miRTarBase - #MIRT075249 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SNTB2   
Synonyms D16S2531E, EST25263, SNT2B2, SNT3, SNTL
Description syntrophin beta 2
Transcript NM_006750   
Expression
Putative miRNA Targets on SNTB2
3'UTR of SNTB2
(miRNA target sites are highlighted)
>SNTB2|NM_006750|3'UTR
   1 GCAACAAAAAATCAGAAAAGAGCCTTGACTGTCACAAGAAATATTTCCACCTCAAAAAAAAAAAAGCACAAAAAGAAACT
  81 CTTTGCTCTCCTTCAGCACAGTGCCTTCCCAAGGACCTGCAAATAACTGCTGAACCATAACCGTGTTTAAAGAAGAGCCT
 161 ACCTTTCACAGTCTACCTTGGCCAGATATTCTAGCACTCTAAAAGGCTCCAAAATGAAGCTGTTGATTTATTCTCATTTC
 241 AAAATATGGTTTATGAGTAATTAGGTTTATTTCTACTGCTAAAAAGAATGGCTCATTGTTTTCTTTTTTTTTCATTGTTT
 321 TCATTTTTAGACATAATCAAATACCCAAGCATTGTTTTCTTTTTCTTCTCCCTGTAGGATTTGTGTTGTGCTTAGCCTTG
 401 ATCTCTTGTTCAGAACAATTGTCCCTTCCCAGGTGCTAGCTTGCAGCAGCCTGTTGCTTCCTGAGCATTCCAGATAGGTC
 481 GTATGTCTTGGAATTTACTGTCCTCACTAGCTCCTTCCACCATAGGAAGTCCTTGAATTGTATCACCAAAGGGTTGTTCC
 561 ATTTGCCCTGGATCTCCCTCTATCTCAGCCTGGCCATCACTTCCCACCTTATCCCAAGCTTTGCCACTGTCTCTAGGACT
 641 TAGAACTTGTAAATTTGATTTGCCTTGCCTTCTACTTCCTTTCTAGTGGTGACTGAGTTGAAAAGCAAGTTGGAAGCCAC
 721 TGCTTTTAAAGAAAAGTTTTGCTTGGTTTAGGTTTTTCCAATTTTATTTTTGTTAGGAGCCAGGGGATAAGATTTATTTT
 801 AAATGAAAATCCTCTTCCTAGGTTAAGCCATTTTTTTTATTGCTTACCAAATGTGCCTTTGGTTAGGGTTAGTGGAGCTT
 881 TATTAGTCACTATTTGAATAACTGGAAATCACTGCCATTTCCAGGAGATCACCTATCCTAGTTTTGAGGAATAGTCATTG
 961 AGGTGGGTTTCCTTAATGGCATCTCTTCTAGTAGGCAGATCTGTTTGAACAAGATAAATCCTAAAGAGCCAGCCTGCTTG
1041 AGGAGTAGACTTGGTGGGTGAAGCCAGCAATTCCGCACAAACGTCATGTTGAATTGTTTTGGGCTGCCCAAAAACAACAG
1121 GATGCAGCATCCTGGCTGTGGCCTGGCCCTTTGTGGCAGCAGTGGCATGGACAAGCAACTGCTAATTCGAGACTTACTAT
1201 TGGCTTCACAGCACACCCTACAGTGAGCAGGGTGATGAGACCGTGGAACAGCTACCTGCTTTTGGTTAAGATTGCCAGAT
1281 ATCATTAGGACACAGTAGCAGCAAGAATGCTGATTTTGTAGTGTTAGAAAATGAACTCAGCTTGTTTTTCCTAATTTTGA
1361 AGGTGGTATATATCTGCAAACATTTAAAATGGTATAATATCATATAAAATGTCAAAATTAGCACAGTCCCTGGATCTCAA
1441 AGAATAGGTAATATTGACTTGGATGTTCTTTATGCTCTCTGAAGAAAGGTCTAGGGAAAGTTCTTGTTTGCTTGATTGAT
1521 CAAGAGTGCCACGGAAGAATGTGAGCGCTGTGGAGGGTGGAGGAGGGTGTCACTTCAGATGGGGCAGGCACAGGGGGAGA
1601 AAAGAAGAGAAAAACACACCTGTGTGCAAAATGAGCTATTTGGTTTCAGTGCGGCCTGACCGATGGGGAGGACCCATGAG
1681 CAGAGAGAGTTCTAGGTCAACATTGTAACTCCATTGTCCTCCTTCACCCATAAGTCAGTCCTCCTTCCTCATTACAGTGA
1761 AACCAACAATATGCAGAGGTTGGGGAGAGATGCCTGTTCTTCCCCCAGCTTCATATAATTGTCAAAGTTCCAAAAATGAA
1841 TTATCTGAACTGCTTAAAACTGGAAATTAAAATCTAGACAAGAATATGTCTTTCAAGAGCTTTTTATGTTTTGAAAGTTC
1921 ATAAACCTAAGATTGGCTCCATCTGAGATAAATTTTCTTTTCTTTTTTTTTTTGAGACGGAGTCTCGTTCTGTCTCCCAG
2001 GCTGGAGTGCAGTGGCATGATCTCGGCTCACTGCAACCTCCACCTCCTAGGTTCAAGTGATTCTCCTGAGTAGCTGGGGT
2081 TATAGCTACCCACCACCACACCCAGCTAATTTTTGTATTTTTAGTAGAGGCAGGTTTTCACCATGTTGGCTAGGCTGGTC
2161 TTGAACTCCCGACCTCAAGTGATCCACCTGCCTTGGCCTCCCAAAGTGCTGGGATTATAGGTGTGAGCCCCCGTGCCTGG
2241 CCCACAATAAATTTTCATTTCAGAGAAGGAAAAAAATCTCTTGAACGTCCAGAAATGATTTCTGGAATCAGAATTTCAAT
2321 ATGTAATACCCTCAGGTAGGCAATCTTGAACCCTCTATGCAGTGAGAGCATTATTAATATGAGATGTTGAATGATGCCTT
2401 TACAGACTTCAGCAGCAAAGCCATTTGGTTGAGGTTTTCTGTGTTAATGTGAAAAGCTAAGCCACTGAGATTTGCAGGGG
2481 AGCTTCTGAGCCACCCTGCTTGTTGGTTATATGAGGATGTAAAATAGGTGGAATTAAAATGTGAGCAGGAAAGGCAAGGC
2561 ATGTGTGCATTTTCACTCATTTTGGTCAAGGTTAAACTGACATGTATAGCACTGAGGTCTGTAGGGTTCTTAATATCTTT
2641 TGAGTCTTGCTGTGAAATGAAAGTGTGGGAGGTTTCCTTTGTCCATTAGCAGCCCCAAGAACCAGAACCCTTTTGCTGCT
2721 TTTCTTACATACCTAACAGCTCTCCAGTCATGATGACCAAGGTTGTTCTTCAATCAAATGTGTTTGTGGGATTTTCAGTC
2801 CGCAAATGAAGTGCTCTCTAATGAATGGGACACCATGATAAATATGTATTTATATTTAGATGCCAAAGTATGGCAAATTA
2881 TTTCCAAATGATAACTACAAATGGGAATTTTCGATATTCTACCTTTTTTATAGAACCAGCTCACTTTTCATTTCTTTTTC
2961 ATTTTGAATTAAGAAAATTGTTGAGGATGTGGTGGGTTCCAGTGTGTGGAATGGAAAGGAAACTGCAGAATAGTGTCTGC
3041 TCCCCATTCAGAGGGACTGCTTCCTGTGCCCCCCAGACCCGGGGCTTCGACAGCTTCTCCACATTCCACACAGATGCCTA
3121 GGAGCAGCGAGTTGGTATATGAAAAGTCTCCCACCTTTTCTCCTAAAACTTCTCTCCTTTCTCTCCATAAAAAGAAAAGG
3201 AAAGGAACAAAAGAAAAACATTCAGTTTTTCTTTTTCTGAAAAAGGTAAGTCCTTTCCTGAAGTCATCAAATGAAACATT
3281 ATCTGGAAATTAGTTTCTAATGTTGTATATGAAGAAATACTTAAATATAAGTTCCTGCAGTATTTATTAGATAGTTGTAA
3361 CTGTAAACTCACCTCCCTAGTAGATAAGAGTTTCAGGTTAAATACTGGAACATATATAGGCAGTCAAAAATACTACTTTA
3441 AATGTCATTCACCTATTTTAAAGCCATGTTTTAGCACTTTTTAGGCCAAAGAAGGTCTGATAGTGCCTGTTTTTATGTTC
3521 TGTACTCTCACAAACTTTGTTACTCAAAATTATTGCATGGCAGGAGAGATTGGATTATTTATTTCTTATATTTTTATAAG
3601 TAAAAAAATCTTTCTAAACAACAAATACCTAACATTATTACTGATTGTTTTCCTAATTTATCCTCCTAAGTTGAATGGTA
3681 ACAAAGCTTTTCCAGCTGAATGAATGCACTTAGCTGATAAACCAGAATTTGTTCTTTTTTTTCCTTCTTTTTTTTTTGAG
3761 ACAGGTTCTCACTCTGTCACCGAGGTTGGAGTGCAGTGGTATGATCATAGCTGACTGCAGCCTCAACCTTCTGGGCTCAA
3841 ATGATCCTTTCACCTCAGCCTCCTGAGTAGCTGGGACCACAGGTGTGTGCCACCACACCTGGCTAATTTTTATGGATTTT
3921 TTTTTCTTTTTTTTTTTTCGCCATGTTGCCCAGGCTGGTCTTGAACTCTTGGCACTCAAGCAGTCCTTCTGCCTCAGCCT
4001 CCCAAAGTGCTGGGATTACAGATGTGAGCCACTGCACCTGGCCCCAGAAATTATGCTTAAAAAAAAAATTAAGCTGTGTG
4081 GAATCTGGACAAGGCTATGTTTCTCCTAGAAACAGGTTTTGCTGTAAATGGTTTTGATGGGCGAAAGTGTGAGAAAAGGT
4161 TATAATAGATTCTTTTTTTTAATTTTGTGAGAAATTCCAGGTCTTCTTGCTTAACTTATATGCATGTGGATATATTTGTT
4241 TTCAAAGCCATGGAAGAATCTCTGTTCATATATTTTAATGCAAATTACCTTGTATGCTGCTATGCAAATTCTATTAAAAG
4321 GCCTACCTGCTTAAGAATTAAACATTTTTGAAACTTTCAGGGAAGACCTGTAGACTCAAGCACTTTCTCTGCTTTTTTGT
4401 ATCTTATCTTGGACACTTATGCTGAATTATGTTCTTATTATTTTCACTGGTTATAAGCTATTCCTTGTACATAATATTTA
4481 AACTATCCAAATATCCAGCATACATTTCCATGTGGCTGCCATCGGCTGTTGATGCCATGAATGAAATGGCTGGTTAGAAA
4561 GCCAAAGGTCTTCTTTTTTCAATTCCTAATGAATAAGTAAAATGCCAGATCTCTTTGGTCTCAAAGCAAATTGCTCTGAT
4641 CAGATCAAATATCTATGTAATGAAAAGAGACTTACTTAAATTTGGGATTCTGCTTAAACTTTAAGTTGAATTTGACTGTA
4721 GTCATTCATTCTTTTTATATATCTCTGTCAGGTATGACATTAATTACCAGGTGGTATTATACTCTACTTTGAGTTTGGAC
4801 ATCACTTTCAGTTAAATTTCTGTTGTTATTGTGGCTTTTTTTTTTTTTTAACCCCACTGAAGATGGAAGTAGAGCAGTCT
