miRTarBase - #MIRT075891 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C16orf72   
Synonyms PRO0149
Description chromosome 16 open reading frame 72
Transcript NM_014117   
Expression
Putative miRNA Targets on C16orf72
3'UTR of C16orf72
(miRNA target sites are highlighted)
>C16orf72|NM_014117|3'UTR
   1 ACTGCAAACATTTTCACACCCACCATGCTGCTTGAAAGCCACTTGATCCTCAACATATACTATAATTGCAAAGGAAACAT
  81 GAGGCCATCTTCCCTTGTTCACTGTTTAAGACAAGTGAATTCTATAGTGGTTGCCATAAAAGGAAGTTCTAGGTATTTAT
 161 AGTAGATGCCTCTTGTAATTATGGCTTTCTTAAAACTATAATCCTAGCAGAGGACATCAGATATTGTGTAGTCGTTAGCA
 241 AGATCATCATAGGCAAACATATATCCGTTCCAAGGCTAAAAGTGACCTTAACTGTATTTATTCTCAAAGGGAAAGGAAAT
 321 ATCAGATGTTTATTTGGTTATAGAATGCTTTTTTTTTTTTTGGGTCCATTTCCTGCTGTGTTGAGTATTTTGCTTCAACA
 401 GTATTGCCAGGTTCCTAAAATTGTCTAAAAACATGATTTGGCTTCCATTTTTGCAGCTGCACTGTACCATGCACCTGGTT
 481 TCTATATAGTAACAGTGTGCAATTCTAATTATTGGACTGTGCCCTGTTTTTAGTTTTCAAATCAATTTCTAATTCTGGTG
 561 ATTGTGTGATGTAAAGAGGTGCTATGATGGTCATGCAATTAATACTAAATATTGAATCAATGCCCAGAGCTTTATTGGAT
 641 TCACTTTGTGTGTGTTAGTGCTCTAAAGTAGCAGTATTATTATTAAACTGTCCCCAGAGTAACCCTGTAGGCCTAAAGTA
 721 CTCAGTTTTAAGACAAACACTACTTCCCATGCGGGGTACTTTCCTTATGGTAAATGTAAACATGTAGACTGCATTCGAGG
 801 TGACCTAAAGTAGAGAGGTCATGAACTTTGAGAATGGGCTTCCTTTTTGGTTCAGTATTAGTGAGAGGGAGAGGGAGATG
 881 GATGGTGGGGTAGGTTTTCTAGTCTATCATTTTACATTTTTCATGGAGTCCCTGCTTAGTGCAGTTTCCATTGGAATGGG
 961 TGGAAGATGATAAAGCTCTCTTTTTTATCTACTAATAATGTGATTGCAACTTAAAATAGCAAAACCCAACTCTCCCTGTC
1041 CCTCCAATCCCTCTCCTAAAAAGTTCAGTTTGGAATCTCATTCTGGAAAAGATGGAATCGCATGGAGATTCTCTAGCTGT
1121 TAGGTAGACCTAAATAAAAAGTTCTCAATAGATTCCTCTTTTGAGTAAATATAAGACCTCTTGTAGCTACAATGTTTTAG
1201 AGCATGTTTCATCTTCATTTTTAATATCCTGAACTGAATGATAGTGTTTTTTTAGATGAAGAACTGATGTCAGCCTGCCA
1281 GGTACTGTAATTTATTCTATCATATTATTATATTATATATCAAGTAGGACAGTGAAAAATGTTTCCTTGCAAACTTGTAG
1361 TCCAGTATCAGTTACTTCCTATTTTTATCCTTAAAAGACCATTGCAAATCAGTGTAAGGGTTTTTCCAGTAATTACTCAC
1441 AGCACTTTGTTAAAGTTTGCAATTTCTTCAGCCATTTAATAATATCTTTCTGTGAAGAAACTTTGCTGAGTTAACCATAA
1521 ATGTTCATTCATTGACTGGGTGGGATGTGAATGGAATGTTAGAAATGTTGTGTGAATTGAAGTTCTGTATTCATTATAGA
1601 TGTAGCCCTTATTTAAAAAAGTGAATTCCATACTAAAACTAGGAATGAAAGTGAGAGATTTCTAAACTTTTGCGAAAGTG
1681 GGTCATTTTTTGTTTGACTATAATAGCAGGAAGAATTATAGCAATCTGTCATTTTACCTGAAACAGACAAGCCTATGTAT
1761 TATGAATACTTTCAAGCTTCCCTTTGGAATATACAAGACATGCGTTTGGAGTTACCTTTGTTTTTCTATCGTAAATTTAG
1841 ATTCTGGAATTGGGGTTTGGTGGTGCAATGTGTTGCTCACAAGTGGCCAGAACTCCTATTCCTAAAAGGATTTTGAGATG
1921 GAGGAACACATATTTAATTCCCCTTTATGCCTTGGTTCTTGCTCCTCTTTCCACGTTGGATAACAATTTTTTGGTTGTTT
2001 TGTTTAAGTTGGTGCTCTGAAGCTTAATCTCAGTACCCTTTACTCTGAATTGTCAAATTTTGATAAAACGTGCCATTTTC
2081 TTTGGTAAGAGAAAGCAGGTCTTAATGTCTGCCAGAACACAATTTATATGCCTTATTGGCTTCATTAAACTTTTAGAAAA
2161 CTTTAGCATTTGTTACTTTTTTCCATTGCATTTACTTTCAAATGCACCTAATGAATTTGTCACCCAGTCGCAACTTTTCC
2241 CTTCTCTGTCCCATTGCTTTCTCCTTTCCCCGACGCACAGAATAAACATGAAGCTCAGCAGTAGAAGCGTAATGATTTCC
2321 CTCAGGAAAAACTTCTGACAGCTAGGTTTTTCAAGGGTTTCCCTGTGCTAGCTGAGATGCAAAACAAATCATGGAAGATT
2401 GCATACCTGTGTGGTATTTTAAAAACAAGTTGACTTTTTCAGTTTCTTGAACGGTTAAGGGTGGATTTAAAAACTAGACA
2481 GTTTAGTTTTGGGGAACAGAAGCTCTCTTCGTCTTAAGCCAGATTCTCTGATTCTTTTAGACGTCATAGCTCCTTAGTTC
2561 TGCTCCTGTCGCCCTAACTTGGCATGGGCAAGTTGAAGTTCATCCTTAGACTGCAGCGTTCTGAGCATGGCTGAAGTATT
2641 AAAATGTTTAATATTTTTTAGAGCAAAATTGATGGAAAGCATTTGGCTGAATCTAAAGACCTGCAGTCAGATTCTTCAAT
2721 GTGGTTTACCCAACTGGAGTAGTGATAAACACCTTAATCATAAAATGAATAAAAACAAAAAAACCAAAAAAAAAAAAAAA
2801 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGU-UUGGUAAUACACGACGAu 5'
            || | |||  |  ||||||| 
Target 5' ttCACACCCACCA--TGCTGCTt 3'
13 - 33 148.00 -16.70
2
miRNA  3' guguuugguaaUACACGACGAu 5'
                     |||||:|||| 
Target 5' ttggtggtgcaATGTGTTGCTc 3'
1857 - 1878 139.00 -12.00
3
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ||||| | ||| ||| 
Target 5' tggcttCCATT-TTTGCAGCTg 3'
439 - 459 127.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13698646 8 COSMIC
COSN31582953 13 COSMIC
COSN30106561 52 COSMIC
COSN13698655 65 COSMIC
COSN30183986 84 COSMIC
COSN31572844 85 COSMIC
COSN30188567 88 COSMIC
COSN30531065 118 COSMIC
COSN1712609 278 COSMIC
COSN31568910 300 COSMIC
COSN20112595 362 COSMIC
COSN31559549 362 COSMIC
COSN19664018 363 COSMIC
COSN1712610 492 COSMIC
COSN26639099 591 COSMIC
COSN16747995 688 COSMIC
COSN31487102 693 COSMIC
COSN8239859 753 COSMIC
COSN31483544 1527 COSMIC
COSN26565776 1535 COSMIC
COSN31551663 1600 COSMIC
COSN26047976 1641 COSMIC
COSN4768154 1687 COSMIC
COSN9446481 1763 COSMIC
COSN26602547 1995 COSMIC
COSN26586126 2023 COSMIC
COSN22748614 2063 COSMIC
COSN15978134 2097 COSMIC
COSN19543036 2183 COSMIC
COSN19660118 2219 COSMIC
COSN31553352 2231 COSMIC
COSN28201873 2288 COSMIC
COSN27996856 2327 COSMIC
COSN25862160 2576 COSMIC
COSN22149259 3391 COSMIC
COSN29701679 3659 COSMIC
COSN24661015 3660 COSMIC
COSN9446482 3846 COSMIC
COSN16116470 4210 COSMIC
COSN21694418 4540 COSMIC
rs3743832 3112 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1208202295 3 dbSNP
rs1023428811 5 dbSNP
rs756286069 6 dbSNP
rs1178549239 7 dbSNP
rs542361654 8 dbSNP
rs1456272799 10 dbSNP
rs1159212564 13 dbSNP
rs1487066668 14 dbSNP
rs1346607033 16 dbSNP
rs375766819 17 dbSNP
