP
rs1381140308 1196 dbSNP
rs1347184689 1197 dbSNP
rs1211889877 1199 dbSNP
rs1279837184 1202 dbSNP
rs1447549811 1215 dbSNP
rs965389593 1222 dbSNP
rs1296640518 1223 dbSNP
rs1461735575 1229 dbSNP
rs1219180127 1236 dbSNP
rs978053752 1243 dbSNP
rs1166563740 1249 dbSNP
rs1421864854 1252 dbSNP
rs1031318907 1253 dbSNP
rs1262855470 1257 dbSNP
rs957896146 1277 dbSNP
rs1440965791 1280 dbSNP
rs1235897776 1293 dbSNP
rs1194861601 1306 dbSNP
rs1488570331 1308 dbSNP
rs1266850160 1309 dbSNP
rs1224189144 1313 dbSNP
rs1357772406 1315 dbSNP
rs1314942990 1327 dbSNP
rs1241559565 1341 dbSNP
rs1379209209 1343 dbSNP
rs989268246 1347 dbSNP
rs914700515 1365 dbSNP
rs1391666332 1383 dbSNP
rs1295540373 1386 dbSNP
rs1422483619 1411 dbSNP
rs1364788734 1415 dbSNP
rs948806742 1418 dbSNP
rs1421510991 1431 dbSNP
rs980558307 1431 dbSNP
rs559799422 1445 dbSNP
rs1180388357 1447 dbSNP
rs1433287320 1450 dbSNP
rs1268969977 1461 dbSNP
rs748722352 1469 dbSNP
rs938656367 1493 dbSNP
rs1291576177 1495 dbSNP
rs1037309353 1497 dbSNP
rs1374407730 1510 dbSNP
rs1259510720 1513 dbSNP
rs756584823 1515 dbSNP
rs1331795264 1519 dbSNP
rs1422291810 1531 dbSNP
rs1392989842 1539 dbSNP
rs1403400717 1541 dbSNP
rs1385358523 1543 dbSNP
rs1381626183 1545 dbSNP
rs1423282788 1545 dbSNP
rs1316071126 1547 dbSNP
rs1298512409 1548 dbSNP
rs1332943138 1549 dbSNP
rs1421301932 1555 dbSNP
rs1235030373 1556 dbSNP
rs1302974010 1557 dbSNP
rs1346066447 1558 dbSNP
rs1242582257 1565 dbSNP
rs918820545 1568 dbSNP
rs1378905735 1577 dbSNP
rs1173794213 1585 dbSNP
rs528551956 1589 dbSNP
rs1048591222 1592 dbSNP
rs1194785640 1604 dbSNP
rs1203922381 1610 dbSNP
rs1260223853 1617 dbSNP
rs889924703 1627 dbSNP
rs1270010844 1634 dbSNP
rs1257903290 1645 dbSNP
rs551910944 1646 dbSNP
rs1006658334 1647 dbSNP
rs918028497 1648 dbSNP
rs1279102425 1660 dbSNP
rs948109306 1667 dbSNP
rs1041169957 1682 dbSNP
rs571698983 1694 dbSNP
rs537645049 1697 dbSNP
rs1396592124 1710 dbSNP
rs1403710419 1712 dbSNP
rs1193783228 1718 dbSNP
rs1334035533 1720 dbSNP
rs1393951854 1726 dbSNP
rs550930454 1729 dbSNP
rs1423849876 1734 dbSNP
rs1172428107 1735 dbSNP
rs1476582517 1741 dbSNP
rs567927730 1743 dbSNP
rs1193098502 1753 dbSNP
rs1443429825 1759 dbSNP
rs1030953762 1764 dbSNP
rs1201798309 1775 dbSNP
rs750460920 1775 dbSNP
rs1460952036 1780 dbSNP
rs957948427 1788 dbSNP
rs1452731086 1797 dbSNP
rs2158458 1804 dbSNP
rs1337184504 1805 dbSNP
rs746236014 1810 dbSNP
rs1287056255 1822 dbSNP
rs1010741362 1827 dbSNP
rs1396526068 1830 dbSNP
rs1342147156 1833 dbSNP
rs1441532036 1838 dbSNP
rs1451244182 1841 dbSNP
rs1332939409 1842 dbSNP
rs148571848 1846 dbSNP
rs969163283 1848 dbSNP
rs1473343081 1860 dbSNP
rs928691453 1862 dbSNP
rs1182332840 1873 dbSNP
rs35485878 1873 dbSNP
rs397797801 1873 dbSNP
rs973136164 1874 dbSNP
rs554909266 1882 dbSNP
rs62081839 1883 dbSNP