4881 GCCATCTCCTGCTGTTCTTTCTCTGTGCCCCCTAATTGCTTGGTAATCTAAAATTATTCTGACTTTCCACATACTGTCTT
4961 TAAAAACCAATTGTAGCAATCTGCCCGCCTCCACCCTTTAAGCTAAATCTTTCACTGTGCTGGATACATAGACACTCGAT
5041 AAATGTGTGATGATAGTTCTAAAATAATTATGCTATATATCAGGGTTCTGTATTTTTGAGCAATATCATTATTCCTATGC
5121 TGTGATGTTAAATGGAATTTATTTTACACTAGTAATAGACTGCTTAAGTGGCTGATTTGAAACCTTTCTCTAAAAAAACA
5201 AAAACATCTGGCAGATGAGTGACACAAATTCATTCTCTTAAAGGATAGAATTTCAAGTTAAGGATAAGGCACAATAAATA
5281 GGCACATAGAGGACATCTGTTTTTGTTTTTGGTTTTGGTTTTGTTTTTTTTTGTCTCTCTGACTAGCTAAACTGCCAACT
5361 AGAAGAATGGTTGTTATGTAGTAACTCAGAAGAATCTTTTAATAAGTTTCTTCTTTTGTTTCAAAACAAACTTGAGCTTC
5441 ATTTCTTGCCACCTCTATTCTTTCTTCCCACGTTGGGTGACTGAACTGATGCTTATTCTAGTTTTAGAAGAGGATCCACA
5521 TTTAATGTAAGGCATAAATATGCCTTTTGCAAATTATTGCTTGTTCTCCAGTGAACATTTGATCATATTCAACAGAAATC
5601 CACCATATAAACCATAATCCTTGAATTGCCCCTTTTAAAATAGATTGGTTAAAACCAAAAACCTATAAGAGAGAAATGAT
5681 ATTTCATTGTATTGTAGGTTTGGGAATCCTGGTTAGATTTATAATTTCTGGCCGGGTGCGGTGGCTCATGCCTGTATTCC
5761 CAGTACTTTGGGAGCCCAAGGTGGGTGGATCACCTGAGGTAAGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCC
5841 ATCTCTACTAAAAATACAAAAAGTTAGCTGGGCATGGTGGTGCGCGCCTGTGGTCCCAGCTACTCGGGAGGCTGAGGTGG
5921 GAGAATCCCTTGAACCCAGGAGGCAGAAGTTGCAGTGAGCTGAGATCATGCCATTGCACTCCAGCCTGGGCAACAGAGCG
6001 AGACTTCATCTCCAAAAAAAGAAAAAGAAGAAAAAGATTTATAATTTCTGAGTCCCCTAAGTCCCTTTCTCAGTTTGCAA
6081 TAATCTTACGTCCATGCTATTGACACTAATTTTGAAACTGGAAAGCTAATTAATGACATATTCATGTGTTCTTTCATCTA
6161 ATAAACATTTATTAATGTATAGTTCTACACCAGGCATTCTGAAGGGTCCAAAAGAAAGTTCCTGCCCTCTAGTAGCACAT
6241 AATCCGTTATTTCTCAGCACACCATGCCATCTGTTTATCATTCAGCAGTTAAGTAATTCATCACTTCATATTTTTACCAA
6321 AGTATATTTACAAGTCTGTTTATCTGGATCTGGCAAACTGGAAAATGTTTGAAGGGATACTCAGGCTTTGATCCATGCCA
6401 ACATGAAAGGACTCCAAGCACATTTAAGTAGGCTGGTCTTTTCATCATGCATGATTTTTTTTTTAGTGCAAATTTAGACT
6481 TTAGTTTGGGAAAGAGAACAGTATACAGTATCCTTTGTAAGATAAATCACAACAACAAAAATTAAGTTTTATTGCACAAA
6561 GTAGATAAATGAGAAAGTCTTTCTTAAAAAATGCTTCTTTAACTGTAACAGCAAAACTAAATGCATATTTTATCAACCCC
6641 TTATTTCTAATTGCTGTATTCATTTCCACCCTTAAACTATTTAAGCATTTCATCTGCTGAAAGTCCTTATATACATGGTA
6721 GACGGAATATTTCTCCATTAATGATAGATCAAAATGAAGATATTTAAAAATTAACAAAATCAGGCCAAGGCAGGAGGATC
6801 ACTTTAGCCCAGGAGGTCCAGACCAGCCTGGGCAACACAGCGGGACCCCGACTCCATTTAAAAAATTAAAAAAAAAAAAA
6881 AAACTTTTAACATTTAAAAAATAAAAATTAACAAAATTTCACTTATTCCAGGACACGCTGGCATTTGGACTCAATGAAAA
6961 GGGCACCTAAAGAAAATAAGGCTGACTGAATGTTTTCCATAATTTTCACACAATAACAGTCCCTTTCTATCCAGCTTGCC
7041 TTCCATTTATCTCTAGGGTTAGCTTTTCAGGCAACATCCTTGGTCATTGCCCAGAAAGTACCTGAGCTATCAGTGATTGG
7121 AATGGCACAGGAAACCGAATCACATGGGTGCCCTCCCCTTGGTTTTCAAGTATCTTGGAGTTGTGCACAAAAATTAGGTC
7201 ATGCCTTCAGTGTCTTGTTCTTTAAACCTACCCTTTGACAATCAGGTGCTAATGATTGTATACTATTAAAACCAGCACAT
7281 AAGTATTGTAAATGTGTGTTCCTCCTAGGTTGGAAGAAATGTCTTTCCTTCTATCTGGGTCCTGTTAAAGCGGGTGTCAG
7361 TTGTGTCTTTTCACCTCGATTTGTGAATTAATAGAATTGGGGGGAGAGGAAATGATGATGTCAATTAAGTTTCAGGTTTG
7441 GCATGATCATCATTCTCGATGATATTCTCACTTTGTCGCAAATCTGCCCTTATCGTAAGAACAAGTTTCAGAATTTTCCC
7521 TCCACTATACGACTCCAGTATTATGTTTACAATCCATTGGATGAGTGCAGCATTATAAGACCTTGGTGCCCAGAAAAATC
7601 TGTCCTTTTTGGTACCAAACCTGAGGTCTTTTGGAAGATAATGTAGAAAACCACTACCTATTGAAGGCCTGTTTTGGCTA
7681 ATCTGTGCAAACTCTGATGATACCTGCTTATGTGGATTCTTTTCCACACTGCTTTCATTTTTAAGTATAAAGACTTAGAA
7761 AACTAGAATAATGCTTTTACAAATAATTAAAAGTATGTGATGTTCTGGGTTTTTTCCTTCTTTTTAGAACCCTGTATTTA
7841 AACAAGCCTTCTTTTTAAGTCTTGTTTGAAATTTAAGTCTCAGATCTTCTGGATACCAAATCAAAAACCCAACGCGTAAA
7921 ACAGGGCAGTATTTGTGTTCCTAATTTTAAAAAGCTTTATGTATACTCTATAAATATAGATGCATAAACAACACTTCCCC
8001 TTGAGTAGCACATCAACATACAGCATTGTACATTACAATGAAAATGTGTAACTTAAGGGTATTATATATATAAATACATA
8081 TATACCTTTGTAACCTTTATACTGTAAATAAAAAAGTTGCTTTAGTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU--AAUACACGACGAu 5'
            ||||::|  ||:| ||||||| 
Target 5' tgCAAATTACCTTGTATGCTGCTa 3'
4279 - 4302 170.00 -17.10
2
miRNA  3' guGU-UUGGUAAUACACGACGAu 5'
            || |||| || | ||||||| 
Target 5' acCAGAACCCTT-T-TGCTGCTt 3'
2701 - 2721 158.00 -13.00
3
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               :||||    |||||:| 
Target 5' agtctGCCATCTCCTGCTGTTc 3'
4876 - 4897 133.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26996235 12 COSMIC
COSN30104512 56 COSMIC
COSN30104476 57 COSMIC
COSN1189851 66 COSMIC
COSN20113025 66 COSMIC
COSN22448135 76 COSMIC
COSN20093147 126 COSMIC
COSN31594687 146 COSMIC
COSN26573453 183 COSMIC
COSN28198349 207 COSMIC
COSN15112629 471 COSMIC
COSN31520314 732 COSMIC
COSN20566246 736 COSMIC
COSN29380818 787 COSMIC
COSN31770047 862 COSMIC
COSN31486582 897 COSMIC
COSN30174116 961 COSMIC
COSN27649406 1111 COSMIC
COSN25561705 1177 COSMIC
COSN20719754 1441 COSMIC
COSN21147890 2101 COSMIC
COSN6092741 2115 COSMIC
COSN31770048 2136 COSMIC
COSN31770053 2152 COSMIC
COSN31770062 2186 COSMIC
COSN31769233 2195 COSMIC
COSN31770066 2195 COSMIC
COSN31770071 2201 COSMIC
COSN31770072 2202 COSMIC
COSN31770073 2219 COSMIC
COSN31770085 2231 COSMIC
COSN19619704 2577 COSMIC
COSN31585793 2638 COSMIC
COSN17037335 2672 COSMIC
COSN31770092 2706 COSMIC
COSN26644338 2710 COSMIC
COSN30541427 2726 COSMIC
COSN8865837 2748 COSMIC
COSN25904511 2763 COSMIC
COSN13684237 2913 COSMIC
COSN1189853 3239 COSMIC
COSN31515319 3317 COSMIC
COSN31576933 3406 COSMIC
COSN31548063 3514 COSMIC
COSN30176808 3569 COSMIC
COSN31562823 3573 COSMIC
COSN31770093 3772 COSMIC
COSN31918353 3927 COSMIC
COSN29604223 4069 COSMIC
COSN31565541 4253 COSMIC
COSN30108188 4283 COSMIC
COSN20719755 4293 COSMIC
COSN18937730 4363 COSMIC
COSN25361747 4795 COSMIC
COSN1189854 4850 COSMIC
COSN31770099 4949 COSMIC
COSN21686803 4974 COSMIC
COSN17469908 5106 COSMIC
COSN1707064 5209 COSMIC
COSN23165668 5333 COSMIC
COSN9441025 5350 COSMIC
COSN31961227 5503 COSMIC
COSN31770100 5738 COSMIC
COSN31770102 5920 COSMIC