rs1241259180 18 dbSNP
rs1292574935 23 dbSNP
rs770995553 24 dbSNP
rs775458912 29 dbSNP
rs369950722 31 dbSNP
rs768652882 36 dbSNP
rs560529525 39 dbSNP
rs367800836 40 dbSNP
rs1050201512 41 dbSNP
rs1400675248 43 dbSNP
rs772411778 48 dbSNP
rs909567027 49 dbSNP
rs764767951 51 dbSNP
rs1266229015 52 dbSNP
rs1488714311 53 dbSNP
rs1453845415 54 dbSNP
rs942431799 55 dbSNP
rs1185380543 56 dbSNP
rs745342949 56 dbSNP
rs1258016404 57 dbSNP
rs1192176339 59 dbSNP
rs1252907179 60 dbSNP
rs187368949 63 dbSNP
rs774420951 85 dbSNP
rs746033851 87 dbSNP
rs933480361 90 dbSNP
rs1272573714 93 dbSNP
rs1174599135 95 dbSNP
rs1013218022 103 dbSNP
rs1051959828 105 dbSNP
rs1285204009 118 dbSNP
rs1400314005 125 dbSNP
rs372727157 126 dbSNP
rs1430443234 127 dbSNP
rs1325269927 130 dbSNP
rs1320851155 131 dbSNP
rs77646951 143 dbSNP
rs757584477 147 dbSNP
rs1393142973 148 dbSNP
rs905441129 154 dbSNP
rs1002479559 156 dbSNP
rs531630853 157 dbSNP
rs1167181882 160 dbSNP
rs1286350897 170 dbSNP
rs952887739 171 dbSNP
rs190784306 182 dbSNP
rs999791890 183 dbSNP
rs112738663 191 dbSNP
rs1004792766 194 dbSNP
rs1342442924 199 dbSNP
rs1053762530 201 dbSNP
rs1337292617 203 dbSNP
rs1290850661 205 dbSNP
rs781634746 208 dbSNP
rs1253015050 216 dbSNP
rs1337883919 220 dbSNP
rs965882063 222 dbSNP
rs1484227880 225 dbSNP
rs1012298915 226 dbSNP
rs1024131642 235 dbSNP
rs1394494505 243 dbSNP
rs953285720 244 dbSNP
rs1407806772 245 dbSNP
rs970859733 247 dbSNP
rs371246520 249 dbSNP
rs776254048 250 dbSNP
rs1453773401 255 dbSNP
rs985980015 259 dbSNP
rs925218913 267 dbSNP
rs1169447699 268 dbSNP
rs936476503 275 dbSNP
rs1436265475 277 dbSNP
rs568392112 279 dbSNP
rs1052704532 282 dbSNP
rs1003783729 285 dbSNP
rs1347876652 287 dbSNP
rs1025464616 288 dbSNP
rs761641530 293 dbSNP
rs913642338 293 dbSNP
rs797013831 295 dbSNP
rs984003743 297 dbSNP
rs909526159 299 dbSNP
rs963671803 301 dbSNP
rs1387212850 304 dbSNP
rs1490016207 306 dbSNP
rs767368834 311 dbSNP
rs975132443 323 dbSNP
rs1302807666 326 dbSNP
rs535390675 333 dbSNP
rs553894161 342 dbSNP
rs1233174466 344 dbSNP
rs1176671817 349 dbSNP
rs1201999370 349 dbSNP
rs1234813531 349 dbSNP
rs34120073 349 dbSNP
rs933791632 351 dbSNP
rs1485558723 356 dbSNP
rs1213679074 359 dbSNP
rs1283003643 362 dbSNP
rs565754947 362 dbSNP
rs1344837471 363 dbSNP
rs888704947 364 dbSNP
rs1251049880 365 dbSNP
rs1489093859 366 dbSNP
rs1212107875 367 dbSNP
rs924109451 371 dbSNP
rs1453842185 373 dbSNP
rs147377331 375 dbSNP
rs1314458304 377 dbSNP
rs965475970 379 dbSNP
rs1392244531 381 dbSNP
rs1447826542 386 dbSNP
rs1054053182 392 dbSNP
rs1168067038 394 dbSNP
rs1399029566 397 dbSNP
rs557920234 399 dbSNP
rs1012643812 401 dbSNP
rs1183189549 403 dbSNP
rs1045110492 409 dbSNP
rs954020478 410 dbSNP
rs576095365 412 dbSNP
rs549536444 416 dbSNP
rs925188673 424 dbSNP
rs1003637420 426 dbSNP
rs1025390785 432 dbSNP
rs951233541 434 dbSNP
rs773271402 443 dbSNP
rs1294968117 455 dbSNP
rs1396392777 461 dbSNP
rs1360933363 463 dbSNP
rs1287061608 464 dbSNP
rs1432752220 470 dbSNP
rs1390966532 471 dbSNP
rs1159960686 476 dbSNP
rs73495965 479 dbSNP
rs1415938622 480 dbSNP
rs1167432993 483 dbSNP
rs575035564 485 dbSNP
rs1261397396 486 dbSNP
rs1185305704 492 dbSNP
rs1487112490 494 dbSNP
rs949150605 496 dbSNP
rs1475302031 499 dbSNP
rs772495076 508 dbSNP
rs1212364924 512 dbSNP
rs762986800 513 dbSNP
rs748982904 514 dbSNP
rs926362704 518 dbSNP
rs765927112 523 dbSNP
rs975479169 524 dbSNP
rs1224486648 525 dbSNP
rs11537633 527 dbSNP
rs759221109 539 dbSNP
rs1321368865 541 dbSNP
rs1048125330 542 dbSNP
rs1295514966 544 dbSNP
rs1468140476 547 dbSNP
rs1168752512 561 dbSNP
rs1451944133 564 dbSNP
rs1391325212 565 dbSNP
rs977188530 580 dbSNP
rs1193488215 588 dbSNP
rs1209458038 594 dbSNP
rs753408602 599 dbSNP
rs924078207 602 dbSNP
rs114410428 605 dbSNP
rs989671495 612 dbSNP
rs527909444 621 dbSNP
rs1206339668 626 dbSNP
rs545877301 631 dbSNP
rs901311205 635 dbSNP
rs1368895093 640 dbSNP
rs767166521 642 dbSNP
rs948362420 644 dbSNP
rs1045436650 648 dbSNP
rs1387602238 649 dbSNP
rs1396026987 657 dbSNP
rs1460802921 663 dbSNP
rs998324993 664 dbSNP
rs1432026656 666 dbSNP
rs906535461 669 dbSNP
rs1173587783 675 dbSNP
rs1428237318 675 dbSNP
rs1453076354 689 dbSNP
rs1287897590 693 dbSNP
rs939406019 694 dbSNP
rs1378901327 696 dbSNP
rs564282751 697 dbSNP
rs1047145850 698 dbSNP
rs887218026 700 dbSNP
rs1380438964 704 dbSNP
rs1418204694 709 dbSNP
rs1230378225 716 dbSNP
rs1005340590 725 dbSNP
rs1247972924 727 dbSNP
rs1000142569 732 dbSNP
rs1016759501 736 dbSNP
rs1279276912 737 dbSNP
rs1208674273 738 dbSNP
rs1349923767 739 dbSNP
rs957961222 741 dbSNP
rs1234053986 744 dbSNP
rs1291759748 747 dbSNP
rs1335182250 748 dbSNP
rs756740143 749 dbSNP
rs1229510163 750 dbSNP
rs531596028 753 dbSNP
rs1351523438 754 dbSNP
rs796160928 755 dbSNP
rs1029719436 757 dbSNP
rs76671587 759 dbSNP
rs1172723507 760 dbSNP
rs1452433443 763 dbSNP
rs778064387 764 dbSNP
rs1198874425 769 dbSNP
rs1361498240 770 dbSNP
rs1031407569 777 dbSNP
rs1215386019 780 dbSNP
rs779439643 783 dbSNP
rs1185498398 785 dbSNP
rs1483487411 787 dbSNP
rs548616292 791 dbSNP
rs957147779 794 dbSNP
rs970508985 797 dbSNP
rs754278122 798 dbSNP