rs754065842 1883 dbSNP
rs75120475 1884 dbSNP
rs1436223664 1889 dbSNP
rs1272572717 1898 dbSNP
rs1307920245 1899 dbSNP
rs1210177336 1913 dbSNP
rs1358257292 1921 dbSNP
rs571718916 1924 dbSNP
rs1316731987 1933 dbSNP
rs1237261282 1946 dbSNP
rs534362673 1971 dbSNP
rs557823441 1987 dbSNP
rs537603405 1995 dbSNP
rs577699522 1997 dbSNP
rs1439411067 2001 dbSNP
rs778291975 2003 dbSNP
rs1334754711 2005 dbSNP
rs1323842085 2008 dbSNP
rs1406286914 2017 dbSNP
rs183346732 2019 dbSNP
rs1040831281 2023 dbSNP
rs1424657216 2027 dbSNP
rs900912618 2032 dbSNP
rs999241087 2033 dbSNP
rs771010824 2038 dbSNP
rs1250713348 2043 dbSNP
rs1199915449 2046 dbSNP
rs1052536497 2047 dbSNP
rs1418300190 2047 dbSNP
rs34975148 2047 dbSNP
rs1289413690 2055 dbSNP
rs1221473179 2061 dbSNP
rs1354257709 2063 dbSNP
rs1156741589 2064 dbSNP
rs1419760468 2070 dbSNP
rs550701677 2082 dbSNP
rs1221533745 2085 dbSNP
rs1461932781 2098 dbSNP
rs1275050562 2106 dbSNP
rs779326715 2120 dbSNP
rs1164101749 2121 dbSNP
rs1347768770 2122 dbSNP
rs893437456 2123 dbSNP
rs746071121 2128 dbSNP
rs1023482184 2129 dbSNP
rs144391145 2140 dbSNP
rs1399005024 2143 dbSNP
rs751571943 2156 dbSNP
rs1407427617 2163 dbSNP
rs1173375682 2164 dbSNP
rs1481504349 2175 dbSNP
rs1316536306 2176 dbSNP
rs1267054670 2177 dbSNP
rs1198362577 2178 dbSNP
rs1488512139 2198 dbSNP
rs1243745143 2203 dbSNP
rs969216583 2212 dbSNP
rs768635578 2216 dbSNP
rs1315797543 2222 dbSNP
rs1278791896 2224 dbSNP
rs1224820901 2227 dbSNP
rs1003772522 2234 dbSNP
rs1282263214 2248 dbSNP
rs1298973334 2249 dbSNP
rs1341579985 2254 dbSNP
rs1372942727 2258 dbSNP
rs1035812798 2263 dbSNP
rs1429327521 2265 dbSNP
rs1252604673 2267 dbSNP
rs1345122856 2274 dbSNP
rs960397085 2291 dbSNP
rs1389885040 2303 dbSNP
rs1471010036 2306 dbSNP
rs776570133 2325 dbSNP
rs972803332 2329 dbSNP
rs573841830 2336 dbSNP
rs1233230812 2341 dbSNP
rs918604970 2342 dbSNP
rs1184701127 2344 dbSNP
rs1271776876 2345 dbSNP
rs1485463458 2352 dbSNP
rs1237996933 2360 dbSNP
rs1204960371 2371 dbSNP
rs1459611606 2373 dbSNP
rs952667509 2374 dbSNP
rs984396135 2377 dbSNP
rs1332033961 2389 dbSNP
rs542951528 2395 dbSNP
rs1308444986 2403 dbSNP
rs1298102520 2406 dbSNP
rs1205940734 2407 dbSNP
rs911465753 2408 dbSNP
rs1361815490 2409 dbSNP
rs1316392424 2410 dbSNP
rs942918104 2415 dbSNP
rs1045050019 2416 dbSNP
rs1404061456 2422 dbSNP
rs1336303869 2424 dbSNP
rs977324999 2428 dbSNP
rs922757761 2434 dbSNP
rs1480146676 2445 dbSNP
rs755334581 2452 dbSNP
rs1185399293 2459 dbSNP
rs761644711 2471 dbSNP
rs1442231873 2473 dbSNP
rs935086415 2484 dbSNP
rs1259413607 2488 dbSNP
rs748620575 2490 dbSNP
rs1249284756 2498 dbSNP
rs780776011 2501 dbSNP
rs1202818786 2508 dbSNP
rs1052102992 2516 dbSNP
rs375536815 2524 dbSNP
rs1293112734 2559 dbSNP
rs559736327 2561 dbSNP
rs1248876458 2563 dbSNP
rs1380669617 2564 dbSNP
rs1187176302 2567 dbSNP