COSN22155661 5938 COSMIC
COSN14860147 6004 COSMIC
COSN1707065 6327 COSMIC
COSN20113028 6601 COSMIC
COSN9651621 6602 COSMIC
COSN9651622 6620 COSMIC
COSN31770107 6806 COSMIC
COSN31918242 6867 COSMIC
COSN32062329 6884 COSMIC
COSN15755350 6899 COSMIC
COSN20593248 6959 COSMIC
COSN31482402 7137 COSMIC
COSN31590669 7352 COSMIC
COSN31769320 7599 COSMIC
COSN30544247 8120 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs191890831 3 dbSNP
rs1263495393 6 dbSNP
rs758245256 11 dbSNP
rs777716435 15 dbSNP
rs1423321093 21 dbSNP
rs1160007981 28 dbSNP
rs746811552 32 dbSNP
rs1187693047 36 dbSNP
rs1452317662 36 dbSNP
rs536414693 39 dbSNP
rs770778325 41 dbSNP
rs781000945 50 dbSNP
rs745499020 53 dbSNP
rs1256539405 54 dbSNP
rs1481994571 54 dbSNP
rs34703750 54 dbSNP
rs398029805 54 dbSNP
rs763359703 54 dbSNP
rs878873889 54 dbSNP
rs1038736901 60 dbSNP
rs1173797261 66 dbSNP
rs1376926487 67 dbSNP
rs1397530113 68 dbSNP
rs1297094205 70 dbSNP
rs900159955 72 dbSNP
rs1218436126 74 dbSNP
rs1318826707 75 dbSNP
rs1326919462 76 dbSNP
rs554810967 84 dbSNP
rs1280345504 87 dbSNP
rs754002949 89 dbSNP
rs1010853547 95 dbSNP
rs1022150801 113 dbSNP
rs531763342 114 dbSNP
rs1408237550 118 dbSNP
rs1234791414 124 dbSNP
rs765174808 126 dbSNP
rs1007303698 127 dbSNP
rs752688088 138 dbSNP
rs1423823175 141 dbSNP
rs1034785439 143 dbSNP
rs960151301 144 dbSNP
rs1214504652 150 dbSNP
rs1254827822 162 dbSNP
rs1181983731 164 dbSNP
rs1005841169 170 dbSNP
rs1236921641 172 dbSNP
rs1198339945 179 dbSNP
rs1458506891 183 dbSNP
rs1253510514 185 dbSNP
rs1283737586 187 dbSNP
rs1321394170 192 dbSNP
rs1448072186 194 dbSNP
rs993851365 194 dbSNP
rs1026249131 195 dbSNP
rs1329244070 200 dbSNP
rs1446017209 209 dbSNP
rs1400748110 225 dbSNP
rs993317410 229 dbSNP
rs1456041551 234 dbSNP
rs573124421 236 dbSNP
rs915945833 243 dbSNP
rs1164821589 248 dbSNP
rs1445934730 249 dbSNP
rs1033477297 255 dbSNP
rs1477879664 258 dbSNP
rs1440920870 261 dbSNP
rs970448776 266 dbSNP
rs973672927 271 dbSNP
rs920865003 280 dbSNP
rs1396483757 281 dbSNP
rs1417524587 282 dbSNP
rs929515415 287 dbSNP
rs1047933565 288 dbSNP
rs1157523331 289 dbSNP
rs534128346 290 dbSNP
rs1385120464 293 dbSNP
rs1308703720 295 dbSNP
rs1401950918 296 dbSNP
rs34094349 300 dbSNP
rs1239298756 302 dbSNP
rs1308813311 304 dbSNP
rs991586927 304 dbSNP
rs1321464968 314 dbSNP
rs1330473909 315 dbSNP
rs1389484031 316 dbSNP
rs1441340222 318 dbSNP
rs1305407502 323 dbSNP
rs1303393840 324 dbSNP
rs1373465308 339 dbSNP
rs1358073812 345 dbSNP
rs558257458 347 dbSNP
rs1157573699 350 dbSNP
rs1440826020 351 dbSNP
rs917259507 354 dbSNP
rs912045053 378 dbSNP
rs1432978516 379 dbSNP
rs944506354 386 dbSNP
rs576805582 392 dbSNP
rs1268561321 398 dbSNP
rs1238324091 401 dbSNP
rs950065998 406 dbSNP
rs1487453406 419 dbSNP
rs758295208 421 dbSNP
rs755622650 429 dbSNP
rs1039182586 443 dbSNP
rs1351263774 446 dbSNP
rs936224772 451 dbSNP
rs900190538 466 dbSNP
rs1010548210 478 dbSNP
rs1230717982 481 dbSNP
rs1260379743 482 dbSNP
rs116562449 500 dbSNP
rs889282589 501 dbSNP
rs1288286427 503 dbSNP
rs1338034954 521 dbSNP
rs1296990303 524 dbSNP
rs943139223 527 dbSNP
rs1387697751 540 dbSNP
rs902449183 541 dbSNP
rs1040111083 549 dbSNP
rs1466033874 557 dbSNP
rs1378542836 559 dbSNP
rs999356571 570 dbSNP
rs1179093714 572 dbSNP
rs1034854166 578 dbSNP
rs896300118 579 dbSNP
rs1194396663 583 dbSNP
rs1448830216 587 dbSNP
rs1437419137 589 dbSNP
rs1254238217 604 dbSNP
rs868403030 607 dbSNP
rs562570218 608 dbSNP
rs970143445 615 dbSNP
rs1263507930 616 dbSNP
rs973414608 620 dbSNP
rs1225143264 627 dbSNP
rs1315608407 628 dbSNP
rs1277192700 634 dbSNP
rs138745184 636 dbSNP
rs1327672213 647 dbSNP
rs372020467 649 dbSNP
rs950983986 652 dbSNP
rs1395934691 657 dbSNP
rs1407499347 661 dbSNP
rs1161003079 662 dbSNP
rs763903522 666 dbSNP
rs1461961251 667 dbSNP
rs1168699804 687 dbSNP
rs1476551363 689 dbSNP
rs1366767712 714 dbSNP
rs1327658390 731 dbSNP
rs1186997459 732 dbSNP
rs1441725653 736 dbSNP
rs1243710130 738 dbSNP
rs768613183 743 dbSNP
rs1456265483 746 dbSNP
rs1257256650 758 dbSNP
rs115975790 762 dbSNP
rs944853102 768 dbSNP
rs551946663 773 dbSNP
rs1281873086 778 dbSNP
rs1243474222 780 dbSNP
rs974916597 784 dbSNP
rs1384091700 785 dbSNP
rs1339287197 795 dbSNP
rs959217143 796 dbSNP
rs1336599092 802 dbSNP
rs992009855 830 dbSNP
rs1241241181 831 dbSNP
rs1024404356 843 dbSNP
rs1388878090 847 dbSNP
rs560361593 852 dbSNP
rs1445325398 860 dbSNP
rs1387220176 881 dbSNP
rs141767219 891 dbSNP
rs1334759638 906 dbSNP
rs571883063 911 dbSNP
rs1237316974 918 dbSNP
rs1204984113 928 dbSNP
rs1439152910 931 dbSNP
rs1287306189 940 dbSNP
rs1208669340 942 dbSNP
rs1043378710 954 dbSNP
rs1275611317 959 dbSNP
rs1316620882 963 dbSNP
rs924608981 966 dbSNP
rs936298427 969 dbSNP
rs990345737 981 dbSNP
rs1444858156 986 dbSNP
rs1195609687 994 dbSNP
rs1323124150 994 dbSNP
rs1425605995 1004 dbSNP
rs1250768360 1011 dbSNP
rs1367490496 1024 dbSNP
rs1156979105 1026 dbSNP
rs11859260 1040 dbSNP
rs1407207272 1043 dbSNP
rs1184776031 1055 dbSNP
rs935281296 1060 dbSNP
rs1056769888 1064 dbSNP
rs1475258313 1068 dbSNP
rs896341899 1071 dbSNP
rs943562779 1075 dbSNP
rs1198236084 1076 dbSNP
rs1421434662 1081 dbSNP
rs1490423096 1083 dbSNP
rs1012511400 1084 dbSNP
rs1293295784 1094 dbSNP
rs1464861239 1104 dbSNP
rs1213859097 1111 dbSNP
rs867860364 1119 dbSNP
rs1285584577 1120 dbSNP
rs76091845 1122 dbSNP
rs1365920128 1124 dbSNP
rs1274671213 1132 dbSNP
rs757011718 1138 dbSNP
rs1332256528 1148 dbSNP
rs1027691132 1150 dbSNP
rs1399481656 1152 dbSNP
rs531703873 1165 dbSNP
rs1233983094 1189 dbSNP
rs150767583 1190 dbSNP
rs1295609697 1200 dbSNP
rs1175503842 1213 dbSNP
rs887438832 1220 dbSNP
rs1006165580 1222 dbSNP
rs1190795752 1242 dbSNP
