miRTarBase - #MIRT076791 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GOSR1   
Synonyms GOLIM2, GOS-28, GOS28, GOS28/P28, GS28, P28
Description golgi SNAP receptor complex member 1
Transcript NM_001007024   
Other Transcripts NM_001007025 , NM_004871   
Expression
Putative miRNA Targets on GOSR1
3'UTR of GOSR1
(miRNA target sites are highlighted)
>GOSR1|NM_001007024|3'UTR
   1 TGGGACATCTTCAGGGACTCTTGACAGCCACCGCTTTCACACCCTGGTCTGGAATAAGGAAACATCGGAGGGAGAAGTTG
  81 ACTGTCTTGATAATTAGCCTGACCAGCAGGATGAATGCAAGACTGACAGTGATGGACTCTGTGACATGGTCAGGTTGAGC
 161 TGAAGCCACAGTTTCTCTGTGCTGTGTTTTCTAACACATTTTTCTGTTTTTAATTAAAAAAAAAAAAAAAAGGTTTTCAG
 241 TTGCTTTTGTCTCCCTAGGAGGCAGGTAAACCAATCAAAAACAGAGTTTTCTGTGTTTCCATGATAGTGTTGAAGCCTAA
 321 TGACAAGCCAGGTCTTACAGCTGGGCTCTTCAGAAAACCAGGTTTCTACATCCAAAGACTGCTTTTCTTTTAGCTGCCAG
 401 ATTGGATTGTGAATAAAAATAATTCTTCCCTCTCCCTCTCCCTCTCCCCACGGTCTCCCTCTTTCCACGGTCTCCCTCTG
 481 ATGCCGAGCCGAAGCTGGACTGTACTGCTGCCATCTCGGCTCACTGCAACCTCCCTGCCTGATTCTCCTGCCTCAGCCTG
 561 CCGAGTGCCTGCAATTGCAGGCGAGCGCCGCCACGCCTGACTGCCTCGGCCTCCCGAGGTGCCGGGATTGCAGACGGAGT
 641 CTCGTTCACTCAGTGCTCAATGGTGCCCAGGCTGGAGTGCAGTGGCGTGATCTCGGCTCACTACAACCTCCACCTCCCAG
 721 CCACCTGCCTTGGCCTCCCAAAGTGCCGAGATTGCAGCCTCTGCCCGGCCGCCACCCCGTCTGGAAAGTGAGGAGCGCCT
 801 CTGCCCGGCCGCCATCCCATCTAGGAAGTGAGGAGCGCCTCTTCCCAGCCGCCATCCCATCTAGGAAGTGAGGAGCGTCT
 881 CTGCCCGGCCGCCCATCGTCTGAGATGTGGGGAGCGCCTCTGCCCCGCCGCCCCGTCTGGGATGTGAGGAGCTCCTCTGC
 961 CCGGCCGCGACCCCGTCTGGGAGGTGAGGAGCGTCTCTGTCTGGCCACCCCGTCTGAGAAGTGAGGAGACCTCCGCCCGG
1041 CAGCCGCCCTGTCTGAGAAGTGAGGAGCCCCTCCGCCCGGCAGCCACCCCATCTGGGAAGTGAGGAGCGTCTACGCCCGG
1121 GCAGCTGCCCCGTCCGGGAGGGAGGTGGGGGGGTCAGCCCCCCGCCCGGCCAGCCGCCCCGTCCGGGAGGGAGGTGGGGG
1201 GGATCAGCCCCCCGCCCGGCCAGCCGCCCCGTCCGGGAGGGAGGTGGGGGGCGCCTCTGCCCGGCCGCCCCTGCCCGGCC
1281 GCCCCTACTGGGAAGTGAGGAGCCCCTCTGCCTGGCCACCACCCCATCTGGGAGGTGTGCCCAGCAGCTCATTGAGAACG
1361 GGCCATGATGACAATGGCGGTTTTGTGGAATAGAAAAGGCGGAAAGGTGGGGAAAAGATTGAGAAATTGGATGGTTGCCG
1441 TGTCTGTGTAGAAAGAAGTAGACATGGGAGACTTTTCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGGGATCCT
1521 GTTGATCTATGACCTTACCCCCAACCTGGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTAAATGGATTAAGGGT
1601 GGTGCAAGATGTGCTTTGTTAAACAGATGCTTGAAGGCAGCATGCTCCTTAAGAGTCATCACCACTCCCTAATCTCAAGT
1681 ACCCAGGGACACAAACACTGCGGAAGGCGGCAGGGTCCTCTGCCTAGGAAAACCAGAGACCTTTGTTCACTTGTTGATCT
1761 GCTGACCTTCCCTCCACTATTGTCCTATGACCCTGCCAAATCCCCCTCTGCGAGAAACACCCAAGAATGATCAATTAAAA
1841 AAAAAATAATATAATAATAATTCTTGTCCTCTTATTTTACACTCATAATGAGAAATCACAAGTTCTTTCTTGATGATCTG
1921 TGCTATAGATTTCTACTCTGTCTCCTCAACTCTGTTGATATTTGGGGAAAATTCTGTTTTTCATAGATTCTTTGAGATGC
2001 TGATGGACCAGCTTCAGCATGTTTGAGGTTGTCTGAAATGGAGATCACTGTAAAACTGTCTTTTTCTTTTAAATTACAAG
2081 TACACTGGGGTTAACTGTATTGCTGGAAAAACATCAAGAATGACAGTCTTATATTTAAGGCACCAGTCATTGTTTCCATT
2161 TTTTTTTTAATTCTTCCCTTGGATTAATATTTTCTACTGAAAAGAAATGAAATCTCAGTTCCACTATGATAAAAGAAACG
2241 AATCACCAGTGTCTGTCAGTGCCCCCACTGCTCCTCCTCATACCAGCATTGACACTGGTAGCTGAGGAAGGGGACTGCTC
2321 AATTTCTAATGTGATCTATTCAAGAAGCCACATATAAAAAGGCATTGAGGGCTCACTGTCCAGAGAATTGCTTTTGTAAA
2401 TGCTCCACAACGTATGGGCAAAAGTTTAAGGACTACTGCCTGATGTACCAGGAATCCTGAGTTCTGTGAAAATCTGTTCA
2481 TTCCAAATCTGTTAAGCATTTCCAAACATCCAGAGAATGGTTTCACTGTTGAGGGTGCATGTGGCAGAATCTGTCTCTCT
2561 CTGCACCTGTCTTCTGTTACCATCCCTGGACAGTGACAGATTTTAAGCCAGCCACCAGAATTCTTTTCGAGTTAACCATT
2641 TCTTAGTTTCTGTAAATTCATGACTTGTCTTACTGAACTACAGCCTGGTTTGTAGACTTCCAACATCTACACTGCTGCTC
2721 TTCACCATTGGAATTCACTGTGGTATTTATAGTATTGGCTTCAGTCCGAGCCACAGGCAATAAAAGGATATCAGCTGTAG
2801 TTCTCAGCTACATCATGGTGTATAGATGCTGTTATTCAGGCGAACTTGCTCATGGGTGGACTAACACCTGGTTTGGTACA
2881 GAGACTGAGAAGTTTTTCATTCTGGTGTCAAAGTTTTGTTACATTATGGGTGTGAAGGGCATTTGATATATTTTTCTTAA
2961 CTATGGGGTTTATTTTTCTAAATGTGGGTTGATTGACTGTTAATTGATTCAGGGTACCCTTAAAAGAAAAGAAGTTTTCC
3041 CATTGTGAACCTTAAATGATCAGAGAAGTAAGTTCATTGATTAAATTCTCTGTTGGGAGAACAAAACTTTTCTCCCTTGA
3121 CACTTTATTATCTTTGATTTTTCAAAGGGCCTTGATTGGTGGTTGTGTCTCGGTTAAAATTTATGGGACTTTGCTATGTA
3201 GTTGGCATTTATAAAATCTGAAGTATCATAAATAAAGTTATTTATTTAATTATACTACCAGTCTTTTTTACTGGTCTGAT
3281 TCTTTTGTGCATTCATTAAAGCTGATTGTGTGAGAGTGAACTGGGACACAAGCTAGTCTAGCTCACTGCAGCCAAGCAAA
3361 CCCTGTTGATGGCTGATGGGCCTTTCCATTAGGGTTTTGCTTATGTGAAGTAATGGAATTATGTTGGTTATTTTCTTTAT
3441 GAAAATAAACCAGTTCTTCCAAGGAAGTTAAAAGGCTTGGTATGGATGTTGGTGTCAGATAGGTCTGACTAACCTCTCCG
3521 TGCTGCAGCCTATACTAAGGTGACCCAGGGCCACATGTAGACAGCTAGGCCAGTGCTTTTTCCTCTTAGGGTTTCTTTGC
3601 AGAAAGAAACCTCCAGCAAGGGAAGAGAGGTGTGTGTCCACAGGAAGGGGCTCCGTGGGGATCCCATGAAGGGATTTGAG
3681 CTCTTTCAGCTCCATGTCATTTAACTTTTTTGTTTAACCACCTTGGCTTTCTCTCCTTTTTTGCTGTCCTCCTTACGGAC
3761 CAGTTACCAGATTCAGAGGCTAACAGTTAGTTACTTGTTAATGCTAGTCACAGCCAGGAGGTCAGAAGGAATTTTCTACT
3841 TCTGGATCCAAATGTTACCTCTTAGGGGAAGTTATGCCCCCTCAACTATTGTCTTATTATAATGAATCTTTCCTTTTTGG
3921 TCCTTTTAAGTAACCACTCAAAACTTTTCATTTCACTGAAAAAATATGAAAAACCATGACAATAGGGCTGGGTGCAGTGG
4001 CTCACGCCTGTAATCTTAGCACTTTGGGAGACCAAGGCAGGCGGATCGTTTGAGGCCAGGAGTTTGAGACCAGCCTGGGC
4081 AATGTAGCAAGACTCTGTCTCTGCAAAAAAAATTAAAAGATACCTGAGAGCTCACTTTAATATCAAGGTATTTGCATCCA
4161 TTCCCACCCTGTTAGCTCTTAAGGGAGGAGGGAAATCAATTCCAACCATACTTTCCTGTGATGGAAGATGTTTCCTCTTG
4241 AAAAAATGCCAATACAGATTTTTAAAACCTATTGTTTTCCAAATGCACTTTGTAAGTTTTTGCTTTTAAAATAGCTTCTT