rs1392046928 2568 dbSNP
rs111430839 2570 dbSNP
rs528493553 2604 dbSNP
rs567473718 2616 dbSNP
rs1044988668 2625 dbSNP
rs1384551874 2628 dbSNP
rs905100517 2628 dbSNP
rs1178665467 2629 dbSNP
rs1171305356 2634 dbSNP
rs1353980297 2635 dbSNP
rs11555598 2640 dbSNP
rs1176315750 2641 dbSNP
rs1247943465 2641 dbSNP
rs1480503176 2641 dbSNP
rs1270131649 2649 dbSNP
rs1003416915 2655 dbSNP
rs1035267177 2655 dbSNP
rs1314941190 2656 dbSNP
rs1431216429 2658 dbSNP
rs897628696 2662 dbSNP
rs1318852256 2669 dbSNP
rs1305121599 2672 dbSNP
rs1391109009 2681 dbSNP
rs1346397304 2685 dbSNP
rs551841372 2686 dbSNP
rs1025715205 2690 dbSNP
rs1364843441 2698 dbSNP
rs952717675 2707 dbSNP
rs1454875698 2708 dbSNP
rs1361618923 2712 dbSNP
rs1157907461 2713 dbSNP
rs984112517 2720 dbSNP
rs1271699590 2725 dbSNP
rs1270611417 2728 dbSNP
rs565366752 2735 dbSNP
rs1489969720 2738 dbSNP
rs1268758811 2753 dbSNP
rs1306390182 2758 dbSNP
rs369479523 2768 dbSNP
rs769645042 2771 dbSNP
rs964646431 2781 dbSNP
rs1258973057 2782 dbSNP
rs1238442862 2787 dbSNP
rs1324481440 2791 dbSNP
rs530937181 2794 dbSNP
rs1485880381 2800 dbSNP
rs1285464766 2824 dbSNP
rs1221432167 2827 dbSNP
rs1344696222 2828 dbSNP
rs1318877073 2837 dbSNP
rs922777520 2839 dbSNP
rs1209963489 2844 dbSNP
rs1382702121 2848 dbSNP
rs34061743 2853 dbSNP
rs1287720190 2854 dbSNP
rs935491200 2868 dbSNP
rs1430918964 2870 dbSNP
rs1255129152 2871 dbSNP
rs34454406 2873 dbSNP
rs551126231 2887 dbSNP
rs538047485 2904 dbSNP
rs1377491242 2912 dbSNP
rs909176217 2915 dbSNP
rs1194354520 2920 dbSNP
rs188457115 2928 dbSNP
rs536508531 2932 dbSNP
rs1418917113 2933 dbSNP
rs1461860969 2933 dbSNP
rs1426768035 2937 dbSNP
rs546884631 2943 dbSNP
rs1322555207 2957 dbSNP
rs1270486098 2959 dbSNP
rs749784435 2967 dbSNP
rs758430068 2968 dbSNP
rs1452685943 2989 dbSNP
rs1407718694 2990 dbSNP
rs1434328649 2998 dbSNP
rs566862656 3005 dbSNP
rs1347292474 3013 dbSNP
rs1432176571 3014 dbSNP
rs550100707 3030 dbSNP
rs1360700726 3035 dbSNP
rs571830664 3041 dbSNP
rs1371815110 3046 dbSNP
rs557496664 3050 dbSNP
rs139023905 3057 dbSNP
rs1233068576 3059 dbSNP
rs1276302380 3060 dbSNP
rs1448468288 3061 dbSNP
rs1216443365 3067 dbSNP
rs796128802 3075 dbSNP
rs1241377090 3076 dbSNP
rs1484940360 3080 dbSNP
rs993316346 3087 dbSNP
rs1460994214 3092 dbSNP
rs1025767376 3094 dbSNP
rs1197289130 3098 dbSNP
rs1195637967 3099 dbSNP
rs1250666747 3124 dbSNP
rs1246691385 3132 dbSNP
rs146705278 3140 dbSNP
rs1005599161 3147 dbSNP
rs1451314175 3148 dbSNP
rs1335943953 3161 dbSNP
rs1018293791 3171 dbSNP
rs964047613 3174 dbSNP
rs1394860038 3175 dbSNP
rs1168505449 3181 dbSNP
rs977429721 3184 dbSNP
rs536760279 3186 dbSNP
rs747169531 3188 dbSNP
rs139176752 3197 dbSNP
rs573881927 3238 dbSNP
rs553459436 3246 dbSNP
rs1343891281 3248 dbSNP
rs1184305450 3257 dbSNP
rs542892458 3257 dbSNP
rs1435850181 3273 dbSNP