rs568523748 1243 dbSNP
rs535953973 1244 dbSNP
rs572621907 1265 dbSNP
rs780960775 1266 dbSNP
rs745491799 1270 dbSNP
rs1311002186 1276 dbSNP
rs566713582 1278 dbSNP
rs1198311821 1279 dbSNP
rs895024941 1285 dbSNP
rs1276554909 1286 dbSNP
rs975325689 1290 dbSNP
rs1485688000 1294 dbSNP
rs534063495 1296 dbSNP
rs1399689291 1299 dbSNP
rs1362746314 1303 dbSNP
rs377609097 1311 dbSNP
rs558839841 1320 dbSNP
rs1013436620 1327 dbSNP
rs922086942 1345 dbSNP
rs1357381873 1348 dbSNP
rs971541216 1354 dbSNP
rs998895676 1367 dbSNP
rs74435266 1383 dbSNP
rs1260912846 1386 dbSNP
rs957357380 1394 dbSNP
rs173473 1395 dbSNP
rs1170876734 1397 dbSNP
rs910824518 1399 dbSNP
rs748717981 1401 dbSNP
rs1482539520 1406 dbSNP
rs1243076428 1410 dbSNP
rs35811121 1428 dbSNP
rs564152724 1430 dbSNP
rs1462923899 1437 dbSNP
rs1170972114 1438 dbSNP
rs1226932194 1447 dbSNP
rs1308352863 1453 dbSNP
rs28402914 1461 dbSNP
rs1375102895 1470 dbSNP
rs1056108799 1476 dbSNP
rs976286228 1482 dbSNP
rs567630953 1493 dbSNP
rs1376806688 1504 dbSNP
rs1314313360 1511 dbSNP
rs539892274 1519 dbSNP
rs929109146 1520 dbSNP
rs113565532 1523 dbSNP
rs1329106133 1533 dbSNP
rs908906840 1534 dbSNP
rs35310462 1535 dbSNP
rs941687434 1538 dbSNP
rs1171823056 1539 dbSNP
rs1382212476 1547 dbSNP
rs1054769428 1556 dbSNP
rs1045304058 1560 dbSNP
rs1296933645 1568 dbSNP
rs1328495488 1580 dbSNP
rs1195611453 1581 dbSNP
rs1481060110 1589 dbSNP
rs1013884621 1592 dbSNP
rs1253305820 1592 dbSNP
rs1046268517 1594 dbSNP
rs1231565014 1600 dbSNP
rs1279100164 1609 dbSNP
rs1348218394 1613 dbSNP
rs898324611 1618 dbSNP
rs1246591260 1620 dbSNP
rs375115364 1621 dbSNP
rs1304543357 1630 dbSNP
rs1390608610 1632 dbSNP
rs773831576 1637 dbSNP
rs886500339 1639 dbSNP
rs1005307275 1648 dbSNP
rs11545145 1650 dbSNP
rs1018914071 1653 dbSNP
rs747445783 1654 dbSNP
rs1427055957 1657 dbSNP
rs996442554 1659 dbSNP
rs1186978500 1663 dbSNP
rs1263769915 1675 dbSNP
rs1029607892 1679 dbSNP
rs968172523 1681 dbSNP
rs1253182888 1690 dbSNP
rs574190967 1701 dbSNP
rs1490260912 1702 dbSNP
rs541568457 1703 dbSNP
rs1394671317 1710 dbSNP
rs1011535981 1719 dbSNP
rs1238312300 1720 dbSNP
rs923709377 1722 dbSNP
rs956426900 1726 dbSNP
rs992241755 1727 dbSNP
rs1344499450 1728 dbSNP
rs1175584208 1737 dbSNP
rs1343447767 1739 dbSNP
rs1453148209 1746 dbSNP
rs1359125797 1751 dbSNP
rs551213226 1752 dbSNP
rs1387800003 1769 dbSNP
rs1365883546 1773 dbSNP
rs1174422997 1785 dbSNP
rs1480207339 1794 dbSNP
rs561552476 1795 dbSNP
rs1385428430 1809 dbSNP
rs1201610571 1810 dbSNP
rs1303186553 1815 dbSNP
rs1044975797 1816 dbSNP
rs919782438 1820 dbSNP
rs1261210668 1826 dbSNP
rs931153613 1834 dbSNP
rs1204449122 1837 dbSNP
rs1486182564 1847 dbSNP
rs1046903372 1873 dbSNP
rs771409564 1875 dbSNP
rs1371277227 1876 dbSNP
rs1004931828 1877 dbSNP
rs1306649126 1885 dbSNP
rs923487234 1887 dbSNP
rs1315742742 1891 dbSNP
rs1215927775 1895 dbSNP
rs1040818705 1901 dbSNP
rs1324172805 1907 dbSNP
rs901837795 1920 dbSNP
rs996858835 1921 dbSNP
rs572335353 1922 dbSNP
rs1212832786 1927 dbSNP
rs1253454260 1928 dbSNP
rs1455430800 1930 dbSNP
rs1469621106 1939 dbSNP
rs775727067 1941 dbSNP
rs569585601 1943 dbSNP
rs1430500782 1949 dbSNP
rs1178843356 1953 dbSNP
rs1195656887 1953 dbSNP
rs1406098420 1955 dbSNP
rs536753480 1963 dbSNP
rs751843109 1963 dbSNP
rs183684649 1967 dbSNP
rs1054805356 1968 dbSNP
rs1159980810 1975 dbSNP
rs1001000206 1979 dbSNP
rs1460402040 1980 dbSNP
rs1031093993 1987 dbSNP
rs759610959 1988 dbSNP
rs1227521851 1990 dbSNP
rs949356428 1995 dbSNP
rs765392330 1997 dbSNP
rs991919608 2004 dbSNP
rs1046732591 2008 dbSNP
rs1443574594 2010 dbSNP
rs917603299 2018 dbSNP
rs1407260102 2025 dbSNP
rs1339160800 2032 dbSNP
rs1372187864 2034 dbSNP
rs1408379785 2035 dbSNP
rs969062215 2044 dbSNP
rs935183940 2045 dbSNP
rs775388644 2047 dbSNP
rs1383533689 2062 dbSNP
rs1308601634 2080 dbSNP
rs1053513506 2085 dbSNP
rs893231361 2086 dbSNP
rs1232542199 2092 dbSNP
rs1185226788 2094 dbSNP
rs188300022 2096 dbSNP
rs1011609763 2097 dbSNP
rs1340854661 2101 dbSNP
rs1289005883 2102 dbSNP
rs1469614970 2106 dbSNP
rs1245855035 2108 dbSNP
rs1384211852 2112 dbSNP
rs1017642104 2116 dbSNP
rs919852985 2125 dbSNP
rs1440474269 2127 dbSNP
rs997806645 2129 dbSNP
rs1329777227 2145 dbSNP
rs931182661 2146 dbSNP
rs1046931748 2150 dbSNP
rs1031013054 2156 dbSNP
rs1480450221 2158 dbSNP
rs908371262 2160 dbSNP
rs1410335702 2170 dbSNP
rs940803397 2171 dbSNP
rs763002219 2172 dbSNP
rs1468394795 2177 dbSNP
rs983620114 2178 dbSNP
rs1474276630 2183 dbSNP
rs1164755068 2188 dbSNP
rs901866081 2190 dbSNP
rs1419251092 2199 dbSNP
rs1266087770 2201 dbSNP
rs1221133299 2203 dbSNP
rs1360711094 2209 dbSNP
rs1463300138 2222 dbSNP
rs550099253 2224 dbSNP
rs764055015 2233 dbSNP
rs1050359713 2234 dbSNP
rs904122348 2243 dbSNP
rs1280552185 2244 dbSNP
rs1444614327 2246 dbSNP
rs1299538162 2254 dbSNP
rs1027627791 2255 dbSNP
rs8053471 2265 dbSNP
rs1031168869 2266 dbSNP
rs1302548490 2270 dbSNP
rs1413661390 2274 dbSNP
rs1405640551 2279 dbSNP
rs1367588484 2284 dbSNP
rs892627202 2287 dbSNP
rs963156179 2288 dbSNP
rs757099612 2289 dbSNP
rs529397356 2291 dbSNP
rs1426775740 2296 dbSNP
rs192387663 2308 dbSNP
rs1490367100 2309 dbSNP
rs1248019363 2310 dbSNP
rs566648894 2319 dbSNP
rs1214237834 2320 dbSNP
rs916279453 2330 dbSNP
rs1216531423 2331 dbSNP
rs533959223 2338 dbSNP
rs1225869069 2344 dbSNP
rs115509708 2349 dbSNP
rs980439496 2351 dbSNP
rs1224420851 2354 dbSNP
rs1205419570 2355 dbSNP
rs1287237871 2356 dbSNP
rs750093430 2356 dbSNP
rs1026610118 2358 dbSNP
rs981779310 2374 dbSNP
rs952644483 2382 dbSNP
rs1175261617 2387 dbSNP
rs1484710197 2397 dbSNP
rs923862761 2399 dbSNP
rs779349236 2406 dbSNP
rs982686266 2418 dbSNP