4321 GGAACCAATTTTATTGTATTTGTACTTAATTTTTGTTCTCATCTAAATGTGCATTTTCTGACTGTATAGAAGAAGCTTTG
4401 GTATGTAATTTAATAATAAATTAGAAATCTAAATGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-AU-ACACGACGAu 5'
            |||  ||| ||   ||||||| 
Target 5' tcCAA--CATCTACACTGCTGCTc 3'
2699 - 2720 148.00 -9.90
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            | ||||  |  |||||||  
Target 5' gaCTAACCTCTCCGTGCTGCag 3'
3507 - 3528 140.00 -14.30
3
miRNA  3' guGUUUGGUA----AUA-C-ACGACGAu 5'
            :| |:|||    ||| | |||||:| 
Target 5' gcTACATCATGGTGTATAGATGCTGTTa 3'
2807 - 2834 138.00 -11.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28188488 10 COSMIC
COSN30151802 13 COSMIC
COSN30453164 18 COSMIC
COSN30453103 19 COSMIC
COSN26977739 26 COSMIC
COSN30735288 57 COSMIC
COSN30189797 60 COSMIC
COSN30522630 60 COSMIC
COSN31587021 63 COSMIC
COSN30157662 67 COSMIC
COSN30105992 68 COSMIC
COSN30117267 83 COSMIC
COSN8602876 116 COSMIC
COSN30494646 131 COSMIC
COSN18740442 232 COSMIC
COSN30177121 352 COSMIC
COSN31565211 420 COSMIC
COSN17579397 491 COSMIC
COSN6655760 746 COSMIC
COSN6655761 768 COSMIC
COSN24318343 838 COSMIC
COSN23977531 927 COSMIC
COSN22309677 1360 COSMIC
COSN7163537 1562 COSMIC
COSN20113774 2169 COSMIC
COSN22742526 2574 COSMIC
COSN27620426 2757 COSMIC
COSN26406367 2768 COSMIC
COSN22411958 2815 COSMIC
COSN6548076 2832 COSMIC
COSN24294755 3429 COSMIC
COSN8834387 3457 COSMIC
COSN26485456 3599 COSMIC
COSN22404040 3775 COSMIC
COSN31924807 3817 COSMIC
COSN1716376 3851 COSMIC
COSN20788051 3900 COSMIC
COSN30172568 4216 COSMIC
COSN26642230 4356 COSMIC
COSN19250794 4391 COSMIC
COSN30157975 4402 COSMIC
COSN26504135 4686 COSMIC
COSN5178717 5044 COSMIC
COSN22727486 5056 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs373019750 2 dbSNP
rs377415352 13 dbSNP
rs749940753 16 dbSNP
rs1341493423 19 dbSNP
rs201386051 26 dbSNP
rs138729753 28 dbSNP
rs1171821146 31 dbSNP
rs753717493 33 dbSNP
rs754846082 34 dbSNP
rs1170564676 36 dbSNP
rs763792182 43 dbSNP
rs778554899 48 dbSNP
rs183768688 49 dbSNP
rs1055514524 58 dbSNP
rs1460417180 60 dbSNP
rs73987934 64 dbSNP
rs1014065713 68 dbSNP
rs1015691027 71 dbSNP
rs1320725392 75 dbSNP
rs1266263413 93 dbSNP
rs961505501 98 dbSNP
rs995668256 101 dbSNP
rs543901818 105 dbSNP
rs563759843 117 dbSNP
rs761635585 119 dbSNP
rs954423244 134 dbSNP
rs575781399 138 dbSNP
rs1331571411 141 dbSNP
rs910181255 146 dbSNP
rs965757909 147 dbSNP
rs1235148838 152 dbSNP
rs975764108 155 dbSNP
rs1321884756 160 dbSNP
rs913661007 162 dbSNP
rs945160347 163 dbSNP
rs865853029 178 dbSNP
rs1041404540 191 dbSNP
rs1326920860 192 dbSNP
rs1390964291 194 dbSNP
rs902685682 205 dbSNP
rs1003773562 207 dbSNP
rs1177093184 210 dbSNP
rs1327413913 212 dbSNP
rs1470809833 214 dbSNP
rs1208340795 215 dbSNP
rs1426946065 216 dbSNP
rs1436768971 216 dbSNP
rs34897756 216 dbSNP
rs80310135 216 dbSNP
rs869279909 216 dbSNP
rs76806222 217 dbSNP
rs1244242002 218 dbSNP
rs902922925 227 dbSNP
rs1229458826 232 dbSNP
rs561596948 232 dbSNP
rs1035219904 245 dbSNP
rs979231003 259 dbSNP
rs1353107702 263 dbSNP
rs925139450 265 dbSNP
rs937910668 267 dbSNP
rs1055071383 275 dbSNP
rs1486875793 277 dbSNP
rs896666436 284 dbSNP
rs896441341 290 dbSNP
rs9891458 294 dbSNP
rs1037070402 300 dbSNP
rs1335830740 305 dbSNP
rs1401111897 308 dbSNP
rs1024317971 310 dbSNP
rs898785709 311 dbSNP
rs897242786 317 dbSNP
rs546972969 324 dbSNP
rs1434206576 326 dbSNP
rs1027141980 328 dbSNP
rs889974573 330 dbSNP
rs565268640 332 dbSNP
rs1202122974 338 dbSNP
rs749914967 371 dbSNP
rs1185908131 372 dbSNP
rs1443312610 375 dbSNP
rs532699104 378 dbSNP
rs1025677524 379 dbSNP
rs1216917158 384 dbSNP
rs1410213305 404 dbSNP
rs1449147847 406 dbSNP
rs1282371996 407 dbSNP
rs1204774766 408 dbSNP
rs113250630 409 dbSNP
rs987293815 410 dbSNP
rs1243957020 415 dbSNP
rs551030409 420 dbSNP
rs1314354087 426 dbSNP
rs1169963771 427 dbSNP
rs569394077 427 dbSNP
rs966064433 431 dbSNP
rs1399768644 433 dbSNP
rs1164934889 437 dbSNP
rs534187035 437 dbSNP
rs975711585 439 dbSNP
rs1385137006 442 dbSNP
rs1187640920 446 dbSNP
rs1476554783 448 dbSNP
rs1020615421 449 dbSNP
rs568991307 450 dbSNP
rs947344444 452 dbSNP
rs541439478 453 dbSNP
rs548191598 456 dbSNP
rs1406680697 457 dbSNP
rs1289006866 462 dbSNP
rs1398591110 462 dbSNP
rs938392659 465 dbSNP
rs1057300732 466 dbSNP
rs566390195 467 dbSNP
rs1429853307 469 dbSNP
rs200442920 470 dbSNP
rs558178995 476 dbSNP
rs1304638382 477 dbSNP
rs1422165951 479 dbSNP
rs948204109 482 dbSNP
rs1171660225 483 dbSNP
rs141850417 486 dbSNP
rs898743322 487 dbSNP
rs1318912892 489 dbSNP
rs537586299 491 dbSNP
rs917835008 492 dbSNP
rs1271255856 493 dbSNP
rs1197572489 497 dbSNP
rs12449550 508 dbSNP
rs1206788957 510 dbSNP
rs1037017459 513 dbSNP
rs897189053 518 dbSNP
rs931357699 519 dbSNP
rs1048527690 526 dbSNP
rs889912773 529 dbSNP
rs1402730268 530 dbSNP
rs575768107 531 dbSNP
rs964184607 532 dbSNP
rs1443788144 535 dbSNP
rs1353246710 537 dbSNP
rs1328798429 538 dbSNP
rs1421631490 544 dbSNP
rs1007066236 546 dbSNP
rs997080868 551 dbSNP
rs112392963 552 dbSNP
rs1021446629 553 dbSNP
rs1163529022 554 dbSNP