rs1250884605 3275 dbSNP
rs771762591 3276 dbSNP
rs1443743201 3278 dbSNP
rs767091837 3286 dbSNP
rs1327378551 3288 dbSNP
rs988261837 3316 dbSNP
rs1244565665 3319 dbSNP
rs1350825667 3322 dbSNP
rs1371063778 3333 dbSNP
rs192688444 3349 dbSNP
rs1439657967 3354 dbSNP
rs1439736614 3357 dbSNP
rs865802669 3373 dbSNP
rs1334810863 3374 dbSNP
rs1307747157 3379 dbSNP
rs1405956017 3399 dbSNP
rs915032508 3400 dbSNP
rs1301876053 3427 dbSNP
rs753081115 3429 dbSNP
rs573212136 3435 dbSNP
rs144027445 3442 dbSNP
rs1160505259 3443 dbSNP
rs980454541 3445 dbSNP
rs1352573849 3446 dbSNP
rs1199837178 3448 dbSNP
rs1224072659 3448 dbSNP
rs760519010 3450 dbSNP
rs1266659196 3455 dbSNP
rs926300012 3462 dbSNP
rs939011744 3475 dbSNP
rs1285669933 3490 dbSNP
rs1283275040 3498 dbSNP
rs1056813426 3506 dbSNP
rs1221587370 3518 dbSNP
rs1327988847 3519 dbSNP
rs1283561631 3529 dbSNP
rs373703630 3540 dbSNP
rs565157448 3543 dbSNP
rs919172663 3546 dbSNP
rs183658577 3548 dbSNP
rs1301818699 3555 dbSNP
rs1048927029 3576 dbSNP
rs544389928 3588 dbSNP
rs1005650180 3589 dbSNP
rs1192020268 3590 dbSNP
rs1177489225 3592 dbSNP
rs561486838 3602 dbSNP
rs1481287837 3607 dbSNP
rs1039769389 3618 dbSNP
rs1190414189 3625 dbSNP
rs1234751181 3625 dbSNP
rs187967995 3628 dbSNP
rs1177051151 3629 dbSNP
rs1212984752 3634 dbSNP
rs1464080906 3635 dbSNP
rs1406198775 3641 dbSNP
rs899857358 3642 dbSNP
rs1166222360 3645 dbSNP
rs1219034005 3647 dbSNP
rs1394621402 3647 dbSNP
rs1272474592 3652 dbSNP
rs1428702400 3652 dbSNP
rs998186180 3652 dbSNP
rs531944004 3660 dbSNP
rs1364620694 3668 dbSNP
rs1337631626 3673 dbSNP
rs1471041223 3674 dbSNP
rs1030362744 3679 dbSNP
rs1175027179 3680 dbSNP
rs1321187669 3685 dbSNP
rs17582112 3688 dbSNP
rs566801378 3691 dbSNP
rs759491586 3691 dbSNP
rs1442473067 3692 dbSNP
rs1244160366 3694 dbSNP
rs546644438 3700 dbSNP
rs1459654659 3701 dbSNP
rs1255086311 3705 dbSNP
rs1278782488 3713 dbSNP
rs1443378392 3716 dbSNP
rs1348374886 3718 dbSNP
rs1209820916 3719 dbSNP
rs1308501606 3720 dbSNP
rs139035795 3720 dbSNP
rs1275709919 3721 dbSNP
rs1226927188 3722 dbSNP
rs25543 3722 dbSNP
rs35009710 3722 dbSNP
rs370686113 3725 dbSNP
rs1454671664 3727 dbSNP
rs373791266 3727 dbSNP
rs377514206 3728 dbSNP
rs1377198397 3729 dbSNP
rs1235087948 3741 dbSNP
rs1009737043 3746 dbSNP
rs1273694572 3750 dbSNP
rs1022428283 3752 dbSNP
rs1442633671 3752 dbSNP
rs1208079229 3753 dbSNP
rs1168222931 3758 dbSNP
rs751689021 3758 dbSNP
rs1428952819 3762 dbSNP
rs552484550 3762 dbSNP
rs968159368 3762 dbSNP
rs569021890 3769 dbSNP
rs757215510 3769 dbSNP
rs1177488379 3770 dbSNP
rs1234892503 3773 dbSNP
rs1203472631 3774 dbSNP
rs991834553 3780 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  | ||  ||||||| 
Target 5' uuuuuuuaAAUAGAUGCUGCUu 3'
2 - 23