rs1475353509 2419 dbSNP
rs755680245 2421 dbSNP
rs1258803585 2424 dbSNP
rs1243209047 2427 dbSNP
rs573539177 2429 dbSNP
rs1211183396 2442 dbSNP
rs779638773 2447 dbSNP
rs1476496369 2470 dbSNP
rs1460254414 2476 dbSNP
rs1262952124 2492 dbSNP
rs137997718 2500 dbSNP
rs1314186216 2503 dbSNP
rs8054244 2532 dbSNP
rs1410882560 2534 dbSNP
rs1214066186 2555 dbSNP
rs185524145 2559 dbSNP
rs923395589 2563 dbSNP
rs1270685390 2566 dbSNP
rs12708895 2577 dbSNP
rs1433536256 2585 dbSNP
rs557917818 2601 dbSNP
rs747913850 2607 dbSNP
rs903861461 2613 dbSNP
rs1469955566 2616 dbSNP
rs72795266 2617 dbSNP
rs1167625344 2626 dbSNP
rs900553673 2630 dbSNP
rs1419690188 2645 dbSNP
rs1191020545 2657 dbSNP
rs1269537945 2659 dbSNP
rs1052618171 2661 dbSNP
rs1184626146 2666 dbSNP
rs1216145002 2673 dbSNP
rs1276980836 2678 dbSNP
rs1030292690 2679 dbSNP
rs775908232 2686 dbSNP
rs886698071 2699 dbSNP
rs1308149410 2710 dbSNP
rs1210213384 2711 dbSNP
rs190829921 2711 dbSNP
rs1380527246 2719 dbSNP
rs540107685 2720 dbSNP
rs1486702762 2729 dbSNP
rs1191578717 2730 dbSNP
rs1013766585 2733 dbSNP
rs1005128661 2744 dbSNP
rs8058805 2748 dbSNP
rs1188706774 2757 dbSNP
rs904942437 2764 dbSNP
rs1392841240 2774 dbSNP
rs879232558 2778 dbSNP
rs1453489244 2781 dbSNP
rs1425910948 2785 dbSNP
rs761616015 2792 dbSNP
rs1176805281 2799 dbSNP
rs1001949471 2801 dbSNP
rs1481111658 2802 dbSNP
rs546336519 2803 dbSNP
rs990975822 2812 dbSNP
rs1398459013 2814 dbSNP
rs1357111890 2825 dbSNP
rs1290969049 2826 dbSNP
rs1023824231 2828 dbSNP
rs1317508474 2830 dbSNP
rs1345740655 2834 dbSNP
rs1432613152 2836 dbSNP
rs1390409697 2837 dbSNP
rs558069183 2843 dbSNP
rs1309245299 2849 dbSNP
rs1402573686 2850 dbSNP
rs952342510 2851 dbSNP
rs576668432 2853 dbSNP
rs982723459 2861 dbSNP
rs79171478 2880 dbSNP
rs562048689 2881 dbSNP
rs935290968 2901 dbSNP
rs1362402827 2905 dbSNP
rs1304446456 2906 dbSNP
rs768677936 2908 dbSNP
rs976621843 2913 dbSNP
rs866992573 2914 dbSNP
rs1490199428 2918 dbSNP
rs529331780 2921 dbSNP
rs769963060 2922 dbSNP
rs1284151580 2924 dbSNP
rs775754104 2927 dbSNP
rs986171493 2930 dbSNP
rs541458903 2931 dbSNP
rs1238101450 2934 dbSNP
rs1039512967 2937 dbSNP
rs933385876 2938 dbSNP
rs1051798729 2941 dbSNP
rs886436253 2950 dbSNP
rs1210959464 2955 dbSNP
rs1383440582 2959 dbSNP
rs1005167783 2972 dbSNP
rs1037972096 2978 dbSNP
rs1454120491 2981 dbSNP
rs1391342813 2984 dbSNP
rs899391917 2997 dbSNP
rs936694139 3009 dbSNP
rs1480267943 3012 dbSNP
rs1052357116 3018 dbSNP
rs1201100145 3032 dbSNP
rs1023773879 3033 dbSNP
rs1193807660 3035 dbSNP
rs914165704 3040 dbSNP
rs1465156531 3050 dbSNP
rs1269858648 3059 dbSNP
rs949627363 3067 dbSNP
rs1046597643 3068 dbSNP
rs1322416377 3069 dbSNP
rs1274853000 3074 dbSNP
rs1157537243 3075 dbSNP
rs905349110 3079 dbSNP
rs1001980650 3081 dbSNP
rs1315804246 3082 dbSNP
rs1367781413 3086 dbSNP
rs1003294089 3089 dbSNP
rs573257725 3090 dbSNP
rs888175924 3103 dbSNP
rs1393371180 3104 dbSNP
rs1003897013 3112 dbSNP
rs1174342726 3114 dbSNP
rs1460510879 3116 dbSNP
rs1372618851 3118 dbSNP
rs1192378452 3121 dbSNP
rs143901505 3127 dbSNP
rs533271719 3129 dbSNP
rs552346454 3130 dbSNP
rs956358753 3133 dbSNP
rs1460568392 3134 dbSNP
rs1278916180 3135 dbSNP
rs1201868604 3140 dbSNP
rs1336841593 3151 dbSNP
rs1326768762 3155 dbSNP
rs1333092516 3159 dbSNP
rs989075393 3165 dbSNP
rs1229722813 3172 dbSNP
rs915174425 3175 dbSNP
rs181656609 3182 dbSNP
rs531622182 3184 dbSNP
rs965327868 3188 dbSNP
rs1279102828 3196 dbSNP
rs1352006954 3211 dbSNP
rs1336369189 3214 dbSNP
rs922452503 3226 dbSNP
rs35566167 3240 dbSNP
rs148612177 3247 dbSNP
rs1271836182 3251 dbSNP
rs1051837923 3253 dbSNP
rs1391982169 3257 dbSNP
rs568037360 3264 dbSNP
rs1028192753 3266 dbSNP
rs1161386067 3269 dbSNP
rs764141275 3270 dbSNP
rs907932433 3271 dbSNP
rs953867809 3279 dbSNP
rs1037666896 3285 dbSNP
rs1435734539 3290 dbSNP
rs1214733956 3294 dbSNP
rs1268994842 3298 dbSNP
rs542316001 3300 dbSNP
rs1012495058 3303 dbSNP
rs1180461288 3304 dbSNP
rs1344879352 3315 dbSNP
rs1233012276 3319 dbSNP
rs1245940258 3328 dbSNP
rs1470881355 3332 dbSNP
rs1357491479 3337 dbSNP
rs1237080299 3338 dbSNP
rs1162651638 3341 dbSNP
rs925384048 3349 dbSNP
rs1308671630 3351 dbSNP
rs1411763615 3355 dbSNP
rs1045680714 3357 dbSNP
rs761669398 3358 dbSNP
rs767374886 3364 dbSNP
rs1404757237 3365 dbSNP
rs1414183990 3378 dbSNP
rs1164790660 3382 dbSNP
rs200698606 3382 dbSNP
rs535051085 3384 dbSNP
rs1166875437 3389 dbSNP
rs1393138014 3397 dbSNP
rs544073209 3404 dbSNP
rs1182515839 3415 dbSNP
rs1483733164 3428 dbSNP
rs562488391 3434 dbSNP
rs1222382200 3436 dbSNP
rs1292385411 3445 dbSNP
rs374306327 3445 dbSNP
rs539201755 3465 dbSNP
rs1350161156 3476 dbSNP
rs1289193103 3478 dbSNP
rs1230502897 3491 dbSNP
rs1343710325 3496 dbSNP
rs956431674 3500 dbSNP
rs1047070813 3505 dbSNP
rs1435596928 3522 dbSNP
rs1350433500 3528 dbSNP
rs1411782094 3532 dbSNP
rs1010528678 3534 dbSNP
rs926832835 3540 dbSNP
rs938181447 3542 dbSNP
rs1387687596 3544 dbSNP
rs1291926947 3546 dbSNP
rs1473402613 3554 dbSNP
rs1334821051 3566 dbSNP
rs1048566884 3571 dbSNP
rs1478619250 3575 dbSNP
rs558318979 3581 dbSNP
rs1267676524 3602 dbSNP
rs576593005 3611 dbSNP
rs1003926647 3614 dbSNP
rs531421674 3628 dbSNP
rs1483720836 3647 dbSNP
rs1210803550 3657 dbSNP
rs1321680509 3667 dbSNP
rs1185222790 3677 dbSNP
rs1262547511 3679 dbSNP
rs1219912252 3683 dbSNP
rs1256677588 3685 dbSNP
rs1369884801 3688 dbSNP
rs1276513709 3694 dbSNP
rs1475531371 3695 dbSNP
rs1428632912 3705 dbSNP
rs1189338378 3706 dbSNP
rs187122144 3722 dbSNP
rs1461301723 3733 dbSNP
rs1167520350 3735 dbSNP
rs998142513 3737 dbSNP
rs1397512148 3739 dbSNP
rs1458427695 3740 dbSNP
rs1403481304 3743 dbSNP
rs545302836 3743 dbSNP