rs1178993563 555 dbSNP
rs543156812 561 dbSNP
rs554971328 562 dbSNP
rs1231058070 563 dbSNP
rs188678784 564 dbSNP
rs1264753921 565 dbSNP
rs1221527266 567 dbSNP
rs1311214687 569 dbSNP
rs1307325072 574 dbSNP
rs901420553 583 dbSNP
rs1010466447 584 dbSNP
rs1272551347 585 dbSNP
rs1020561491 588 dbSNP
rs966359860 589 dbSNP
rs540924437 590 dbSNP
rs565306192 591 dbSNP
rs1407358996 593 dbSNP
rs979113428 594 dbSNP
rs1394510191 595 dbSNP
rs1445160383 595 dbSNP
rs1312151652 597 dbSNP
rs1032102561 600 dbSNP
rs959419417 606 dbSNP
rs532534859 608 dbSNP
rs544395650 609 dbSNP
rs562954699 616 dbSNP
rs972658528 617 dbSNP
rs1395763088 620 dbSNP
rs918568877 623 dbSNP
rs931303849 624 dbSNP
rs548406303 625 dbSNP
rs1360202338 628 dbSNP
rs1164256328 631 dbSNP
rs1234948600 635 dbSNP
rs887387973 636 dbSNP
rs1422958143 637 dbSNP
rs1188112403 639 dbSNP
rs566329257 640 dbSNP
rs911301917 644 dbSNP
rs1284917788 645 dbSNP
rs1369047214 648 dbSNP
rs1041090853 652 dbSNP
rs942817313 657 dbSNP
rs1290174516 659 dbSNP
rs527611049 661 dbSNP
rs1298176923 664 dbSNP
rs1380922557 668 dbSNP
rs1340091149 670 dbSNP
rs901363772 677 dbSNP
rs1304001133 682 dbSNP
rs552039548 687 dbSNP
rs570131753 688 dbSNP
rs902155921 690 dbSNP
rs1457331253 693 dbSNP
rs533474905 695 dbSNP
rs1000480798 696 dbSNP
rs1032464743 698 dbSNP
rs1266171905 699 dbSNP
rs959134686 700 dbSNP
rs970175252 704 dbSNP
rs973169326 705 dbSNP
rs1225632729 707 dbSNP
rs1317723852 715 dbSNP
rs1284085837 719 dbSNP
rs1225593925 722 dbSNP
rs374676573 724 dbSNP
rs537822808 738 dbSNP
rs1392078517 741 dbSNP
rs555986234 744 dbSNP
rs62070565 746 dbSNP
rs535188829 748 dbSNP
rs1464778989 749 dbSNP
rs555189364 750 dbSNP
rs573452296 756 dbSNP
rs1197520759 757 dbSNP
rs112801093 760 dbSNP
rs1253231992 762 dbSNP
rs1454654759 764 dbSNP
rs1457552658 765 dbSNP
rs559259826 767 dbSNP
rs1365179778 769 dbSNP
rs373530090 771 dbSNP
rs1274537126 776 dbSNP
rs1239800516 779 dbSNP
rs908784947 780 dbSNP
rs577314246 782 dbSNP
rs1315841811 786 dbSNP
rs1470860633 787 dbSNP
rs1399546398 788 dbSNP
rs1275599220 795 dbSNP
rs1470139584 797 dbSNP
rs1365045429 798 dbSNP
rs1310782857 799 dbSNP
rs1209794035 804 dbSNP
rs944337701 806 dbSNP
rs1256255721 807 dbSNP
rs1200296963 808 dbSNP
rs1205947644 808 dbSNP
rs1041410005 811 dbSNP
rs1352861887 812 dbSNP
rs1259030146 815 dbSNP
rs1239603752 816 dbSNP
rs1376028486 822 dbSNP
rs1315669697 824 dbSNP
rs1454337919 830 dbSNP
rs1462323441 837 dbSNP
rs376406187 838 dbSNP
rs1246862465 839 dbSNP
rs1386767501 844 dbSNP
rs1156270446 845 dbSNP
rs1450055788 848 dbSNP
rs1386353447 849 dbSNP
rs562731883 850 dbSNP
rs1188182953 851 dbSNP
rs1422920279 852 dbSNP
rs1448956257 853 dbSNP
rs1432417482 857 dbSNP
rs1043134930 859 dbSNP
rs1176436504 866 dbSNP
rs1360293919 867 dbSNP
rs904643023 876 dbSNP
rs530259476 877 dbSNP
rs867069334 878 dbSNP
rs1431254329 884 dbSNP
rs1031503309 888 dbSNP
rs1432169432 889 dbSNP
rs895691612 891 dbSNP
rs1366056845 892 dbSNP
rs1014176624 896 dbSNP
rs569595002 898 dbSNP
rs370926577 899 dbSNP
rs1023032398 900 dbSNP
rs1261246408 904 dbSNP
rs1193220054 911 dbSNP
rs559947701 913 dbSNP
rs527447421 914 dbSNP
rs1206407722 915 dbSNP
rs1266998653 917 dbSNP
rs1464977825 927 dbSNP
rs1217264004 928 dbSNP
rs1244915658 930 dbSNP
rs1217651920 931 dbSNP
rs552072182 934 dbSNP
rs1219514239 935 dbSNP
rs1488085497 936 dbSNP
rs1433731956 937 dbSNP
rs1349790444 938 dbSNP
rs1191617657 945 dbSNP
rs1431153393 946 dbSNP
rs61429680 947 dbSNP
rs1421948491 948 dbSNP
rs1157188992 953 dbSNP
rs529534223 954 dbSNP
rs1401390261 955 dbSNP
rs1027388371 958 dbSNP
rs1320292705 963 dbSNP
rs1348658919 965 dbSNP
rs950486316 967 dbSNP
rs1304198908 969 dbSNP
rs1347757376 970 dbSNP
rs982941006 971 dbSNP
rs908716850 974 dbSNP
rs1226896018 975 dbSNP
rs1216928180 976 dbSNP
rs1280588345 978 dbSNP
rs1449632077 984 dbSNP
rs1398822061 986 dbSNP
rs1331058639 993 dbSNP
rs1287362549 994 dbSNP
rs545938808 996 dbSNP
rs181108986 1000 dbSNP
rs977049014 1004 dbSNP
rs1408827588 1011 dbSNP
rs1179084967 1012 dbSNP
rs1236329184 1018 dbSNP
rs1177756023 1021 dbSNP
rs1461624921 1022 dbSNP
rs1257321404 1023 dbSNP
rs1451034481 1023 dbSNP
rs750238967 1029 dbSNP
rs1207597055 1030 dbSNP
rs1311306450 1030 dbSNP
rs1270842242 1035 dbSNP
rs1043061152 1036 dbSNP
rs921233432 1036 dbSNP
rs904611823 1037 dbSNP
rs376513017 1039 dbSNP
rs1251362190 1040 dbSNP
rs1052847034 1042 dbSNP
rs549791374 1044 dbSNP
rs1470600268 1046 dbSNP
rs1160425507 1047 dbSNP
rs1411709811 1051 dbSNP
rs1444949693 1051 dbSNP
rs1257991732 1052 dbSNP
rs1179965684 1057 dbSNP
rs1482705760 1061 dbSNP
rs1242387581 1065 dbSNP
rs866295264 1066 dbSNP
rs1218104445 1068 dbSNP
rs1350903660 1069 dbSNP
rs567961803 1070 dbSNP
rs1247363770 1071 dbSNP
rs1324090202 1074 dbSNP
rs1405348721 1074 dbSNP
rs1164799040 1075 dbSNP
rs535566005 1076 dbSNP
rs1044047830 1079 dbSNP
rs553890583 1079 dbSNP
rs1022869532 1082 dbSNP
rs1458340710 1083 dbSNP
rs1162403392 1087 dbSNP
rs1307748494 1088 dbSNP
rs1336043388 1091 dbSNP
rs1443921529 1092 dbSNP
rs1195404019 1094 dbSNP
rs1486989668 1097 dbSNP
rs1281964492 1101 dbSNP
rs1222675402 1103 dbSNP
rs1489737597 1107 dbSNP