rs576422003 801 dbSNP
rs1255051620 809 dbSNP
rs915418972 812 dbSNP
rs1266272951 819 dbSNP
rs937785364 824 dbSNP
rs75211213 825 dbSNP
rs78460255 827 dbSNP
rs1335465411 844 dbSNP
rs1382103593 854 dbSNP
rs750956150 857 dbSNP
rs981063362 858 dbSNP
rs1382176079 860 dbSNP
rs140815827 860 dbSNP
rs372010736 860 dbSNP
rs1457485769 863 dbSNP
rs199550457 863 dbSNP
rs1037663454 868 dbSNP
rs1473665311 876 dbSNP
rs1368784078 881 dbSNP
rs1192423020 883 dbSNP
rs901425425 889 dbSNP
rs76672820 891 dbSNP
rs35653566 892 dbSNP
rs34936649 903 dbSNP
rs1210658778 905 dbSNP
rs1272787003 907 dbSNP
rs1359397862 907 dbSNP
rs1226764749 916 dbSNP
rs374832384 917 dbSNP
rs745978856 924 dbSNP
rs1047094309 931 dbSNP
rs1227393029 932 dbSNP
rs1363613703 932 dbSNP
rs1322037847 933 dbSNP
rs887187291 938 dbSNP
rs1435196424 943 dbSNP
rs889864651 944 dbSNP
rs1000259096 948 dbSNP
rs1033001298 951 dbSNP
rs1391242812 952 dbSNP
rs117365660 955 dbSNP
rs1474420889 963 dbSNP
rs539682818 967 dbSNP
rs8052104 971 dbSNP
rs1450180135 976 dbSNP
rs899684605 981 dbSNP
rs569720901 983 dbSNP
rs1453511913 987 dbSNP
rs78634953 987 dbSNP
rs537152890 990 dbSNP
rs1195574113 993 dbSNP
rs1279350968 994 dbSNP
rs970667676 999 dbSNP
rs1229730209 1010 dbSNP
rs1369650821 1013 dbSNP
rs780304648 1014 dbSNP
rs555307713 1019 dbSNP
rs1033537874 1020 dbSNP
rs1350098935 1023 dbSNP
rs1328014609 1026 dbSNP
rs188077824 1027 dbSNP
rs1372111761 1028 dbSNP
rs1277947109 1030 dbSNP
rs891060895 1033 dbSNP
rs536126215 1037 dbSNP
rs190365766 1042 dbSNP
rs961293032 1043 dbSNP
rs1479161181 1046 dbSNP
rs1247504112 1049 dbSNP
rs972431828 1050 dbSNP
rs1482292471 1051 dbSNP
rs922848653 1056 dbSNP
rs1182898139 1058 dbSNP
rs1206553776 1060 dbSNP
rs998518875 1068 dbSNP
rs1031375040 1069 dbSNP
rs1275969101 1074 dbSNP
rs1220450904 1076 dbSNP
rs552055475 1081 dbSNP
rs1278602839 1090 dbSNP
rs182625696 1096 dbSNP
rs936186969 1097 dbSNP
rs1171340955 1100 dbSNP
rs1022860819 1101 dbSNP
rs969595457 1102 dbSNP
rs1054924303 1103 dbSNP
rs1416258003 1104 dbSNP
rs981374891 1114 dbSNP
rs928237137 1115 dbSNP
rs1158243006 1120 dbSNP
rs1430800387 1124 dbSNP
rs960980999 1128 dbSNP
rs564346124 1130 dbSNP
rs1045771015 1132 dbSNP
rs1334522422 1144 dbSNP
rs576089756 1148 dbSNP
rs1312285925 1149 dbSNP
rs543527568 1150 dbSNP
rs1226228197 1151 dbSNP
rs1033611475 1153 dbSNP
rs562088527 1156 dbSNP
rs1232450747 1157 dbSNP
rs1376611310 1160 dbSNP
rs1304538609 1169 dbSNP
rs1005385075 1172 dbSNP
rs1017059078 1173 dbSNP
rs1319947168 1178 dbSNP
rs1455903389 1179 dbSNP
rs941427102 1186 dbSNP
rs1160100497 1191 dbSNP
rs1369752421 1192 dbSNP
rs1423613274 1193 dbSNP
rs777282769 1199 dbSNP
rs187660249 1201 dbSNP
rs1483844699 1203 dbSNP
rs771019517 1208 dbSNP
rs972805398 1211 dbSNP
rs547658304 1213 dbSNP
rs1206267883 1214 dbSNP
rs922294594 1218 dbSNP
rs770588312 1222 dbSNP
rs1268372693 1225 dbSNP
rs1205628593 1229 dbSNP
rs879096934 1232 dbSNP
rs1319737982 1235 dbSNP
rs1314572863 1243 dbSNP
rs559431694 1244 dbSNP
rs1051408269 1245 dbSNP
rs1361173710 1247 dbSNP
rs1274777971 1254 dbSNP
rs13543 1255 dbSNP
rs998778939 1257 dbSNP
rs1432999693 1258 dbSNP
rs985648252 1258 dbSNP
rs533266616 1261 dbSNP
rs1321491378 1265 dbSNP
rs936134079 1267 dbSNP
rs865778720 1268 dbSNP
rs1054663744 1274 dbSNP
rs913305013 1276 dbSNP
rs774470882 1284 dbSNP
rs1045751201 1292 dbSNP
rs1212727999 1302 dbSNP
rs907174884 1302 dbSNP
rs769072796 1306 dbSNP
rs1267055914 1309 dbSNP
rs74861452 1316 dbSNP
rs766993056 1317 dbSNP
rs569881068 1318 dbSNP
rs781550749 1318 dbSNP
rs892824017 1320 dbSNP
rs1011300385 1322 dbSNP
rs1367475420 1323 dbSNP
rs759373261 1324 dbSNP
rs557571023 1326 dbSNP
rs1365738143 1336 dbSNP
rs895068892 1339 dbSNP
rs1458737657 1340 dbSNP
rs537114015 1345 dbSNP
rs1167301059 1347 dbSNP
rs1170881960 1352 dbSNP
rs1432138974 1352 dbSNP
rs138039181 1355 dbSNP
rs1035607674 1363 dbSNP
rs536739128 1368 dbSNP
rs983015539 1393 dbSNP
rs1431162565 1398 dbSNP
rs149452835 1401 dbSNP
rs534361441 1403 dbSNP
rs974505344 1406 dbSNP
rs754224763 1408 dbSNP
rs554444322 1411 dbSNP
rs572359372 1413 dbSNP
rs912401327 1414 dbSNP
rs1342754169 1415 dbSNP
rs1230839854 1426 dbSNP
rs539756949 1429 dbSNP
rs1232616295 1441 dbSNP
rs934540437 1443 dbSNP
rs1337179321 1446 dbSNP
rs1303693565 1449 dbSNP
rs1053035246 1457 dbSNP
rs1306538799 1461 dbSNP
rs1350298989 1461 dbSNP
rs1412288857 1464 dbSNP
rs557898500 1467 dbSNP
rs1290498726 1468 dbSNP
rs893086585 1472 dbSNP
rs1211292602 1477 dbSNP
rs1011220865 1493 dbSNP
rs1044490878 1499 dbSNP
rs1176380225 1511 dbSNP
rs1251761045 1514 dbSNP
rs1465090463 1518 dbSNP
rs1194812361 1522 dbSNP
rs73495968 1524 dbSNP
rs1003040153 1527 dbSNP
rs1184060035 1537 dbSNP
rs878996327 1545 dbSNP
rs1420674181 1547 dbSNP
rs1255390170 1548 dbSNP
rs1460278195 1553 dbSNP
rs35494642 1553 dbSNP
rs1325345274 1555 dbSNP
rs183903688 1562 dbSNP
rs1437610735 1563 dbSNP
rs1257804970 1566 dbSNP
rs1234305725 1567 dbSNP
rs553131738 1568 dbSNP
rs562079622 1572 dbSNP
rs1328738793 1574 dbSNP
rs188894009 1583 dbSNP
rs773377849 1587 dbSNP
rs573199186 1588 dbSNP
rs1351429358 1589 dbSNP
rs56154228 1593 dbSNP
rs1336859457 1597 dbSNP