rs1174685929 3745 dbSNP
rs1426709721 3748 dbSNP
rs907961729 3748 dbSNP
rs1185279407 3749 dbSNP
rs1449449109 3751 dbSNP
rs1248966357 3759 dbSNP
rs1431684468 3761 dbSNP
rs940722414 3762 dbSNP
rs1190948988 3768 dbSNP
rs1460113628 3773 dbSNP
rs1311184857 3781 dbSNP
rs1355381780 3782 dbSNP
rs556065798 3783 dbSNP
rs1416000018 3789 dbSNP
rs1271043000 3794 dbSNP
rs188422802 3800 dbSNP
rs920605661 3802 dbSNP
rs1298011166 3804 dbSNP
rs1028640019 3807 dbSNP
rs1437033445 3821 dbSNP
rs765987439 3825 dbSNP
rs999993817 3833 dbSNP
rs948329666 3836 dbSNP
rs541391558 3837 dbSNP
rs1227179872 3842 dbSNP
rs1429635225 3844 dbSNP
rs565452046 3845 dbSNP
rs1343906093 3851 dbSNP
rs533457700 3857 dbSNP
rs988621932 3860 dbSNP
rs913930282 3883 dbSNP
rs1255983522 3888 dbSNP
rs1182653815 3890 dbSNP
rs1484367819 3894 dbSNP
rs892223991 3897 dbSNP
rs971116413 3903 dbSNP
rs1208091657 3914 dbSNP
rs1482659649 3916 dbSNP
rs1010603726 3917 dbSNP
rs1022416713 3917 dbSNP
rs1230568858 3917 dbSNP
rs982109600 3918 dbSNP
rs899478908 3926 dbSNP
rs1309221092 3927 dbSNP
rs1380935421 3927 dbSNP
rs369525772 3927 dbSNP
rs1279057145 3932 dbSNP
rs1370682357 3938 dbSNP
rs1423363184 3939 dbSNP
rs996889508 3939 dbSNP
rs1029599445 3940 dbSNP
rs1202041307 3941 dbSNP
rs1406089698 3944 dbSNP
rs1181787704 3946 dbSNP
rs1472940442 3946 dbSNP
rs1254152422 3950 dbSNP
rs1207192820 3953 dbSNP
rs955429640 3958 dbSNP
rs1264565267 3961 dbSNP
rs1222063261 3973 dbSNP
rs1323339642 3977 dbSNP
rs926878236 4002 dbSNP
rs938212107 4008 dbSNP
rs1227478084 4013 dbSNP
rs181258363 4020 dbSNP
rs142681537 4021 dbSNP
rs1385529908 4022 dbSNP
rs1390684623 4023 dbSNP
rs1193698808 4024 dbSNP
rs1015430917 4025 dbSNP
rs1459747412 4032 dbSNP
rs531379402 4043 dbSNP
rs1390990683 4046 dbSNP
rs1451637793 4051 dbSNP
rs1171832539 4053 dbSNP
rs1473072739 4059 dbSNP
rs962162269 4059 dbSNP
rs184882398 4068 dbSNP
rs12149104 4069 dbSNP
rs1431325211 4089 dbSNP
rs1266564567 4091 dbSNP
rs543796846 4095 dbSNP
rs948090725 4096 dbSNP
rs1266077514 4106 dbSNP
rs1383496143 4107 dbSNP
rs3932197 4110 dbSNP
rs1207648094 4112 dbSNP
rs981154987 4125 dbSNP
rs556396693 4126 dbSNP
rs1037175813 4141 dbSNP
rs189741606 4143 dbSNP
rs75616757 4144 dbSNP
rs1389098792 4146 dbSNP
rs1366895553 4147 dbSNP
rs1320317798 4148 dbSNP
rs757658919 4150 dbSNP
rs1049370150 4153 dbSNP
rs892631701 4160 dbSNP
rs946491537 4162 dbSNP
rs565577438 4165 dbSNP
rs1465582792 4172 dbSNP
rs1176691673 4173 dbSNP
rs1245895052 4173 dbSNP
rs562828146 4173 dbSNP
rs781710512 4181 dbSNP
rs1258874625 4182 dbSNP
rs1485528252 4183 dbSNP
rs1032839274 4184 dbSNP
rs996529367 4208 dbSNP
rs1029709424 4216 dbSNP
rs891615706 4220 dbSNP
rs1009676098 4224 dbSNP
rs1021473202 4232 dbSNP
rs539503941 4244 dbSNP
rs1297269630 4249 dbSNP
rs1436252989 4251 dbSNP
rs1367849556 4262 dbSNP
rs982530701 4271 dbSNP
rs371684411 4276 dbSNP
rs1402931999 4280 dbSNP
rs1304665016 4281 dbSNP
rs1436464575 4286 dbSNP
rs1394727066 4303 dbSNP
rs1167935767 4308 dbSNP
rs551216458 4314 dbSNP
rs1391855997 4321 dbSNP
rs1183308083 4322 dbSNP
rs959651999 4327 dbSNP
rs1433820882 4339 dbSNP
rs759378345 4343 dbSNP
rs1441496371 4345 dbSNP
rs962524854 4351 dbSNP
rs1178373813 4360 dbSNP
rs1362562617 4369 dbSNP
rs974286347 4375 dbSNP
rs984364948 4393 dbSNP
rs1274517337 4402 dbSNP
rs183005599 4414 dbSNP
rs940166255 4421 dbSNP
rs147329888 4432 dbSNP
rs1282809158 4438 dbSNP
rs556000338 4439 dbSNP
rs1341330262 4441 dbSNP
rs980801701 4447 dbSNP
rs1324750774 4453 dbSNP
rs574384634 4454 dbSNP
rs113123420 4459 dbSNP
rs933716229 4468 dbSNP
rs1430394503 4474 dbSNP
rs1398290123 4488 dbSNP
rs1161244330 4490 dbSNP
rs1049422987 4491 dbSNP
rs1368705472 4505 dbSNP
rs889441048 4509 dbSNP
rs1471323010 4510 dbSNP
rs935947058 4512 dbSNP
rs1054280585 4513 dbSNP
rs988333716 4515 dbSNP
rs767414604 4524 dbSNP
rs1269949331 4525 dbSNP
rs1209642453 4538 dbSNP
rs1010496272 4539 dbSNP
rs1332359509 4548 dbSNP
rs535381285 4549 dbSNP
rs1212888762 4554 dbSNP
rs1226862345 4556 dbSNP
rs1349934270 4563 dbSNP
rs1024109946 4566 dbSNP
rs567667757 4569 dbSNP
rs1488967825 4579 dbSNP
rs921030875 4581 dbSNP
rs1050824441 4583 dbSNP
rs1248431883 4591 dbSNP
rs906615977 4592 dbSNP
rs1166632400 4602 dbSNP
rs1418579717 4608 dbSNP
rs890780295 4609 dbSNP
rs553316829 4610 dbSNP
rs1182309457 4623 dbSNP
rs746261965 4625 dbSNP
rs1245464587 4630 dbSNP
rs959348483 4637 dbSNP
rs1186151949 4642 dbSNP
rs957614730 4644 dbSNP
rs984395966 4652 dbSNP
rs1350107382 4656 dbSNP
rs1328760455 4664 dbSNP
rs1268803885 4676 dbSNP
rs1230326996 4686 dbSNP
rs1365639813 4694 dbSNP
rs1272967549 4709 dbSNP
rs187167321 4714 dbSNP
rs545410999 4722 dbSNP
rs1327680426 4724 dbSNP
rs969532056 4725 dbSNP
rs1409938992 4732 dbSNP
rs973314449 4737 dbSNP
rs1035007887 4738 dbSNP
rs1401910219 4740 dbSNP
rs550140144 4744 dbSNP
rs563598852 4753 dbSNP
rs575705170 4766 dbSNP
rs1172490446 4775 dbSNP
rs141006855 4786 dbSNP
rs922791796 4804 dbSNP
rs1478650368 4806 dbSNP
rs1255211870 4816 dbSNP
rs1187097318 4823 dbSNP
rs1232452964 4826 dbSNP
rs1248853897 4830 dbSNP
rs1218258413 4835 dbSNP
rs755552388 4836 dbSNP
rs878882610 4836 dbSNP
rs960681151 4850 dbSNP
rs1305296109 4856 dbSNP
rs1225873658 4858 dbSNP
rs1273642312 4865 dbSNP
rs955333462 4884 dbSNP
rs1320806661 4888 dbSNP
rs780309074 4890 dbSNP
rs561593903 4901 dbSNP
rs935685234 4902 dbSNP
rs1332935294 4903 dbSNP
rs1054018853 4907 dbSNP
rs1223961719 4908 dbSNP
rs1415506712 4923 dbSNP
rs913150932 4938 dbSNP
rs945949365 4941 dbSNP
rs749452399 4947 dbSNP
rs1480319900 4949 dbSNP
rs1391236289 4953 dbSNP
rs921429788 4955 dbSNP
rs1482403568 4960 dbSNP
rs866201025 4971 dbSNP
rs907030209 4987 dbSNP
rs144848297 4988 dbSNP