rs905799977 1108 dbSNP
rs1246008792 1110 dbSNP
rs1171818307 1114 dbSNP
rs1308483157 1114 dbSNP
rs567086685 1115 dbSNP
rs1340202892 1116 dbSNP
rs534362430 1119 dbSNP
rs565864549 1119 dbSNP
rs994503436 1120 dbSNP
rs1457160487 1121 dbSNP
rs1400777946 1122 dbSNP
rs1172629717 1127 dbSNP
rs1204188042 1128 dbSNP
rs1476634064 1129 dbSNP
rs1273423606 1133 dbSNP
rs1438673375 1136 dbSNP
rs1184209485 1137 dbSNP
rs1434424542 1145 dbSNP
rs1265841012 1146 dbSNP
rs1235899241 1147 dbSNP
rs1260388647 1147 dbSNP
rs1481277333 1147 dbSNP
rs1197184676 1148 dbSNP
rs1444119330 1149 dbSNP
rs1027358030 1152 dbSNP
rs1184219180 1153 dbSNP
rs1329422734 1154 dbSNP
rs542031227 1154 dbSNP
rs780004135 1154 dbSNP
rs1387647797 1155 dbSNP
rs950413126 1157 dbSNP
rs1168425183 1160 dbSNP
rs1463916230 1161 dbSNP
rs983201695 1162 dbSNP
rs1172835657 1164 dbSNP
rs1397621748 1165 dbSNP
rs1375412372 1166 dbSNP
rs559302223 1169 dbSNP
rs1411352106 1171 dbSNP
rs1016152911 1174 dbSNP
rs577506556 1176 dbSNP
rs1263916049 1177 dbSNP
rs538153733 1177 dbSNP
rs965586559 1180 dbSNP
rs556547892 1181 dbSNP
rs1377527760 1182 dbSNP
rs977352854 1183 dbSNP
rs574724262 1185 dbSNP
rs542322707 1189 dbSNP
rs921506715 1192 dbSNP
rs1227565980 1195 dbSNP
rs1171457486 1196 dbSNP
rs1382657441 1196 dbSNP
rs1419799266 1196 dbSNP
rs954332695 1197 dbSNP
rs1439408211 1199 dbSNP
rs1341241158 1202 dbSNP
rs777734294 1203 dbSNP
rs1276782308 1204 dbSNP
rs1255799763 1205 dbSNP
rs536023984 1208 dbSNP
rs978722591 1209 dbSNP
rs1460997443 1210 dbSNP
rs1237892266 1211 dbSNP
rs925961156 1214 dbSNP
rs1245040701 1215 dbSNP
rs1400007431 1216 dbSNP
rs1448247790 1216 dbSNP
rs1193075513 1218 dbSNP
rs1374086284 1219 dbSNP
rs1476610236 1220 dbSNP
rs1165349387 1221 dbSNP
rs560182700 1222 dbSNP
rs1401069508 1224 dbSNP
rs1194690207 1226 dbSNP
rs1489282200 1227 dbSNP
rs571910445 1231 dbSNP
rs868661417 1232 dbSNP
rs1385766008 1233 dbSNP
rs554869219 1234 dbSNP
rs1434340052 1235 dbSNP
rs1292240486 1236 dbSNP
rs1296249345 1237 dbSNP
rs1328063606 1241 dbSNP
rs1342032130 1243 dbSNP
rs1053223337 1247 dbSNP
rs1398913447 1249 dbSNP
rs113306015 1250 dbSNP
rs917352228 1251 dbSNP
rs1326112335 1252 dbSNP
rs1403912110 1252 dbSNP
rs1230816200 1253 dbSNP
rs1171886702 1254 dbSNP
rs1274018640 1255 dbSNP
rs1421835386 1256 dbSNP
rs369663373 1257 dbSNP
rs57000155 1257 dbSNP
rs1247175904 1259 dbSNP
rs1224325783 1264 dbSNP
rs1449844227 1266 dbSNP
rs1265133975 1268 dbSNP
rs1199108881 1269 dbSNP
rs62070567 1271 dbSNP
rs1204588088 1273 dbSNP
rs1275926568 1273 dbSNP
rs866098969 1274 dbSNP
rs1263051249 1275 dbSNP
rs1277067323 1276 dbSNP
rs1434910550 1277 dbSNP
rs1449179670 1278 dbSNP
rs1197264890 1281 dbSNP
rs952198799 1282 dbSNP
rs1415063989 1286 dbSNP
rs1427329415 1287 dbSNP
rs1044661015 1288 dbSNP
rs905771454 1290 dbSNP
rs1178956379 1293 dbSNP
rs1458928216 1311 dbSNP
rs755147905 1314 dbSNP
rs1203399562 1318 dbSNP
rs1312455831 1320 dbSNP
rs1048720523 1324 dbSNP
rs867718379 1327 dbSNP
rs545555885 1328 dbSNP
rs1004605144 1331 dbSNP
rs1449414032 1334 dbSNP
rs1297267472 1340 dbSNP
rs1018681399 1341 dbSNP
rs1298015590 1341 dbSNP
rs1288887428 1342 dbSNP
rs966210181 1348 dbSNP
rs1413990142 1350 dbSNP
rs998359650 1360 dbSNP
rs1028941431 1361 dbSNP
rs563932382 1366 dbSNP
rs868700388 1374 dbSNP
rs531681096 1375 dbSNP
rs549786942 1379 dbSNP
rs561759129 1380 dbSNP
rs1285461278 1388 dbSNP
rs186807079 1389 dbSNP
rs1485078901 1391 dbSNP
rs925928591 1392 dbSNP
rs1261372599 1394 dbSNP
rs191716094 1401 dbSNP
rs1306731716 1402 dbSNP
rs1353550271 1407 dbSNP
rs1381540692 1412 dbSNP
rs1208541582 1419 dbSNP
rs1414202063 1421 dbSNP
rs1268682723 1425 dbSNP
rs11657674 1429 dbSNP
rs539530494 1433 dbSNP
rs1378471508 1438 dbSNP
rs989242710 1440 dbSNP
rs917338511 1441 dbSNP
rs1179780931 1445 dbSNP
rs1485169881 1447 dbSNP
rs1263240815 1452 dbSNP
rs1218247758 1453 dbSNP
rs1487586717 1453 dbSNP
rs1260665759 1457 dbSNP
rs1222685676 1463 dbSNP
rs1323909075 1469 dbSNP
rs950213683 1471 dbSNP
rs1232873292 1473 dbSNP
rs1341403215 1476 dbSNP
rs1418140329 1492 dbSNP
rs1398288209 1494 dbSNP
rs1044204653 1501 dbSNP
rs1288253333 1501 dbSNP
rs1458178918 1507 dbSNP
rs1351386333 1511 dbSNP
rs1162577628 1516 dbSNP
rs1159285481 1528 dbSNP
rs1364998691 1530 dbSNP
rs1423969198 1538 dbSNP
rs1195140853 1544 dbSNP
rs1456375971 1547 dbSNP
rs1162876227 1548 dbSNP
rs552850250 1550 dbSNP
rs142898376 1552 dbSNP
rs1305890311 1558 dbSNP
rs1049019424 1563 dbSNP
rs886384095 1563 dbSNP
rs1318849156 1565 dbSNP
rs1391031101 1569 dbSNP
rs1307842609 1573 dbSNP
rs367605789 1574 dbSNP
rs1337586407 1576 dbSNP
rs1242632973 1579 dbSNP
rs1216836698 1582 dbSNP
rs1325956211 1583 dbSNP
rs1291700497 1589 dbSNP
rs1360727177 1592 dbSNP
rs9747838 1601 dbSNP
rs150665781 1603 dbSNP
rs1369725769 1608 dbSNP
rs1004532564 1610 dbSNP
rs1323629401 1610 dbSNP
rs1177405358 1627 dbSNP
rs574796246 1635 dbSNP
rs536653668 1638 dbSNP
rs1459979722 1639 dbSNP
rs918515008 1646 dbSNP
rs952641051 1647 dbSNP
rs1251738033 1648 dbSNP
rs376267991 1649 dbSNP
rs1426459681 1650 dbSNP
rs1240213691 1652 dbSNP
rs1196962201 1663 dbSNP
rs911235916 1666 dbSNP