rs962971103 1598 dbSNP
rs1403766267 1599 dbSNP
rs1231337162 1603 dbSNP
rs1409302278 1609 dbSNP
rs1272010337 1613 dbSNP
rs928710081 1615 dbSNP
rs1329209097 1616 dbSNP
rs1185368798 1626 dbSNP
rs974092836 1629 dbSNP
rs1028749957 1631 dbSNP
rs1444045305 1635 dbSNP
rs937288305 1642 dbSNP
rs1206565352 1650 dbSNP
rs564426772 1653 dbSNP
rs954114527 1655 dbSNP
rs1446010816 1656 dbSNP
rs1210775146 1663 dbSNP
rs1055836659 1665 dbSNP
rs1283945635 1672 dbSNP
rs1188690464 1674 dbSNP
rs559706246 1675 dbSNP
rs1433717885 1676 dbSNP
rs1385732729 1679 dbSNP
rs750981838 1681 dbSNP
rs912368799 1683 dbSNP
rs1474527628 1686 dbSNP
rs758495559 1688 dbSNP
rs988665331 1696 dbSNP
rs192382060 1701 dbSNP
rs1271531237 1710 dbSNP
rs143879237 1711 dbSNP
rs1389808427 1718 dbSNP
rs1038597116 1720 dbSNP
rs1473774844 1721 dbSNP
rs563450396 1725 dbSNP
rs747193576 1728 dbSNP
rs994424743 1733 dbSNP
rs1029329346 1738 dbSNP
rs1190798101 1739 dbSNP
rs1384541990 1743 dbSNP
rs1044030216 1744 dbSNP
rs942159385 1749 dbSNP
rs905545427 1755 dbSNP
rs1362250745 1756 dbSNP
rs1289682462 1758 dbSNP
rs1208424309 1761 dbSNP
rs1358826284 1762 dbSNP
rs1293155185 1767 dbSNP
rs890910676 1773 dbSNP
rs372135210 1780 dbSNP
rs938417745 1783 dbSNP
rs1334604233 1798 dbSNP
rs1431086420 1799 dbSNP
rs1357072532 1803 dbSNP
rs1321100695 1804 dbSNP
rs1406892812 1805 dbSNP
rs1391124954 1812 dbSNP
rs1017919761 1814 dbSNP
rs771838162 1814 dbSNP
rs1427713052 1817 dbSNP
rs1292562362 1826 dbSNP
rs184337847 1829 dbSNP
rs1240582416 1830 dbSNP
rs188063428 1831 dbSNP
rs1349548326 1832 dbSNP
rs1453706870 1842 dbSNP
rs567297160 1845 dbSNP
rs1200632506 1850 dbSNP
rs1004335201 1856 dbSNP
rs1205124973 1857 dbSNP
rs528194439 1861 dbSNP
rs1020976061 1862 dbSNP
rs1340643633 1865 dbSNP
rs1015748865 1869 dbSNP
rs1343601097 1870 dbSNP
rs898716651 1876 dbSNP
rs928693878 1877 dbSNP
rs937445358 1879 dbSNP
rs1407980213 1881 dbSNP
rs1372320833 1882 dbSNP
rs1169063046 1884 dbSNP
rs1410614711 1888 dbSNP
rs996163795 1894 dbSNP
rs764229553 1896 dbSNP
rs1479111315 1898 dbSNP
rs1484877928 1899 dbSNP
rs1430488211 1900 dbSNP
rs1181905483 1903 dbSNP
rs1187957869 1909 dbSNP
rs1482240149 1909 dbSNP
rs751692523 1918 dbSNP
rs749056437 1922 dbSNP
rs1275861011 1924 dbSNP
rs1220649006 1930 dbSNP
rs909241573 1930 dbSNP
rs942038010 1931 dbSNP
rs1038266449 1938 dbSNP
rs1298698794 1944 dbSNP
rs897065863 1946 dbSNP
rs1179753096 1949 dbSNP
rs929777592 1950 dbSNP
rs1332247301 1952 dbSNP
rs954197145 1961 dbSNP
rs1430251558 1962 dbSNP
rs1050925018 1963 dbSNP
rs986847067 1964 dbSNP
rs546240265 1972 dbSNP
rs776839299 1975 dbSNP
rs1178327989 1976 dbSNP
rs375418401 1979 dbSNP
rs774416138 1980 dbSNP
rs1235305082 1981 dbSNP
rs1175730895 1986 dbSNP
rs563140048 1987 dbSNP
rs1461321264 1989 dbSNP
rs1206381179 1994 dbSNP
rs1267115657 1994 dbSNP
rs1377080932 1995 dbSNP
rs1330986377 1997 dbSNP
rs1432622481 1998 dbSNP
rs191820293 2004 dbSNP
rs1376867791 2007 dbSNP
rs1289004270 2009 dbSNP
rs1397134611 2018 dbSNP
rs1006625762 2028 dbSNP
rs1018455211 2032 dbSNP
rs183946008 2036 dbSNP
rs1320181434 2041 dbSNP
rs1455816214 2050 dbSNP
rs1347368870 2051 dbSNP
rs1304265588 2054 dbSNP
rs988632897 2061 dbSNP
rs1011662959 2069 dbSNP
rs1020503625 2070 dbSNP
rs1305170706 2071 dbSNP
rs1444738192 2075 dbSNP
rs569903920 2088 dbSNP
rs1246830918 2099 dbSNP
rs1186324297 2100 dbSNP
rs1465956747 2104 dbSNP
rs1261152436 2105 dbSNP
rs914413863 2116 dbSNP
rs947302217 2121 dbSNP
rs1319639986 2122 dbSNP
rs1291967190 2123 dbSNP
rs1003037680 2124 dbSNP
rs1296942770 2125 dbSNP
rs1383674711 2125 dbSNP
rs1210635103 2131 dbSNP
rs1275711129 2133 dbSNP
rs980442084 2137 dbSNP
rs1364351178 2142 dbSNP
rs927262694 2145 dbSNP
rs1436219718 2147 dbSNP
rs1481924871 2151 dbSNP
rs1348447747 2154 dbSNP
rs938330524 2158 dbSNP
rs369851816 2159 dbSNP
rs1194534712 2160 dbSNP
rs1425810867 2163 dbSNP
rs1056763386 2165 dbSNP
rs1433808747 2167 dbSNP
rs1195804239 2169 dbSNP
rs1393484023 2176 dbSNP
rs1453941838 2177 dbSNP
rs886181968 2178 dbSNP
rs940451137 2181 dbSNP
rs1487401429 2186 dbSNP
rs745857944 2188 dbSNP
rs1037121487 2189 dbSNP
rs1248213316 2190 dbSNP
rs960123 2191 dbSNP
rs1274102342 2195 dbSNP
rs1373388559 2200 dbSNP
rs1463510199 2202 dbSNP
rs1296350224 2203 dbSNP
rs909306356 2205 dbSNP
rs963370548 2207 dbSNP
rs1365977232 2212 dbSNP
rs555927728 2214 dbSNP
rs1048687 2219 dbSNP
rs890065947 2220 dbSNP
rs1373114554 2223 dbSNP
rs1174966412 2229 dbSNP
rs1296769638 2230 dbSNP
rs1008226749 2231 dbSNP
rs1050872763 2233 dbSNP
rs1019658009 2235 dbSNP
rs1249542385 2242 dbSNP
rs559139738 2246 dbSNP
rs956071273 2247 dbSNP
rs541529728 2252 dbSNP
rs1010346178 2257 dbSNP
rs1197432330 2258 dbSNP
rs1021440847 2262 dbSNP
rs1251931665 2268 dbSNP
rs1481675309 2268 dbSNP
rs1225923463 2270 dbSNP
rs370030244 2271 dbSNP
rs942557944 2272 dbSNP
rs189111738 2273 dbSNP
rs545306663 2274 dbSNP
rs563616182 2275 dbSNP
rs1468224075 2276 dbSNP
rs1393616900 2277 dbSNP
rs530729674 2285 dbSNP
rs760327299 2289 dbSNP
rs940421343 2292 dbSNP
rs1003153891 2299 dbSNP
rs1372446512 2300 dbSNP
rs1409434349 2301 dbSNP
rs1183949785 2303 dbSNP
rs1419575213 2304 dbSNP
rs1199936435 2310 dbSNP