rs1474553769 4993 dbSNP
rs932444691 5001 dbSNP
rs1226180981 5005 dbSNP
rs547319829 5014 dbSNP
rs1055196459 5029 dbSNP
rs895209349 5032 dbSNP
rs1298078584 5038 dbSNP
rs1215892485 5039 dbSNP
rs1005569834 5040 dbSNP
rs1283034267 5042 dbSNP
rs912288045 5044 dbSNP
rs570085327 5060 dbSNP
rs1036658072 5071 dbSNP
rs768723969 5072 dbSNP
rs774373818 5082 dbSNP
rs1353585687 5084 dbSNP
rs995819574 5086 dbSNP
rs994421018 5099 dbSNP
rs905674393 5100 dbSNP
rs559278810 5101 dbSNP
rs1476226360 5107 dbSNP
rs1030271203 5109 dbSNP
rs1202862034 5116 dbSNP
rs532763472 5118 dbSNP
rs1353469345 5119 dbSNP
rs568753172 5134 dbSNP
rs1206389274 5138 dbSNP
rs551370665 5151 dbSNP
rs1288659003 5152 dbSNP
rs1009532701 5153 dbSNP
rs1356799483 5165 dbSNP
rs1381015933 5184 dbSNP
rs1285919661 5192 dbSNP
rs1409713098 5198 dbSNP
rs1020903475 5207 dbSNP
rs968368952 5210 dbSNP
rs1456686426 5213 dbSNP
rs980077135 5222 dbSNP
rs1293678995 5226 dbSNP
rs1463221983 5232 dbSNP
rs1409763079 5233 dbSNP
rs192411116 5239 dbSNP
rs1181590078 5244 dbSNP
rs1472195860 5247 dbSNP
rs985568214 5267 dbSNP
rs1205956762 5270 dbSNP
rs954370760 5274 dbSNP
rs537191632 5275 dbSNP
rs1487378507 5279 dbSNP
rs986945480 5280 dbSNP
rs1484739831 5281 dbSNP
rs1336539507 5285 dbSNP
rs1210713819 5296 dbSNP
rs910982010 5297 dbSNP
rs957082534 5302 dbSNP
rs1309785491 5307 dbSNP
rs549590764 5307 dbSNP
rs1357842090 5312 dbSNP
rs912897402 5313 dbSNP
rs945989814 5315 dbSNP
rs567894041 5319 dbSNP
rs1044691926 5324 dbSNP
rs1386751757 5324 dbSNP
rs149946475 5324 dbSNP
rs1449758685 5325 dbSNP
rs1365676082 5329 dbSNP
rs905750449 5334 dbSNP
rs16958730 5337 dbSNP
rs1266363172 5342 dbSNP
rs553365428 5346 dbSNP
rs760446544 5359 dbSNP
rs1469689652 5371 dbSNP
rs1245784580 5374 dbSNP
rs1207800776 5378 dbSNP
rs1485903017 5382 dbSNP
rs539099857 5385 dbSNP
rs1231625157 5399 dbSNP
rs1337556012 5403 dbSNP
rs1312152051 5427 dbSNP
rs1009604719 5433 dbSNP
rs1236919881 5445 dbSNP
rs1363515903 5450 dbSNP
rs1320137569 5452 dbSNP
rs1383045362 5453 dbSNP
rs578210568 5456 dbSNP
rs1020935902 5459 dbSNP
rs538617373 5473 dbSNP
rs1000847114 5476 dbSNP
rs183362168 5496 dbSNP
rs1364721447 5500 dbSNP
rs1455421815 5505 dbSNP
rs954283977 5516 dbSNP
rs1187482197 5519 dbSNP
rs1447225199 5521 dbSNP
rs986973311 5530 dbSNP
rs1019784361 5536 dbSNP
rs151298841 5538 dbSNP
rs1300101583 5541 dbSNP
rs1213726331 5545 dbSNP
rs1340461547 5549 dbSNP
rs1297338358 5551 dbSNP
rs1228340903 5558 dbSNP
rs1345767187 5562 dbSNP
rs1038810035 5564 dbSNP
rs897140725 5602 dbSNP
rs972456195 5613 dbSNP
rs919630557 5620 dbSNP
rs1313399824 5621 dbSNP
rs994848751 5623 dbSNP
rs1029931492 5629 dbSNP
rs1167137480 5632 dbSNP
rs542751897 5634 dbSNP
rs1475507986 5642 dbSNP
rs1374410457 5647 dbSNP
rs979768464 5650 dbSNP
rs561526760 5656 dbSNP
rs927211532 5657 dbSNP
rs75631901 5666 dbSNP
rs1482362093 5667 dbSNP
rs1274308647 5668 dbSNP
rs1444700013 5673 dbSNP
rs1018360504 5679 dbSNP
rs1214072231 5691 dbSNP
rs540848568 5694 dbSNP
rs187560861 5695 dbSNP
rs1341960149 5697 dbSNP
rs1263898462 5706 dbSNP
rs1465634421 5712 dbSNP
rs533265317 5734 dbSNP
rs753547197 5735 dbSNP
rs1392900569 5736 dbSNP
rs1453241902 5740 dbSNP
rs1020400435 5741 dbSNP
rs1172699742 5745 dbSNP
rs1432927146 5752 dbSNP
rs1398443831 5754 dbSNP
rs1161082168 5756 dbSNP
rs891612419 5758 dbSNP
rs1427179574 5772 dbSNP
rs967053371 5777 dbSNP
rs1417866952 5780 dbSNP
rs1398943010 5781 dbSNP
rs1166504452 5784 dbSNP
rs981492024 5785 dbSNP
rs928582337 5788 dbSNP
rs1471353391 5799 dbSNP
rs1251689938 5802 dbSNP
rs945495395 5810 dbSNP
rs1299966852 5812 dbSNP
rs551087874 5820 dbSNP
rs1265729420 5827 dbSNP
rs1209399748 5828 dbSNP
rs1335770922 5850 dbSNP
rs1275073254 5851 dbSNP
rs1042466321 5852 dbSNP
rs533062137 5857 dbSNP
rs1278876879 5864 dbSNP
rs1001278011 5869 dbSNP
rs190059153 5881 dbSNP
rs1321343656 5882 dbSNP
rs571385018 5884 dbSNP
rs549127738 5885 dbSNP
rs567393853 5886 dbSNP
rs941453563 5887 dbSNP
rs1406683210 5894 dbSNP
rs1008480149 5897 dbSNP
rs1038435513 5900 dbSNP
rs528665330 5906 dbSNP
rs374898417 5907 dbSNP
rs1019815792 5909 dbSNP
rs1207129517 5920 dbSNP
rs930004480 5925 dbSNP
rs1051499494 5926 dbSNP
rs533842515 5939 dbSNP
rs1464486138 5942 dbSNP
rs1347234311 5949 dbSNP
rs891378480 5956 dbSNP
rs1285060324 5960 dbSNP
rs961524615 5966 dbSNP
rs1224204994 5968 dbSNP
rs1352787251 5969 dbSNP
rs1272807191 5983 dbSNP
rs547182893 5993 dbSNP
rs1233255695 5999 dbSNP
rs994308390 6000 dbSNP
rs753389310 6001 dbSNP
rs1268083431 6003 dbSNP
rs35653136 6014 dbSNP
rs571803766 6014 dbSNP
rs952455292 6049 dbSNP
rs1018434582 6056 dbSNP
rs1344028458 6068 dbSNP
rs1318447402 6072 dbSNP
rs1402905562 6081 dbSNP
rs1330180765 6083 dbSNP
rs893293819 6090 dbSNP
rs980210038 6091 dbSNP
rs1454975636 6092 dbSNP
rs1011767429 6096 dbSNP
rs1467807143 6097 dbSNP
rs1198941873 6098 dbSNP
rs1186847442 6099 dbSNP
rs1475211145 6100 dbSNP
rs1242733214 6105 dbSNP
rs553601290 6106 dbSNP
rs1440811546 6124 dbSNP
rs959971033 6138 dbSNP
rs967504091 6145 dbSNP
rs1210149629 6162 dbSNP
rs1348256835 6169 dbSNP
rs1305367323 6172 dbSNP
rs557067547 6175 dbSNP
rs1035352729 6178 dbSNP
rs913124066 6179 dbSNP
rs1432247026 6183 dbSNP
rs945903014 6193 dbSNP
rs1312787182 6195 dbSNP
rs958645148 6196 dbSNP
rs1042859466 6206 dbSNP
rs1167134034 6212 dbSNP
rs991391824 6219 dbSNP
rs925369200 6222 dbSNP
rs1420465366 6224 dbSNP
rs1188578276 6227 dbSNP
rs1458598142 6229 dbSNP
rs909069207 6233 dbSNP
rs1256916042 6246 dbSNP
rs941859818 6247 dbSNP
rs1485978472 6265 dbSNP
rs1050225835 6267 dbSNP
rs1392536536 6267 dbSNP
rs889773842 6269 dbSNP
rs1306748893 6290 dbSNP
rs559959651 6305 dbSNP
rs1404924831 6309 dbSNP
rs972277566 6314 dbSNP