rs1000350184 1667 dbSNP
rs1235587844 1669 dbSNP
rs1353671760 1670 dbSNP
rs1301165896 1672 dbSNP
rs1461713200 1677 dbSNP
rs1033207689 1678 dbSNP
rs1377393594 1679 dbSNP
rs1298980649 1688 dbSNP
rs200795299 1690 dbSNP
rs1041537989 1692 dbSNP
rs1395406471 1696 dbSNP
rs1450562741 1698 dbSNP
rs1467142620 1700 dbSNP
rs1393768178 1701 dbSNP
rs1173591524 1702 dbSNP
rs956330668 1703 dbSNP
rs988821656 1709 dbSNP
rs7216263 1710 dbSNP
rs971465993 1716 dbSNP
rs1295924540 1723 dbSNP
rs1482335384 1728 dbSNP
rs980612283 1729 dbSNP
rs1355332098 1732 dbSNP
rs7217597 1734 dbSNP
rs7222372 1743 dbSNP
rs904782621 1746 dbSNP
rs1000880475 1750 dbSNP
rs7216427 1757 dbSNP
rs753014208 1758 dbSNP
rs1236685551 1768 dbSNP
rs7218163 1777 dbSNP
rs1011975009 1780 dbSNP
rs1397222069 1786 dbSNP
rs1025147622 1787 dbSNP
rs970513849 1788 dbSNP
rs1243213078 1791 dbSNP
rs1420838050 1792 dbSNP
rs993994275 1793 dbSNP
rs1382764197 1802 dbSNP
rs1025522033 1806 dbSNP
rs952587261 1812 dbSNP
rs984471936 1813 dbSNP
rs1418640735 1815 dbSNP
rs1018244059 1829 dbSNP
rs534292845 1834 dbSNP
rs1189905373 1837 dbSNP
rs984644018 1837 dbSNP
rs976831138 1838 dbSNP
rs1217520157 1845 dbSNP
rs181682153 1845 dbSNP
rs1040003316 1846 dbSNP
rs1286272336 1846 dbSNP
rs1349722709 1847 dbSNP
rs549753767 1847 dbSNP
rs931724436 1848 dbSNP
rs946175788 1848 dbSNP
rs1336212523 1849 dbSNP
rs1050122367 1851 dbSNP
rs1400095943 1851 dbSNP
rs867089876 1851 dbSNP
rs1362933030 1852 dbSNP
rs1316882717 1854 dbSNP
rs56087749 1864 dbSNP
rs926152889 1867 dbSNP
rs1165403585 1870 dbSNP
rs1460067997 1881 dbSNP
rs936239080 1882 dbSNP
rs1194399946 1884 dbSNP
rs1454603082 1885 dbSNP
rs1478844745 1886 dbSNP
rs564336475 1889 dbSNP
rs34047121 1893 dbSNP
rs1287663336 1899 dbSNP
rs1010908416 1903 dbSNP
rs576142847 1907 dbSNP
rs543717657 1910 dbSNP
rs1361793018 1911 dbSNP
rs1215399785 1913 dbSNP
rs1332139860 1919 dbSNP
rs1056469347 1926 dbSNP
rs1218670543 1936 dbSNP
rs971817874 1939 dbSNP
rs1298168618 1942 dbSNP
rs1321054601 1943 dbSNP
rs1332245479 1945 dbSNP
rs1222489729 1947 dbSNP
rs561807453 1951 dbSNP
rs1460214313 1954 dbSNP
rs528884626 1956 dbSNP
rs947718264 1960 dbSNP
rs1393932809 1965 dbSNP
rs1263270683 1983 dbSNP
rs1034415118 1984 dbSNP
rs1417429725 1995 dbSNP
rs547455919 1997 dbSNP
rs1462282590 1998 dbSNP
rs1247231806 2013 dbSNP
rs1195194058 2017 dbSNP
rs187653273 2020 dbSNP
rs1251938400 2027 dbSNP
rs751246414 2028 dbSNP
rs1198857730 2035 dbSNP
rs906278774 2037 dbSNP
rs1213538496 2041 dbSNP
rs1241447965 2041 dbSNP
rs993941838 2042 dbSNP
rs111535150 2047 dbSNP
rs976420721 2049 dbSNP
rs923244786 2051 dbSNP
rs778312626 2053 dbSNP
rs1050092579 2056 dbSNP
rs903606112 2061 dbSNP
rs1415115747 2073 dbSNP
rs1425737683 2091 dbSNP
rs1025467965 2098 dbSNP
rs533087835 2107 dbSNP
rs1188123631 2108 dbSNP
rs1179091413 2116 dbSNP
rs1422767524 2121 dbSNP
rs1005442747 2133 dbSNP
rs551485287 2142 dbSNP
rs1230832956 2145 dbSNP
rs571038485 2147 dbSNP
rs1442524858 2150 dbSNP
rs1283026206 2152 dbSNP
rs1232707326 2156 dbSNP
rs1018608913 2157 dbSNP
rs1377332270 2159 dbSNP
rs3833858 2159 dbSNP
rs397717585 2159 dbSNP
rs397763116 2159 dbSNP
rs964029889 2159 dbSNP
rs977156635 2169 dbSNP
rs370303516 2170 dbSNP
rs1156936297 2174 dbSNP
rs1345177993 2177 dbSNP
rs1432103817 2178 dbSNP
rs1291040196 2179 dbSNP
rs771355378 2182 dbSNP
rs9906801 2183 dbSNP
rs1404663863 2188 dbSNP
rs1420655553 2190 dbSNP
rs144910521 2190 dbSNP
rs1405290091 2192 dbSNP
rs1325157437 2199 dbSNP
rs977489911 2213 dbSNP
rs568617175 2217 dbSNP
rs1034382504 2218 dbSNP
rs1472948929 2219 dbSNP
rs545672055 2227 dbSNP
rs1217841376 2230 dbSNP
rs1244860041 2231 dbSNP
rs1485600630 2231 dbSNP
rs991722154 2240 dbSNP
rs1306800257 2241 dbSNP
rs1229074820 2258 dbSNP
rs754729915 2262 dbSNP
rs1291495198 2263 dbSNP
rs1199794501 2265 dbSNP
rs1354665330 2271 dbSNP
rs1289400985 2274 dbSNP
rs1455104767 2277 dbSNP
rs916140640 2279 dbSNP
rs950368073 2281 dbSNP
rs1046078601 2295 dbSNP
rs1156967617 2296 dbSNP
rs906224821 2302 dbSNP
rs929680703 2303 dbSNP
rs1185072989 2305 dbSNP
rs1407306910 2306 dbSNP
rs975966709 2325 dbSNP
rs1188780521 2335 dbSNP
rs1485202875 2339 dbSNP
rs1046864950 2356 dbSNP
rs1401846018 2361 dbSNP
rs1161935933 2366 dbSNP
rs1337150080 2368 dbSNP
rs1364206506 2371 dbSNP
rs888245672 2373 dbSNP
rs953356817 2376 dbSNP
rs1318717850 2389 dbSNP
rs1005791701 2394 dbSNP
rs1383815915 2398 dbSNP
rs1018148545 2406 dbSNP
rs899731443 2408 dbSNP
rs564250988 2412 dbSNP
rs866568696 2413 dbSNP
rs1441377478 2415 dbSNP
rs1278497119 2419 dbSNP
rs1162377626 2420 dbSNP
rs1373461568 2422 dbSNP
rs1460641847 2426 dbSNP
rs781384450 2436 dbSNP
rs936401457 2440 dbSNP
rs1052148715 2441 dbSNP
rs1261654546 2443 dbSNP
rs998858240 2446 dbSNP
rs528151245 2455 dbSNP
rs1033066785 2457 dbSNP
rs946187536 2458 dbSNP
rs1318918970 2484 dbSNP
rs1253139371 2488 dbSNP
rs1045937168 2499 dbSNP
rs1223026858 2511 dbSNP
rs1305632126 2512 dbSNP
rs553800049 2521 dbSNP
rs1294813860 2527 dbSNP
rs1234689495 2529 dbSNP
rs907439224 2531 dbSNP
rs1329078957 2532 dbSNP
rs1453579669 2538 dbSNP
rs115046124 2539 dbSNP
rs1232467115 2541 dbSNP
rs1299328518 2552 dbSNP