rs1251405910 2310 dbSNP
rs1461836690 2314 dbSNP
rs1459983838 2327 dbSNP
rs1037424925 2329 dbSNP
rs763768693 2330 dbSNP
rs1204505543 2332 dbSNP
rs1166506611 2333 dbSNP
rs920386081 2336 dbSNP
rs542411259 2337 dbSNP
rs958836021 2338 dbSNP
rs776306519 2339 dbSNP
rs890025167 2340 dbSNP
rs762148189 2350 dbSNP
rs1041046108 2358 dbSNP
rs561148113 2369 dbSNP
rs181605820 2373 dbSNP
rs559365255 2374 dbSNP
rs1337013227 2379 dbSNP
rs1380870929 2385 dbSNP
rs1295228319 2386 dbSNP
rs373227496 2389 dbSNP
rs1386243324 2393 dbSNP
rs1160071013 2399 dbSNP
rs1454306200 2401 dbSNP
rs1057125697 2408 dbSNP
rs750938757 2413 dbSNP
rs115683539 2429 dbSNP
rs1185252982 2434 dbSNP
rs1442889466 2436 dbSNP
rs753460071 2438 dbSNP
rs1245013330 2440 dbSNP
rs1235630380 2449 dbSNP
rs1464604067 2453 dbSNP
rs187201907 2454 dbSNP
rs1207268388 2474 dbSNP
rs919281036 2477 dbSNP
rs1001767363 2485 dbSNP
rs1244362024 2487 dbSNP
rs1209672410 2488 dbSNP
rs1361020246 2490 dbSNP
rs1315107825 2492 dbSNP
rs1433977862 2495 dbSNP
rs1362573685 2497 dbSNP
rs1319805539 2504 dbSNP
rs1244046820 2506 dbSNP
rs1382584187 2508 dbSNP
rs532018680 2511 dbSNP
rs551653442 2512 dbSNP
rs912484220 2514 dbSNP
rs1387224921 2519 dbSNP
rs992721721 2520 dbSNP
rs942505282 2527 dbSNP
rs1240588828 2528 dbSNP
rs1195529322 2529 dbSNP
rs1267076906 2532 dbSNP
rs1447972797 2532 dbSNP
rs79581216 2534 dbSNP
rs907518675 2535 dbSNP
rs1415074199 2536 dbSNP
rs947146922 2538 dbSNP
rs1460459687 2540 dbSNP
rs1336814430 2541 dbSNP
rs766430703 2543 dbSNP
rs973065276 2544 dbSNP
rs537755967 2546 dbSNP
rs1366118248 2550 dbSNP
rs902823836 2562 dbSNP
rs751619984 2563 dbSNP
rs377083587 2564 dbSNP
rs1169913352 2567 dbSNP
rs931781860 2571 dbSNP
rs1197712117 2572 dbSNP
rs1050315602 2575 dbSNP
rs911414620 2577 dbSNP
rs1490924380 2579 dbSNP
rs1270254359 2582 dbSNP
rs944245502 2584 dbSNP
rs1041307384 2588 dbSNP
rs1274469991 2592 dbSNP
rs1196074728 2602 dbSNP
rs755145180 2602 dbSNP
rs1013078351 2603 dbSNP
rs1280895070 2604 dbSNP
rs946029537 2612 dbSNP
rs1291979378 2613 dbSNP
rs1225126840 2614 dbSNP
rs1043097632 2618 dbSNP
rs781538345 2619 dbSNP
rs1016868051 2622 dbSNP
rs904573396 2625 dbSNP
rs1286352080 2627 dbSNP
rs748437472 2628 dbSNP
rs1330965722 2638 dbSNP
rs1315387952 2641 dbSNP
rs993959400 2641 dbSNP
rs1215268799 2643 dbSNP
rs6777 2651 dbSNP
rs1481636675 2653 dbSNP
rs567870959 2656 dbSNP
rs1485858050 2661 dbSNP
rs954669859 2662 dbSNP
rs987439253 2665 dbSNP
rs778854307 2670 dbSNP
rs7188669 2673 dbSNP
rs1260888092 2682 dbSNP
rs961972795 2687 dbSNP
rs1205126144 2694 dbSNP
rs1324048144 2699 dbSNP
rs376662525 2702 dbSNP
rs771927674 2705 dbSNP
rs775026118 2707 dbSNP
rs1177276823 2710 dbSNP
rs1375442616 2717 dbSNP
rs370691852 2720 dbSNP
rs1409475510 2725 dbSNP
rs79190418 2743 dbSNP
rs76826467 2744 dbSNP
rs953206684 2745 dbSNP
rs571939812 2752 dbSNP
rs977552691 2762 dbSNP
rs866349418 2768 dbSNP
rs911660902 2776 dbSNP
rs1407374814 2777 dbSNP
rs578063430 2778 dbSNP
rs944170990 2783 dbSNP
rs1436954903 2785 dbSNP
rs142223578 2787 dbSNP
rs557395555 2790 dbSNP
rs575409399 2798 dbSNP
rs946289799 2801 dbSNP
rs542926272 2802 dbSNP
rs1185108313 2803 dbSNP
rs894726959 2806 dbSNP
rs1247261683 2811 dbSNP
rs1213392633 2830 dbSNP
rs1318444711 2834 dbSNP
rs761524277 2836 dbSNP
rs1227635330 2840 dbSNP
rs1371245494 2840 dbSNP
rs1312994998 2842 dbSNP
rs560894907 2844 dbSNP
rs1454844668 2846 dbSNP
rs765522257 2848 dbSNP
rs1304432913 2854 dbSNP
rs1429085754 2857 dbSNP
rs1055871060 2858 dbSNP
rs551240726 2859 dbSNP
rs899304485 2861 dbSNP
rs1382920508 2865 dbSNP
rs993682345 2865 dbSNP
rs573023996 2866 dbSNP
rs1444645580 2868 dbSNP
rs1014038513 2872 dbSNP
rs1008847799 2877 dbSNP
rs1242457053 2879 dbSNP
rs1014742498 2887 dbSNP
rs1234155796 2888 dbSNP
rs1489838192 2889 dbSNP
rs539926728 2893 dbSNP
rs1293770068 2899 dbSNP
rs190536025 2906 dbSNP
rs763473944 2921 dbSNP
rs766761190 2922 dbSNP
rs567849505 2924 dbSNP
rs1295162865 2925 dbSNP
rs1027707015 2927 dbSNP
rs963983875 2930 dbSNP
rs1289807247 2936 dbSNP
rs975709583 2937 dbSNP
rs1364259783 2940 dbSNP
rs1424773663 2944 dbSNP
rs1446535979 2947 dbSNP
rs1371958885 2962 dbSNP
rs532077421 2963 dbSNP
rs1167931911 2964 dbSNP
rs1429905835 2965 dbSNP
rs1420047219 2972 dbSNP
rs752152782 2975 dbSNP
rs986226398 2980 dbSNP
rs550118895 2988 dbSNP
rs968919208 2989 dbSNP
rs965819666 2991 dbSNP
rs755095878 2997 dbSNP
rs977262030 3000 dbSNP
rs924349800 3004 dbSNP
rs1411062965 3005 dbSNP
rs767771157 3007 dbSNP
rs938451114 3010 dbSNP
rs913406864 3012 dbSNP
rs992480807 3014 dbSNP
rs1223297715 3015 dbSNP
rs780420472 3016 dbSNP
rs1352903677 3017 dbSNP
rs562158173 3021 dbSNP
rs1441548309 3022 dbSNP
rs946268798 3023 dbSNP
rs1395206803 3024 dbSNP
rs1373471249 3026 dbSNP
rs979049162 3038 dbSNP
rs1463012352 3041 dbSNP
rs926225313 3043 dbSNP
rs937339377 3044 dbSNP
rs1468065654 3048 dbSNP
rs1056237665 3049 dbSNP
rs917322377 3052 dbSNP
rs950143000 3053 dbSNP
rs1036113996 3061 dbSNP
rs1343996736 3067 dbSNP
rs115847270 3068 dbSNP
rs1175565060 3076 dbSNP
rs995109044 3078 dbSNP
rs549677160 3080 dbSNP
rs929454662 3087 dbSNP
rs889073242 3096 dbSNP
rs756416086 3097 dbSNP