rs1332865705 6321 dbSNP
rs764865300 6323 dbSNP
rs752306975 6325 dbSNP
rs1376268322 6327 dbSNP
rs1292137168 6355 dbSNP
rs1008511413 6368 dbSNP
rs1357938302 6374 dbSNP
rs930010425 6383 dbSNP
rs34218179 6387 dbSNP
rs1215149697 6392 dbSNP
rs897386619 6394 dbSNP
rs990239452 6404 dbSNP
rs182714780 6406 dbSNP
rs1051143947 6409 dbSNP
rs1403818789 6415 dbSNP
rs1417208489 6423 dbSNP
rs1165785153 6433 dbSNP
rs1476257557 6436 dbSNP
rs536322210 6438 dbSNP
rs942986345 6444 dbSNP
rs187324505 6445 dbSNP
rs1001275215 6451 dbSNP
rs1233252923 6452 dbSNP
rs1351688139 6453 dbSNP
rs1332263315 6455 dbSNP
rs573593405 6455 dbSNP
rs1233338934 6460 dbSNP
rs1336357274 6466 dbSNP
rs959714316 6470 dbSNP
rs757898379 6483 dbSNP
rs1271732556 6490 dbSNP
rs1374427180 6491 dbSNP
rs1300299812 6494 dbSNP
rs77079628 6501 dbSNP
rs1011760414 6506 dbSNP
rs139326531 6507 dbSNP
rs1291619920 6509 dbSNP
rs540827307 6512 dbSNP
rs756443797 6518 dbSNP
rs556104134 6520 dbSNP
rs1156764832 6530 dbSNP
rs1418431962 6537 dbSNP
rs1178751298 6539 dbSNP
rs1467006761 6539 dbSNP
rs1252410788 6542 dbSNP
rs1473564074 6545 dbSNP
rs191422319 6546 dbSNP
rs1213998061 6559 dbSNP
rs780327732 6565 dbSNP
rs760115546 6571 dbSNP
rs1458249008 6576 dbSNP
rs1003027050 6579 dbSNP
rs925804516 6582 dbSNP
rs936773878 6586 dbSNP
rs1309850958 6591 dbSNP
rs184602326 6593 dbSNP
rs1304417961 6595 dbSNP
rs577851990 6595 dbSNP
rs35016022 6598 dbSNP
rs398029806 6598 dbSNP
rs958341519 6598 dbSNP
rs1408243985 6600 dbSNP
rs147461630 6601 dbSNP
rs1012563171 6605 dbSNP
rs1161252056 6621 dbSNP
rs1452335386 6628 dbSNP
rs749540446 6645 dbSNP
rs1193804913 6657 dbSNP
rs1455332936 6680 dbSNP
rs963588652 6692 dbSNP
rs1258999009 6695 dbSNP
rs971923906 6698 dbSNP
rs1371702433 6708 dbSNP
rs1412161218 6710 dbSNP
rs919080095 6711 dbSNP
rs1209429980 6713 dbSNP
rs951530911 6724 dbSNP
rs1246014909 6725 dbSNP
rs1236718887 6726 dbSNP
rs1205350160 6731 dbSNP
rs1295184679 6734 dbSNP
rs1382817198 6735 dbSNP
rs1364254544 6737 dbSNP
rs987277513 6751 dbSNP
rs545322321 6753 dbSNP
rs912589037 6772 dbSNP
rs1432792531 6773 dbSNP
rs942724839 6785 dbSNP
rs994427554 6790 dbSNP
rs1039651116 6796 dbSNP
rs888609765 6809 dbSNP
rs1192114823 6810 dbSNP
rs1002081476 6818 dbSNP
rs1263232148 6828 dbSNP
rs1337086788 6831 dbSNP
rs1485647918 6833 dbSNP
rs1281429698 6842 dbSNP
rs1034123328 6843 dbSNP
rs1337898168 6848 dbSNP
rs1250964953 6850 dbSNP
rs780599133 6851 dbSNP
rs866003127 6857 dbSNP
rs1291549406 6859 dbSNP
rs1274654873 6867 dbSNP
rs117660492 6868 dbSNP
rs1462180212 6868 dbSNP
rs200699081 6868 dbSNP
rs895532191 6868 dbSNP
rs563253155 6869 dbSNP
rs1208590441 6876 dbSNP
rs552555738 6878 dbSNP
rs947589094 6879 dbSNP
rs1258790440 6880 dbSNP
rs1041923283 6881 dbSNP
rs978680891 6882 dbSNP
rs1250266214 6884 dbSNP
rs1189405436 6891 dbSNP
rs1196564069 6892 dbSNP
rs866887611 6900 dbSNP
rs1481756212 6902 dbSNP
rs1370410233 6909 dbSNP
rs903336228 6912 dbSNP
rs1168215996 6929 dbSNP
rs1390794629 6932 dbSNP
rs530490249 6934 dbSNP
rs1311545278 6937 dbSNP
rs747418597 6938 dbSNP
rs1333695044 6941 dbSNP
rs246129 6955 dbSNP
rs779083754 6971 dbSNP
rs1401992138 6972 dbSNP
rs1396945982 6985 dbSNP
rs894198877 6986 dbSNP
rs371768179 6993 dbSNP
rs1206244692 6997 dbSNP
rs944069172 7000 dbSNP
rs1418022121 7008 dbSNP
rs976788990 7010 dbSNP
rs1227124837 7014 dbSNP
rs1469082508 7027 dbSNP
rs1363535333 7036 dbSNP
rs918573766 7040 dbSNP
rs930250916 7048 dbSNP
rs1012593432 7049 dbSNP
rs888674143 7050 dbSNP
rs1015896991 7063 dbSNP
rs545834670 7064 dbSNP
rs1251372780 7073 dbSNP
rs1213369389 7075 dbSNP
rs560928122 7076 dbSNP
rs758728326 7077 dbSNP
rs1468927448 7080 dbSNP
rs1343612875 7088 dbSNP
rs1211520167 7089 dbSNP
rs963363948 7094 dbSNP
rs1348478282 7102 dbSNP
rs1255308698 7110 dbSNP
rs993816727 7118 dbSNP
rs1026177016 7128 dbSNP
rs1055857697 7135 dbSNP
rs1378920119 7136 dbSNP
rs895605740 7137 dbSNP
rs1394523850 7138 dbSNP
rs954685740 7138 dbSNP
rs1324980887 7141 dbSNP
rs1019928827 7142 dbSNP
rs1384835270 7147 dbSNP
rs188723987 7148 dbSNP
rs1441919231 7151 dbSNP
rs1393676851 7163 dbSNP
rs1193175003 7176 dbSNP
rs1249398101 7187 dbSNP
rs193271890 7193 dbSNP
rs902834665 7197 dbSNP
rs1259334218 7206 dbSNP
rs987244496 7207 dbSNP
rs1464277832 7213 dbSNP
rs185047795 7218 dbSNP
rs1205703992 7220 dbSNP
rs1032946695 7229 dbSNP
rs964063461 7233 dbSNP
rs75096685 7236 dbSNP
rs1371251297 7245 dbSNP
rs985990116 7246 dbSNP
rs975388255 7255 dbSNP
rs1428035446 7260 dbSNP
rs1325407907 7262 dbSNP
rs76940144 7274 dbSNP
rs1422068118 7276 dbSNP
rs571849631 7289 dbSNP
rs1173425448 7305 dbSNP
rs1377557586 7308 dbSNP
rs532676868 7332 dbSNP
rs551282724 7334 dbSNP
rs1185065087 7337 dbSNP
rs1475117312 7351 dbSNP
rs1042342764 7352 dbSNP
rs748254042 7353 dbSNP
rs1194213272 7355 dbSNP
rs938861867 7361 dbSNP
rs910144527 7367 dbSNP
rs1209852383 7372 dbSNP
rs1057285312 7375 dbSNP
rs1280282550 7378 dbSNP
rs1055929857 7384 dbSNP
rs895968087 7385 dbSNP
rs1191191222 7394 dbSNP
rs894229884 7398 dbSNP
rs1366965948 7399 dbSNP
rs1402341968 7401 dbSNP
rs949829751 7403 dbSNP
rs948447680 7407 dbSNP
rs1361320204 7412 dbSNP
rs1300061503 7415 dbSNP
rs1037404104 7418 dbSNP
rs1423689324 7419 dbSNP
rs1312276152 7433 dbSNP
rs1409611798 7434 dbSNP
rs1420267451 7438 dbSNP
rs898815424 7439 dbSNP
rs117019089 7442 dbSNP
rs1258925103 7450 dbSNP
rs773038236 7453 dbSNP
rs1415578473 7459 dbSNP
rs760594858 7466 dbSNP
rs1328168110 7472 dbSNP
rs1238995785 7475 dbSNP
rs999866784 7476 dbSNP
rs1436890649 7478 dbSNP
rs1026671279 7479 dbSNP
rs1219897472 7479 dbSNP
rs1332112829 7490 dbSNP
rs371195229 7494 dbSNP
rs890351483 7495 dbSNP
rs75568930 7496 dbSNP
rs1296840696 7500 dbSNP