rs1055763104 2554 dbSNP
rs1372968530 2568 dbSNP
rs1174837520 2570 dbSNP
rs1470571314 2575 dbSNP
rs773618254 2579 dbSNP
rs887794323 2579 dbSNP
rs1193473177 2581 dbSNP
rs1006256977 2584 dbSNP
rs1438554007 2586 dbSNP
rs1252937317 2587 dbSNP
rs1383936607 2600 dbSNP
rs992063816 2607 dbSNP
rs1194113598 2608 dbSNP
rs916104522 2609 dbSNP
rs1256716404 2616 dbSNP
rs1211468878 2621 dbSNP
rs1350048229 2626 dbSNP
rs539581154 2627 dbSNP
rs972043617 2629 dbSNP
rs1367825968 2630 dbSNP
rs1233308132 2636 dbSNP
rs981701753 2637 dbSNP
rs1335911221 2653 dbSNP
rs997753436 2656 dbSNP
rs927588045 2660 dbSNP
rs1030173216 2664 dbSNP
rs557937604 2674 dbSNP
rs1395110409 2675 dbSNP
rs953257845 2676 dbSNP
rs1437116904 2681 dbSNP
rs983941948 2701 dbSNP
rs1046811632 2704 dbSNP
rs986030610 2710 dbSNP
rs909622190 2712 dbSNP
rs1179896697 2722 dbSNP
rs576208682 2726 dbSNP
rs941143884 2729 dbSNP
rs957688069 2741 dbSNP
rs987790257 2744 dbSNP
rs1213187260 2746 dbSNP
rs1486577535 2751 dbSNP
rs1039931764 2753 dbSNP
rs138878949 2757 dbSNP
rs369795614 2757 dbSNP
rs949196014 2768 dbSNP
rs1351160037 2771 dbSNP
rs1262317250 2781 dbSNP
rs1316954629 2791 dbSNP
rs1046281425 2792 dbSNP
rs569801379 2800 dbSNP
rs899679865 2820 dbSNP
rs998034668 2822 dbSNP
rs928820395 2823 dbSNP
rs1194972102 2824 dbSNP
rs1272566558 2835 dbSNP
rs1438550550 2836 dbSNP
rs543206631 2842 dbSNP
rs756535482 2843 dbSNP
rs903158534 2850 dbSNP
rs888054806 2853 dbSNP
rs1006225920 2854 dbSNP
rs1241323928 2856 dbSNP
rs778345122 2867 dbSNP
rs1036401751 2881 dbSNP
rs897871923 2884 dbSNP
rs9913935 2893 dbSNP
rs1184776524 2898 dbSNP
rs1186724482 2899 dbSNP
rs1370662919 2906 dbSNP
rs1415152197 2907 dbSNP
rs1447551030 2910 dbSNP
rs1030557202 2914 dbSNP
rs1033053396 2919 dbSNP
rs1273463242 2919 dbSNP
rs957666147 2922 dbSNP
rs770983273 2924 dbSNP
rs574030670 2927 dbSNP
rs190890735 2933 dbSNP
rs1292183408 2950 dbSNP
rs1023525105 2959 dbSNP
rs1328767792 2962 dbSNP
rs559423835 2964 dbSNP
rs1316611348 2973 dbSNP
rs1382012962 2973 dbSNP
rs1395438545 2982 dbSNP
rs1167646975 2985 dbSNP
rs1419864026 2987 dbSNP
rs1032201426 2989 dbSNP
rs957986910 3004 dbSNP
rs1411296687 3017 dbSNP
rs981649675 3018 dbSNP
rs1020624636 3022 dbSNP
rs988203826 3022 dbSNP
rs1253446606 3032 dbSNP
rs532920311 3036 dbSNP
rs950985559 3044 dbSNP
rs1466915681 3047 dbSNP
rs982427766 3052 dbSNP
rs981901705 3068 dbSNP
rs147964538 3069 dbSNP
rs1342005934 3071 dbSNP
rs928757649 3097 dbSNP
rs1227084207 3106 dbSNP
rs775103280 3108 dbSNP
rs941081104 3108 dbSNP
rs1324545712 3123 dbSNP
rs1394096031 3127 dbSNP
rs1438978304 3127 dbSNP
rs1329555594 3128 dbSNP
rs1226438190 3129 dbSNP
rs937476209 3130 dbSNP
rs1166068609 3133 dbSNP
rs1448834093 3147 dbSNP
rs1039475023 3149 dbSNP
rs991696742 3159 dbSNP
rs1452125332 3163 dbSNP
rs1340372791 3166 dbSNP
rs536750998 3172 dbSNP
rs772385454 3173 dbSNP
rs1270330826 3177 dbSNP
rs1460953429 3181 dbSNP
rs1050920186 3184 dbSNP
rs776241696 3188 dbSNP
rs1205032380 3192 dbSNP
rs142024931 3192 dbSNP
rs897844642 3229 dbSNP
rs182224085 3233 dbSNP
rs1367086444 3238 dbSNP
rs572268472 3238 dbSNP
rs1444699201 3245 dbSNP
rs1352808227 3251 dbSNP
rs998751673 3253 dbSNP
rs1328351334 3255 dbSNP
rs1429017929 3257 dbSNP
rs769553341 3275 dbSNP
rs1376011118 3277 dbSNP
rs1175213287 3279 dbSNP
rs1054850446 3280 dbSNP
rs893149183 3282 dbSNP
rs1423967019 3283 dbSNP
rs1298378422 3286 dbSNP
rs1177401017 3288 dbSNP
rs1470979708 3289 dbSNP
rs1230670373 3295 dbSNP
rs1013393090 3299 dbSNP
rs533218701 3301 dbSNP
rs186496433 3309 dbSNP
rs1209124533 3312 dbSNP
rs907334907 3312 dbSNP
rs1311954200 3325 dbSNP
rs1007344063 3328 dbSNP
rs773298037 3329 dbSNP
rs1469872213 3337 dbSNP
rs1371529779 3345 dbSNP
rs1026510310 3350 dbSNP
rs1032170270 3355 dbSNP
rs950933610 3356 dbSNP
rs1382771955 3364 dbSNP
rs893688092 3365 dbSNP
rs568638983 3369 dbSNP
rs1009487545 3372 dbSNP
rs1381575185 3374 dbSNP
rs985076070 3379 dbSNP
rs1016990329 3394 dbSNP
rs1328004263 3395 dbSNP
rs1402831006 3404 dbSNP
rs763045990 3406 dbSNP
rs1281618969 3410 dbSNP
rs141094432 3411 dbSNP
rs1323031686 3416 dbSNP
rs1159644144 3424 dbSNP
rs1402072410 3431 dbSNP
rs1339672953 3433 dbSNP
rs1021015195 3435 dbSNP
rs1259066962 3442 dbSNP
rs970430004 3442 dbSNP
rs547670760 3447 dbSNP
rs1224269782 3450 dbSNP
rs1257832966 3453 dbSNP
rs765986598 3455 dbSNP
rs1218404450 3462 dbSNP
rs1315287775 3472 dbSNP
rs1267778733 3476 dbSNP
rs933782988 3477 dbSNP
rs1445460469 3487 dbSNP
rs1337009102 3498 dbSNP
rs986577299 3504 dbSNP
rs924475162 3514 dbSNP
rs1033428081 3517 dbSNP
rs934549946 3520 dbSNP
rs761755930 3521 dbSNP
rs1432643356 3526 dbSNP
rs1385937228 3529 dbSNP
rs565753491 3531 dbSNP
rs965856924 3532 dbSNP
rs948755280 3533 dbSNP
rs1419386212 3536 dbSNP
rs1267747805 3537 dbSNP
rs1044823300 3540 dbSNP
rs907269629 3559 dbSNP
rs1480551375 3569 dbSNP
rs1420860139 3574 dbSNP
rs1188615515 3585 dbSNP
rs1485112213 3586 dbSNP
rs1200452603 3588 dbSNP
rs1247847276 3606 dbSNP
rs190169276 3607 dbSNP
rs1002988664 3612 dbSNP
rs1361538466 3614 dbSNP
rs558235386 3629 dbSNP
rs1159107817 3630 dbSNP
rs570013601 3631 dbSNP
rs1422533277 3637 dbSNP