rs1224726356 3100 dbSNP
rs1435949767 3102 dbSNP
rs1007218726 3103 dbSNP
rs890519771 3108 dbSNP
rs3743832 3112 dbSNP
rs965747677 3113 dbSNP
rs745682149 3117 dbSNP
rs1020435645 3122 dbSNP
rs900479585 3127 dbSNP
rs758254138 3129 dbSNP
rs535261238 3133 dbSNP
rs979363107 3134 dbSNP
rs1362010367 3135 dbSNP
rs1021928023 3136 dbSNP
rs779834104 3147 dbSNP
rs959245381 3148 dbSNP
rs368619866 3149 dbSNP
rs62033728 3154 dbSNP
rs917248953 3159 dbSNP
rs1031532115 3163 dbSNP
rs950112019 3167 dbSNP
rs959873742 3169 dbSNP
rs992554124 3180 dbSNP
rs1036393143 3184 dbSNP
rs571721707 3188 dbSNP
rs539145890 3189 dbSNP
rs1450090544 3191 dbSNP
rs1384554780 3197 dbSNP
rs930493421 3200 dbSNP
rs1382464943 3201 dbSNP
rs1290603201 3204 dbSNP
rs75768462 3211 dbSNP
rs973125707 3212 dbSNP
rs920840167 3214 dbSNP
rs1442796586 3216 dbSNP
rs889005516 3220 dbSNP
rs1387339953 3222 dbSNP
rs1007892536 3229 dbSNP
rs929581407 3230 dbSNP
rs1040040731 3232 dbSNP
rs1207467525 3239 dbSNP
rs912034687 3249 dbSNP
rs544136271 3253 dbSNP
rs944896338 3257 dbSNP
rs1243160902 3259 dbSNP
rs1360920504 3264 dbSNP
rs1284459118 3266 dbSNP
rs1039057093 3267 dbSNP
rs901523173 3268 dbSNP
rs1320030362 3271 dbSNP
rs1382775945 3274 dbSNP
rs1009265488 3279 dbSNP
rs1020697424 3285 dbSNP
rs1043773703 3302 dbSNP
rs747029945 3308 dbSNP
rs115294175 3309 dbSNP
rs1164099434 3310 dbSNP
rs1000360928 3311 dbSNP
rs139298101 3319 dbSNP
rs1031610620 3320 dbSNP
rs958944322 3323 dbSNP
rs1268829622 3333 dbSNP
rs1478322049 3333 dbSNP
rs1447159436 3334 dbSNP
rs747744573 3343 dbSNP
rs1195781403 3344 dbSNP
rs1490709978 3346 dbSNP
rs991718317 3351 dbSNP
rs1194931854 3353 dbSNP
rs1014103515 3356 dbSNP
rs1271508168 3358 dbSNP
rs1477792288 3362 dbSNP
rs1344591870 3372 dbSNP
rs554885625 3374 dbSNP
rs1420198564 3375 dbSNP
rs969870794 3380 dbSNP
rs971354380 3381 dbSNP
rs1324274280 3385 dbSNP
rs972080468 3387 dbSNP
rs769465817 3388 dbSNP
rs572946567 3390 dbSNP
rs1466500320 3391 dbSNP
rs368014492 3393 dbSNP
rs984602065 3395 dbSNP
rs1197953539 3399 dbSNP
rs573019962 3400 dbSNP
rs1402627471 3402 dbSNP
rs910395782 3403 dbSNP
rs1246851566 3404 dbSNP
rs1180475322 3408 dbSNP
rs1435509986 3409 dbSNP
rs1274713646 3416 dbSNP
rs1198847986 3420 dbSNP
rs539988665 3421 dbSNP
rs1261007397 3422 dbSNP
rs1225341920 3428 dbSNP
rs1040301607 3429 dbSNP
rs1368215890 3432 dbSNP
rs1320073341 3436 dbSNP
rs1441590328 3441 dbSNP
rs901783377 3442 dbSNP
rs945021783 3444 dbSNP
rs1447771897 3450 dbSNP
rs1042109231 3454 dbSNP
rs1293824138 3459 dbSNP
rs903565951 3466 dbSNP
rs1471123242 3468 dbSNP
rs1001023396 3470 dbSNP
rs1033156191 3472 dbSNP
rs944843982 3477 dbSNP
rs772955043 3478 dbSNP
rs763200239 3479 dbSNP
rs1460593331 3485 dbSNP
rs1240805991 3486 dbSNP
rs144122557 3487 dbSNP
rs922008816 3488 dbSNP
rs1283518671 3489 dbSNP
rs1206474187 3496 dbSNP
rs1024511490 3506 dbSNP
rs1221977248 3512 dbSNP
rs770083421 3513 dbSNP
rs576493731 3514 dbSNP
rs1212300831 3518 dbSNP
rs1026736829 3523 dbSNP
rs1382315993 3526 dbSNP
rs902488739 3527 dbSNP
rs1450664389 3530 dbSNP
rs1474474706 3545 dbSNP
rs935321384 3545 dbSNP
rs1399451134 3546 dbSNP
rs952140189 3553 dbSNP
rs985294516 3554 dbSNP
rs910667550 3555 dbSNP
rs1158725916 3559 dbSNP
rs1443414268 3561 dbSNP
rs1052989041 3564 dbSNP
rs774715762 3567 dbSNP
rs1483479845 3569 dbSNP
rs1014092326 3575 dbSNP
rs543923690 3577 dbSNP
rs975951422 3583 dbSNP
rs1448657224 3585 dbSNP
rs1286566819 3593 dbSNP
rs1022818844 3598 dbSNP
rs905594155 3599 dbSNP
rs3842357 3600 dbSNP
rs398028693 3600 dbSNP
rs1027837536 3601 dbSNP
rs1313198779 3602 dbSNP
rs146809856 3617 dbSNP
rs182019683 3619 dbSNP
rs1423483724 3620 dbSNP
rs1166535430 3624 dbSNP
rs1424021000 3626 dbSNP
rs529727673 3631 dbSNP
rs1184566205 3635 dbSNP
rs1476238126 3637 dbSNP
rs1263845169 3638 dbSNP
rs1311416541 3639 dbSNP
rs760123287 3642 dbSNP
rs1240830304 3645 dbSNP
rs1224142192 3648 dbSNP
rs1213200047 3649 dbSNP
rs903533687 3649 dbSNP
rs975297853 3649 dbSNP
rs549402497 3650 dbSNP
rs922153075 3654 dbSNP
rs1352454592 3659 dbSNP
rs1404855657 3659 dbSNP
rs866074978 3663 dbSNP
rs936404120 3664 dbSNP
rs1294775075 3670 dbSNP
rs35734170 3670 dbSNP
rs116680709 3673 dbSNP
rs1167821374 3676 dbSNP
rs1467021873 3679 dbSNP
rs1424043714 3682 dbSNP
rs1282868112 3688 dbSNP
rs1198675532 3697 dbSNP
rs894938773 3698 dbSNP
rs1479412844 3716 dbSNP
rs1269292598 3717 dbSNP
rs1013032782 3726 dbSNP
rs979501808 3727 dbSNP
rs528798140 3729 dbSNP
rs924029150 3731 dbSNP
rs1024437902 3740 dbSNP
rs907427252 3741 dbSNP
rs1251390236 3742 dbSNP
rs772108328 3746 dbSNP
rs935311299 3752 dbSNP
rs993729307 3753 dbSNP
rs895716478 3755 dbSNP
rs1179997529 3757 dbSNP
rs547177066 3760 dbSNP
rs1379928234 3761 dbSNP
rs950023954 3761 dbSNP
rs1044716724 3762 dbSNP
rs1176645987 3762 dbSNP
rs1177072866 3762 dbSNP
rs1203448303 3762 dbSNP
rs1238953045 3762 dbSNP
rs1249880775 3762 dbSNP
rs1285254906 3762 dbSNP
rs1325521627 3762 dbSNP
rs1379317592 3762 dbSNP
rs1400847085 3762 dbSNP
rs1433880055 3762 dbSNP
rs368347324 3762 dbSNP
rs772452731 3762 dbSNP
rs778133054 3762 dbSNP
rs1454820503 3765 dbSNP
rs1026286264 3766 dbSNP
rs1460222229 3768 dbSNP
rs1174063302 3774 dbSNP