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000225577.4 | 3UTR | AUUUUUUUAAAUAGAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.689 3.9e-4 0.791 1.6e-5 20 Click to see details
GSE38226 Liver fibrosis 0.621 1.3e-3 0.625 1.2e-3 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.406 2.2e-2 0.261 1.0e-1 25 Click to see details
GSE21032 Prostate cancer 0.191 4.2e-2 0.210 2.8e-2 83 Click to see details
GSE14794 Lymphoblastoid cells -0.167 5.8e-2 -0.177 4.8e-2 90 Click to see details
GSE17498 Multiple myeloma -0.241 6.7e-2 -0.186 1.3e-1 40 Click to see details
GSE32688 Pancreatic cancer -0.251 8.3e-2 -0.016 4.7e-1 32 Click to see details
GSE19783 ER- ER- breast cancer -0.156 8.5e-2 -0.064 2.9e-1 79 Click to see details
GSE27834 Pluripotent stem cells -0.313 1.2e-1 -0.359 8.6e-2 16 Click to see details
GSE28544 Breast cancer -0.231 1.4e-1 -0.492 7.3e-3 24 Click to see details
GSE19350 CNS germ cell tumors 0.332 1.5e-1 0.168 3.0e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.118 1.8e-1 -0.050 3.5e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.193 1.8e-1 0.230 1.3e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.273 1.8e-1 -0.060 4.2e-1 13 Click to see details
GSE19536 Breast cancer -0.08 2.1e-1 -0.021 4.2e-1 100 Click to see details
GSE17306 Multiple myeloma 0.107 2.3e-1 0.058 3.5e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells -0.1 3.2e-1 -0.001 5.0e-1 23 Click to see details
GSE21849 B cell lymphoma 0.087 3.3e-1 0.500 2.9e-3 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.091 3.5e-1 0.068 3.9e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.063 3.8e-1 -0.020 4.6e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.063 3.8e-1 -0.020 4.6e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.444 0 0.494 0 42 Click to see details
STAD -0.427 0.01 -0.453 0 32 Click to see details
UCEC 0.426 0.03 0.365 0.06 19 Click to see details
LUAD 0.446 0.07 0.329 0.15 12 Click to see details
LUSC -0.223 0.09 -0.184 0.13 38 Click to see details
PRAD 0.18 0.11 0.216 0.07 50 Click to see details
PCPG -0.915 0.13 -1.000 0.5 3 Click to see details
ESCA -0.351 0.14 -0.591 0.03 11 Click to see details
KICH 0.184 0.19 0.270 0.1 25 Click to see details
CHOL -0.317 0.2 -0.150 0.35 9 Click to see details
LIHC 0.104 0.24 0.061 0.34 49 Click to see details
KIRC 0.083 0.25 0.094 0.22 68 Click to see details
THCA -0.066 0.31 -0.133 0.16 59 Click to see details
PAAD 0.369 0.32 0.200 0.4 4 Click to see details
CESC 0.435 0.36 0.500 0.33 3 Click to see details
BRCA 0.038 0.37 0.010 0.46 84 Click to see details
KIRP -0.026 0.44 0.001 0.5 32 Click to see details
COAD -0.039 0.46 -0.238 0.29 8 Click to see details
BLCA -0.004 0.49 -0.022 0.47 18 Click to see details
BLCA -0.004 0.49 -0.022 0.47 18 Click to see details
BLCA -0.004 0.49 -0.022 0.47 18 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*