rs1216056558 3641 dbSNP
rs919531555 3642 dbSNP
rs1441166575 3643 dbSNP
rs1396240894 3655 dbSNP
rs866366047 3656 dbSNP
rs182436278 3661 dbSNP
rs1345190699 3673 dbSNP
rs1006845898 3674 dbSNP
rs1051752571 3675 dbSNP
rs1389936695 3684 dbSNP
rs889190917 3687 dbSNP
rs1303558170 3697 dbSNP
rs767227553 3702 dbSNP
rs1251378224 3705 dbSNP
rs1016524291 3707 dbSNP
rs752935107 3717 dbSNP
rs1253194226 3736 dbSNP
rs965367309 3740 dbSNP
rs1334077678 3752 dbSNP
rs943464122 3756 dbSNP
rs756512570 3757 dbSNP
rs573490175 3758 dbSNP
rs1053510394 3773 dbSNP
rs1261825801 3775 dbSNP
rs1356398355 3781 dbSNP
rs1372677110 3782 dbSNP
rs187887821 3783 dbSNP
rs1009868453 3785 dbSNP
rs1042293114 3786 dbSNP
rs1370497793 3790 dbSNP
rs573863735 3802 dbSNP
rs541350978 3813 dbSNP
rs868410328 3829 dbSNP
rs754337381 3833 dbSNP
rs1376083067 3836 dbSNP
rs906484949 3840 dbSNP
rs138773706 3850 dbSNP
rs1490422547 3852 dbSNP
rs1419971489 3857 dbSNP
rs1252741916 3863 dbSNP
rs1180125374 3864 dbSNP
rs1481994761 3866 dbSNP
rs1273871960 3876 dbSNP
rs1211278428 3877 dbSNP
rs757800800 3877 dbSNP
rs1349759592 3879 dbSNP
rs1003204288 3880 dbSNP
rs1211290473 3893 dbSNP
rs367982904 3894 dbSNP
rs959074575 3896 dbSNP
rs924424204 3897 dbSNP
rs778941107 3900 dbSNP
rs1016413156 3907 dbSNP
rs963565792 3913 dbSNP
rs1350365337 3924 dbSNP
rs553273672 3924 dbSNP
rs1181830036 3930 dbSNP
rs1314044669 3932 dbSNP
rs1417214256 3948 dbSNP
rs1355881728 3951 dbSNP
rs934511555 3954 dbSNP
rs1400475117 3960 dbSNP
rs6505192 3968 dbSNP
rs1454451345 3976 dbSNP
rs1442700812 3981 dbSNP
rs74887530 3983 dbSNP
rs948683536 3988 dbSNP
rs1044390334 3989 dbSNP
rs907217363 3995 dbSNP
rs563283721 3996 dbSNP
rs530569778 4004 dbSNP
rs1047847800 4006 dbSNP
rs573108060 4007 dbSNP
rs866684657 4009 dbSNP
rs1225988008 4015 dbSNP
rs1038315598 4019 dbSNP
rs915339072 4027 dbSNP
rs945229221 4034 dbSNP
rs1394512110 4043 dbSNP
rs200160407 4044 dbSNP
rs1307780031 4056 dbSNP
rs193187707 4057 dbSNP
rs1383158151 4066 dbSNP
rs1387355838 4071 dbSNP
rs996859066 4076 dbSNP
rs906419098 4084 dbSNP
rs1418663163 4093 dbSNP
rs185128362 4099 dbSNP
rs1314903415 4105 dbSNP
rs1366646690 4105 dbSNP
rs1186525956 4113 dbSNP
rs955058916 4115 dbSNP
rs1360659519 4124 dbSNP
rs1247356076 4125 dbSNP
rs1007892364 4131 dbSNP
rs216463 4135 dbSNP
rs1206403733 4141 dbSNP
rs956015045 4148 dbSNP
rs1273206119 4154 dbSNP
rs1229541607 4155 dbSNP
rs1354816676 4161 dbSNP
rs1284149428 4169 dbSNP
rs1195947816 4171 dbSNP
rs1054772944 4172 dbSNP
rs1328534573 4177 dbSNP
rs1239437337 4179 dbSNP
rs1434625613 4186 dbSNP
rs1395504751 4196 dbSNP
rs894826552 4198 dbSNP
rs1403703750 4202 dbSNP
rs547707598 4203 dbSNP
rs1388426101 4206 dbSNP
rs1005251456 4207 dbSNP
rs989995834 4211 dbSNP
rs914420261 4215 dbSNP
rs565987625 4223 dbSNP
rs1186461725 4241 dbSNP
rs1391779861 4241 dbSNP
rs144926598 4249 dbSNP
rs1253275713 4253 dbSNP
rs551829190 4270 dbSNP
rs1449358318 4272 dbSNP
rs1288580437 4273 dbSNP
rs1196887247 4287 dbSNP
rs993672381 4291 dbSNP
rs1026905987 4294 dbSNP
rs769621566 4297 dbSNP
rs1371945420 4323 dbSNP
rs1305923345 4326 dbSNP
rs11539823 4328 dbSNP
rs1330560378 4328 dbSNP
rs762974847 4329 dbSNP
rs942135155 4339 dbSNP
rs1329699180 4352 dbSNP
rs1037859575 4354 dbSNP
rs1410451281 4355 dbSNP
rs1372336331 4368 dbSNP
rs537182482 4370 dbSNP
rs189244419 4382 dbSNP
rs996419680 4394 dbSNP
rs964667468 4396 dbSNP
rs1192541417 4402 dbSNP
rs1476876938 4404 dbSNP
rs989462202 4406 dbSNP
rs915322511 4411 dbSNP
rs1332172649 4414 dbSNP
rs1273141456 4417 dbSNP
rs1402520614 4419 dbSNP
rs1450492880 4421 dbSNP
rs945462113 4422 dbSNP
rs1336658216 4423 dbSNP
rs1051969733 4425 dbSNP
rs1380456892 4434 dbSNP
rs977914604 4435 dbSNP
rs1230445547 4446 dbSNP
rs1281215453 4471 dbSNP
rs149060641 4472 dbSNP
rs1007839658 4473 dbSNP
rs1055034710 4493 dbSNP
rs1411777591 4493 dbSNP
rs534761455 4502 dbSNP
rs895088322 4504 dbSNP
rs143104754 4508 dbSNP
rs955796221 4511 dbSNP
rs578027478 4513 dbSNP
rs538924034 4517 dbSNP
rs17605796 4519 dbSNP
rs1202410260 4521 dbSNP
rs1158595734 4532 dbSNP
rs759120979 4537 dbSNP
rs1484184954 4543 dbSNP
rs1184630385 4547 dbSNP
rs1260735490 4552 dbSNP
rs1428191921 4564 dbSNP
rs1486322204 4570 dbSNP
rs979983873 4575 dbSNP
rs1208478055 4579 dbSNP
rs1425970539 4580 dbSNP
rs1468311377 4581 dbSNP
rs1175784821 4582 dbSNP
rs1285247469 4603 dbSNP
rs1230520661 4615 dbSNP
rs767031776 4627 dbSNP
rs1450782559 4636 dbSNP
rs1287885754 4664 dbSNP
rs1227699175 4665 dbSNP
rs575163215 4669 dbSNP
rs1379828071 4673 dbSNP
rs1304309315 4686 dbSNP
rs1445576823 4694 dbSNP
rs959985311 4704 dbSNP
rs1358164520 4705 dbSNP
rs983433264 4709 dbSNP
rs890630680 4711 dbSNP
rs1287540453 4719 dbSNP
rs752375290 4720 dbSNP
rs1361730724 4725 dbSNP
rs1400948177 4729 dbSNP
rs1009047310 4738 dbSNP
rs760287105 4739 dbSNP
rs1017792464 4742 dbSNP
rs764439455 4746 dbSNP
rs1463760148 4747 dbSNP
rs1022723217 4749 dbSNP
rs1278706959 4750 dbSNP
rs942096929 4759 dbSNP
rs1313920578 4761 dbSNP
rs1314793001 4762 dbSNP
rs1226582778 4771 dbSNP
rs1378130218 4774 dbSNP
rs1038209258 4782 dbSNP
rs922085096 4791 dbSNP
rs932159970 4796 dbSNP
rs1051913053 4801 dbSNP