rs1234566142 3777 dbSNP
rs1491440090 3783 dbSNP
rs1335609072 3784 dbSNP
rs185456603 3784 dbSNP
rs558866161 3784 dbSNP
rs1232678165 3785 dbSNP
rs1203726400 3786 dbSNP
rs12926744 3786 dbSNP
rs1302159713 3787 dbSNP
rs1303405165 3789 dbSNP
rs1396666565 3790 dbSNP
rs1392641504 3791 dbSNP
rs1328607771 3792 dbSNP
rs1452953794 3793 dbSNP
rs1375733909 3797 dbSNP
rs1441563977 3798 dbSNP
rs1441126962 3799 dbSNP
rs1381176212 3801 dbSNP
rs140516959 3803 dbSNP
rs984831273 3806 dbSNP
rs995084216 3808 dbSNP
rs1018101781 3811 dbSNP
rs1284430329 3812 dbSNP
rs1218190979 3816 dbSNP
rs964823756 3819 dbSNP
rs760562347 3820 dbSNP
rs1346134185 3828 dbSNP
rs1353747457 3829 dbSNP
rs111769155 3830 dbSNP
rs1243289682 3838 dbSNP
rs1342099855 3840 dbSNP
rs551125485 3845 dbSNP
rs886224647 3848 dbSNP
rs1252389555 3849 dbSNP
rs1342010562 3853 dbSNP
rs1299912187 3855 dbSNP
rs1194152672 3857 dbSNP
rs923099974 3861 dbSNP
rs569144669 3867 dbSNP
rs978425767 3879 dbSNP
rs1004503956 3883 dbSNP
rs1471929584 3884 dbSNP
rs1370348072 3887 dbSNP
rs1469091879 3890 dbSNP
rs1428238691 3891 dbSNP
rs1195709327 3892 dbSNP
rs925251048 3893 dbSNP
rs760941117 3896 dbSNP
rs1488358374 3900 dbSNP
rs1254699967 3901 dbSNP
rs1290378126 3901 dbSNP
rs1018590031 3904 dbSNP
rs1358036494 3905 dbSNP
rs1431219297 3906 dbSNP
rs966254299 3912 dbSNP
rs1175021924 3914 dbSNP
rs974994931 3919 dbSNP
rs1373579660 3920 dbSNP
rs936333242 3932 dbSNP
rs1029660578 3947 dbSNP
rs968209860 3952 dbSNP
rs1054834857 3955 dbSNP
rs1403617741 3957 dbSNP
rs1463425586 3958 dbSNP
rs935424373 3959 dbSNP
rs916300208 3965 dbSNP
rs536693517 3969 dbSNP
rs1398898080 3970 dbSNP
rs1478431491 3971 dbSNP
rs1045852851 3980 dbSNP
rs1441234514 3985 dbSNP
rs1327500008 3986 dbSNP
rs917892624 3988 dbSNP
rs907394449 3995 dbSNP
rs993710137 3996 dbSNP
rs1267652309 4002 dbSNP
rs1044283092 4004 dbSNP
rs1315892075 4005 dbSNP
rs1048428762 4006 dbSNP
rs1259741055 4013 dbSNP
rs1218941734 4014 dbSNP
rs1322745863 4019 dbSNP
rs1272949649 4021 dbSNP
rs888073690 4022 dbSNP
rs1332875270 4024 dbSNP
rs1328735528 4029 dbSNP
rs189818164 4034 dbSNP
rs1391024809 4035 dbSNP
rs1257558045 4038 dbSNP
rs1006625699 4045 dbSNP
rs1466416002 4047 dbSNP
rs1171296055 4048 dbSNP
rs1478750308 4052 dbSNP
rs1335514435 4053 dbSNP
rs930487104 4062 dbSNP
rs7185995 4063 dbSNP
rs886172226 4064 dbSNP
rs1239554419 4066 dbSNP
rs1488241910 4067 dbSNP
rs964750615 4068 dbSNP
rs1199059304 4069 dbSNP
rs1004618554 4071 dbSNP
rs1276459961 4073 dbSNP
rs1220851888 4074 dbSNP
rs12927200 4078 dbSNP
rs1190439821 4079 dbSNP
rs754139545 4086 dbSNP
rs1275506988 4087 dbSNP
rs901477113 4092 dbSNP
rs1374974250 4096 dbSNP
rs1030138324 4100 dbSNP
rs577562934 4101 dbSNP
rs1358917366 4102 dbSNP
rs758118679 4104 dbSNP
rs779970528 4105 dbSNP
rs1029238255 4106 dbSNP
rs1422379291 4110 dbSNP
rs776358147 4111 dbSNP
rs1381809052 4112 dbSNP
rs966518579 4118 dbSNP
rs1443830798 4119 dbSNP
rs1235507589 4121 dbSNP
rs977973473 4123 dbSNP
rs925185754 4132 dbSNP
rs1166392739 4133 dbSNP
rs1351549856 4136 dbSNP
rs1031202011 4137 dbSNP
rs761464486 4140 dbSNP
rs957990863 4144 dbSNP
rs990854243 4147 dbSNP
rs751434638 4148 dbSNP
rs916269118 4149 dbSNP
rs558299844 4152 dbSNP
rs1398738867 4158 dbSNP
rs927231775 4159 dbSNP
rs930581181 4160 dbSNP
rs1046118970 4163 dbSNP
rs1356239026 4165 dbSNP
rs1235221305 4170 dbSNP
rs7194891 4172 dbSNP
rs907685418 4179 dbSNP
rs1472976974 4181 dbSNP
rs543886515 4187 dbSNP
rs556263994 4188 dbSNP
rs1487377944 4192 dbSNP
rs780638311 4195 dbSNP
rs887992242 4196 dbSNP
rs548467813 4198 dbSNP
rs1261137149 4202 dbSNP
rs1217713501 4208 dbSNP
rs145195849 4215 dbSNP
rs1214436529 4229 dbSNP
rs1039026943 4231 dbSNP
rs900514337 4232 dbSNP
rs1380306405 4235 dbSNP
rs1262399749 4241 dbSNP
rs559903034 4242 dbSNP
rs1475454509 4243 dbSNP
rs997544963 4245 dbSNP
rs1398679793 4248 dbSNP
rs1030401353 4251 dbSNP
rs769390895 4255 dbSNP
rs1341905544 4262 dbSNP
rs528761498 4266 dbSNP
rs1189478987 4268 dbSNP
rs1435051010 4272 dbSNP
rs1347782502 4276 dbSNP
rs1166421730 4280 dbSNP
rs901623657 4284 dbSNP
rs1168525778 4286 dbSNP
rs777274858 4289 dbSNP
rs1263732661 4290 dbSNP
rs904090130 4295 dbSNP
rs12446666 4297 dbSNP
rs771134601 4298 dbSNP
rs1245241107 4309 dbSNP
rs1224016492 4313 dbSNP
rs1159338901 4318 dbSNP
rs999734650 4320 dbSNP
rs1347383032 4322 dbSNP
rs565457956 4324 dbSNP
rs1297901915 4331 dbSNP
rs1385764927 4333 dbSNP
rs182846006 4334 dbSNP
rs550789594 4335 dbSNP
rs1436733813 4344 dbSNP
rs990765042 4345 dbSNP
rs1399361733 4346 dbSNP
rs1301220813 4347 dbSNP
rs1023537556 4359 dbSNP
rs760070120 4361 dbSNP
rs1175232291 4367 dbSNP
rs146901272 4369 dbSNP
rs952755862 4372 dbSNP
rs12448512 4375 dbSNP
rs1284991691 4383 dbSNP
rs1485968772 4385 dbSNP
rs548527297 4387 dbSNP
rs755500457 4393 dbSNP
rs1459340189 4395 dbSNP
rs12447788 4397 dbSNP
rs1482640905 4400 dbSNP
rs1233135127 4405 dbSNP
rs1177482966 4408 dbSNP
rs1302765463 4412 dbSNP
rs764293426 4418 dbSNP
rs923025653 4423 dbSNP
rs931751132 4431 dbSNP
rs1448766427 4436 dbSNP
rs1400728983 4441 dbSNP
rs983986112 4448 dbSNP
rs1464476430 4450 dbSNP
rs1050195781 4460 dbSNP
rs1158443806 4463 dbSNP
rs909400592 4473 dbSNP
rs1454726258 4481 dbSNP
rs1176970556 4482 dbSNP
rs754005213 4482 dbSNP
rs1441984924 4488 dbSNP
rs1437171220 4491 dbSNP
rs1200454935 4495 dbSNP
rs1174576613 4496 dbSNP
rs1039288270 4497 dbSNP
rs762103023 4498 dbSNP
rs533813199 4499 dbSNP
rs766032912 4502 dbSNP
rs1352288324 4504 dbSNP
rs1283496573 4505 dbSNP
rs1241846952 4506 dbSNP
rs1377447269 4507 dbSNP
rs751381490 4513 dbSNP
rs1443042729 4525 dbSNP
rs1303317927 4526 dbSNP
rs1299890655 4532 dbSNP
rs1435460776 4536 dbSNP
rs1359958171 4539 dbSNP
rs1157145349 4541 dbSNP
rs558456377 4546 dbSNP
rs1364537269 4563 dbSNP
rs1187305354 4564 dbSNP
rs1422386481 4567 dbSNP
rs1258918410 4569 dbSNP
rs1189237741 4571 dbSNP
rs892758824 4572 dbSNP
rs1283252506 4575 dbSNP
rs1013760513 4578 dbSNP
rs1025589896 4580 dbSNP
rs1264445765 4585 dbSNP
rs905264599 4586 dbSNP
rs570303528 4592 dbSNP
rs1348286470 4593 dbSNP
rs902559460 4599 dbSNP
rs1027088737 4600 dbSNP
rs139397400 4601 dbSNP
rs982780011 4603 dbSNP
rs556088509 4604 dbSNP
rs1370547101 4607 dbSNP
rs574433879 4608 dbSNP
rs961958109 4611 dbSNP
rs1456207261 4614 dbSNP
rs1177592528 4619 dbSNP
rs541577135 4621 dbSNP
rs1261582589 4623 dbSNP
rs1012059468 4629 dbSNP
rs1254096549 4631 dbSNP
rs1455847675 4638 dbSNP
rs975874118 4642 dbSNP
rs1171129506 4643 dbSNP
rs1023506525 4646 dbSNP
rs1425091992 4647 dbSNP
rs369220126 4651 dbSNP
rs1489375225 4662 dbSNP
rs572100967 4663 dbSNP
rs201092654 4665 dbSNP
rs540914469 4666 dbSNP
rs1025266859 4667 dbSNP
rs35434865 4667 dbSNP
rs1327072846 4668 dbSNP
rs145338338 4668 dbSNP
rs1465334540 4672 dbSNP
rs766467957 4673 dbSNP
rs1371532237 4678 dbSNP
rs1393061354 4680 dbSNP
rs1438360549 4684 dbSNP
rs951181141 4698 dbSNP
rs1465384883 4700 dbSNP
rs1422144147 4701 dbSNP
rs936315604 4702 dbSNP
rs983898129 4704 dbSNP
rs892706374 4706 dbSNP
rs74008147 4713 dbSNP
rs942192096 4718 dbSNP
rs974944956 4723 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000327827.7 | 3UTR | CAAACAUUUUCACACCCACCAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000327827.7 | 3UTR | CAAACAUUUUCACACCCACCAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000327827.7 | 3UTR | CAAACAUUUUCACACCCACCAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000327827.7 | 3UTR | CAAACAUUUUCACACCCACCAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000327827.7 | 3UTR | CAAACAUUUUCACACCCACCAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.609 2.2e-3 0.626 1.6e-3 20 Click to see details
GSE17306 Multiple myeloma 0.303 1.7e-2 0.348 7.1e-3 49 Click to see details
GSE19536 Breast cancer 0.209 1.8e-2 0.169 4.6e-2 100 Click to see details
GSE19783 ER- ER- breast cancer 0.187 4.9e-2 0.114 1.6e-1 79 Click to see details
GSE32688 Pancreatic cancer 0.283 5.8e-2 0.514 1.3e-3 32 Click to see details
GSE38226 Liver fibrosis 0.338 6.7e-2 0.314 8.3e-2 21 Click to see details
GSE14794 Lymphoblastoid cells 0.118 1.3e-1 0.150 7.9e-2 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.188 1.9e-1 -0.239 1.3e-1 24 Click to see details
GSE21849 B cell lymphoma 0.169 1.9e-1 0.206 1.4e-1 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.171 2.1e-1 0.175 2.0e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.247 2.1e-1 -0.187 2.7e-1 13 Click to see details
GSE28544 Breast cancer -0.174 2.1e-1 -0.538 3.3e-3 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.132 2.6e-1 -0.220 1.5e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.123 2.9e-1 0.010 4.8e-1 23 Click to see details
GSE19783 ER+ ER+ breast cancer 0.082 3.7e-1 0.077 3.7e-1 20 Click to see details
GSE21032 Prostate cancer -0.037 3.7e-1 0.007 4.7e-1 83 Click to see details
GSE19350 CNS germ cell tumors 0.086 4.0e-1 0.203 2.6e-1 12 Click to see details
GSE27834 Pluripotent stem cells -0.016 4.8e-1 -0.176 2.6e-1 16 Click to see details
GSE21687 Ependynoma primary tumors 0.004 4.9e-1 0.083 2.6e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.004 4.9e-1 0.083 2.6e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.322 0.01 -0.278 0.02 59 Click to see details
UCEC 0.45 0.03 0.354 0.07 19 Click to see details
KIRC 0.225 0.03 0.204 0.05 68 Click to see details
PAAD 0.887 0.06 0.200 0.4 4 Click to see details
HNSC 0.187 0.12 0.124 0.22 42 Click to see details
BLCA 0.286 0.12 0.329 0.09 18 Click to see details
LUAD 0.347 0.13 0.315 0.16 12 Click to see details
STAD -0.183 0.16 -0.232 0.1 32 Click to see details
CESC 0.82 0.19 0.500 0.33 3 Click to see details
KICH -0.171 0.21 -0.192 0.18 25 Click to see details
PCPG -0.71 0.25 -0.500 0.33 3 Click to see details
BRCA -0.068 0.27 -0.005 0.48 84 Click to see details
CHOL 0.214 0.29 0.033 0.47 9 Click to see details
KIRP -0.083 0.33 -0.122 0.25 32 Click to see details
COAD -0.189 0.33 -0.405 0.16 8 Click to see details
ESCA -0.089 0.4 -0.127 0.35 11 Click to see details
LUSC -0.027 0.44 0.025 0.44 38 Click to see details
PRAD 0.011 0.47 -0.074 0.3 50 Click to see details
LIHC 0.01 0.47 -0.024 0.43 49 Click to see details
LIHC 0.01 0.47 -0.024 0.43 49 Click to see details
LIHC 0.01 0.47 -0.024 0.43 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2