rs1319224020 4819 dbSNP
rs1213528281 4821 dbSNP
rs542376168 4826 dbSNP
rs1486075610 4828 dbSNP
rs1163257042 4834 dbSNP
rs1195507244 4837 dbSNP
rs1420655420 4839 dbSNP
rs939149984 4843 dbSNP
rs1190928333 4848 dbSNP
rs754259557 4857 dbSNP
rs916492142 4861 dbSNP
rs1052691766 4864 dbSNP
rs560622300 4871 dbSNP
rs1265690520 4872 dbSNP
rs113011484 4882 dbSNP
rs896831726 4884 dbSNP
rs929710895 4887 dbSNP
rs1230343484 4895 dbSNP
rs1362520812 4896 dbSNP
rs540064275 4900 dbSNP
rs115824835 4906 dbSNP
rs559512592 4907 dbSNP
rs1291346989 4908 dbSNP
rs1345043144 4918 dbSNP
rs371542326 4927 dbSNP
rs1001367288 4928 dbSNP
rs114494760 4934 dbSNP
rs1428241955 4934 dbSNP
rs1177015619 4937 dbSNP
rs959933053 4950 dbSNP
rs563547404 4952 dbSNP
rs983379170 4964 dbSNP
rs1343322823 4972 dbSNP
rs1265339942 4976 dbSNP
rs1190696370 4980 dbSNP
rs1014901814 4983 dbSNP
rs963710511 4985 dbSNP
rs900724993 4991 dbSNP
rs973477721 4992 dbSNP
rs1207269022 4998 dbSNP
rs779396993 4999 dbSNP
rs1273731000 5004 dbSNP
rs530905872 5010 dbSNP
rs1221508269 5011 dbSNP
rs987580001 5017 dbSNP
rs1298478237 5020 dbSNP
rs912089577 5021 dbSNP
rs750428971 5029 dbSNP
rs138662605 5034 dbSNP
rs891429368 5035 dbSNP
rs1408575904 5038 dbSNP
rs1370329266 5042 dbSNP
rs1489936208 5043 dbSNP
rs1467721297 5049 dbSNP
rs947037316 5051 dbSNP
rs1042769491 5066 dbSNP
rs1222056739 5069 dbSNP
rs1247471922 5071 dbSNP
rs758526233 5075 dbSNP
rs563809592 5077 dbSNP
rs1472946806 5083 dbSNP
rs990618061 5085 dbSNP
rs1184255547 5089 dbSNP
rs916419031 5092 dbSNP
rs1035495144 5093 dbSNP
rs974410467 5103 dbSNP
rs918537230 5117 dbSNP
rs192346410 5122 dbSNP
rs1440837923 5133 dbSNP
rs1232134252 5140 dbSNP
rs929611623 5154 dbSNP
rs1364080264 5158 dbSNP
rs1424367931 5169 dbSNP
rs1004763605 5174 dbSNP
rs556554066 5189 dbSNP
rs1335192756 5192 dbSNP
rs1015263586 5194 dbSNP
rs963360492 5197 dbSNP
rs1297102166 5199 dbSNP
rs1377607279 5201 dbSNP
rs973807255 5204 dbSNP
rs1029015976 5205 dbSNP
rs146373292 5211 dbSNP
rs373268896 5211 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAAU-----ACACGACGAu 5'
              |||:||||     ||||||||| 
Target 5' ----AACUAUUACAAAUUGUGCUGCUc 3'
1 - 23
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000225724.5 | 3UTR | AACUAUUACAAAUUGUGCUGCUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.357 4.6e-4 0.340 8.3e-4 83 Click to see details
GSE28260 Renal cortex and medulla -0.655 7.6e-3 -0.731 2.3e-3 13 Click to see details
GSE19783 ER- ER- breast cancer 0.239 1.7e-2 0.305 3.1e-3 79 Click to see details
GSE19536 Breast cancer 0.182 3.5e-2 0.180 3.7e-2 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.369 4.2e-2 0.363 4.4e-2 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.262 1.0e-1 0.448 1.2e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.244 1.3e-1 0.124 2.8e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.192 1.5e-1 -0.251 8.3e-2 32 Click to see details
GSE21849 B cell lymphoma 0.194 1.6e-1 0.095 3.1e-1 29 Click to see details
GSE28544 Breast cancer -0.204 1.7e-1 -0.692 9.0e-5 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.203 2.0e-1 -0.311 9.1e-2 20 Click to see details
GSE21687 Ependynoma primary tumors -0.098 2.2e-1 -0.091 2.4e-1 64 Click to see details
GSE17306 Multiple myeloma -0.106 2.3e-1 -0.125 2.0e-1 49 Click to see details
GSE38226 Liver fibrosis -0.088 3.5e-1 0.055 4.1e-1 21 Click to see details
GSE14794 Lymphoblastoid cells -0.029 3.9e-1 0.051 3.2e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.042 4.2e-1 0.103 3.1e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.025 4.6e-1 0.135 3.1e-1 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.019 4.7e-1 0.171 2.4e-1 20 Click to see details
GSE17498 Multiple myeloma 0.004 4.9e-1 -0.056 3.7e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.003 5.0e-1 -0.413 9.1e-2 12 Click to see details
GSE19350 CNS germ cell tumors 0.003 5.0e-1 -0.413 9.1e-2 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP -0.549 0 -0.537 0 32 Click to see details
LIHC -0.338 0.01 -0.248 0.04 49 Click to see details
LUAD 0.489 0.05 0.336 0.14 12 Click to see details
THCA -0.172 0.1 -0.259 0.02 59 Click to see details
KIRC -0.148 0.11 -0.145 0.12 68 Click to see details
STAD -0.216 0.12 -0.265 0.07 32 Click to see details
PCPG -0.926 0.12 -1.000 0.5 3 Click to see details
LUSC 0.16 0.17 0.219 0.09 38 Click to see details
COAD 0.387 0.17 0.452 0.13 8 Click to see details
PAAD 0.653 0.17 0.400 0.3 4 Click to see details
KICH -0.143 0.25 -0.079 0.35 25 Click to see details
UCEC 0.153 0.27 0.165 0.25 19 Click to see details
CHOL -0.193 0.31 0.033 0.47 9 Click to see details
ESCA -0.131 0.35 -0.155 0.32 11 Click to see details
PRAD 0.054 0.35 -0.073 0.31 50 Click to see details
HNSC 0.057 0.36 0.033 0.42 42 Click to see details
CESC 0.143 0.45 0.500 0.33 3 Click to see details
BLCA 0.024 0.46 -0.053 0.42 18 Click to see details
BRCA 0.006 0.48 -0.053 0.32 84 Click to see details
BRCA 0.006 0.48 -0.053 0.32 84 Click to see details
BRCA 0.006 0.48 -0.053 0.32 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein