miRTarBase - #MIRT072822 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARIH1   
Synonyms ARI, HARI, HHARI, UBCH7BP
Description ariadne RBR E3 ubiquitin protein ligase 1
Transcript NM_005744   
Expression
Putative miRNA Targets on ARIH1
3'UTR of ARIH1
(miRNA target sites are highlighted)
>ARIH1|NM_005744|3'UTR
   1 GAATGGCCCTGCATAAAATGAACTCTGAAAACTTTACCATCTAGAGTGCTCATGCAATTAAAACAAAACAAACACAAACA
  81 AGGAGGCACTAAGCCTATTCTGACACCACTGGTCTGTAGTACCAGAATTGTTTTGTTAATGGAAAGTTTAAGTAAATTAT
 161 ATTGTAATAAAAAGGTAGATAAACCATTGTACAACAGTATTCTAGGCCACCAACAAAAGTGTGACAGACACACTAAAAGC
 241 CCTCCAACTTTAACTTGTAACGTAGCTTCATTCTCAAAGCTGACTCCTTTTTTTTCTTTTTCCTTTTCCTGAGTGTAGTA
 321 CAGTTAAAATTTCAAACAGCTCCTTGACACTGCTTTTCATGTTCAAACCAGCCATTTTGTTGTACTTTGGTAAAGGACCT
 401 CTTCCCCTTCCTCCCCTACACATACAGATACACCCACACACAGACTGACTCTCTTTCTCTCATACCCCAAGGTCATGAGT
 481 GAATGATGCTTAGTTCCTTGTAAAGAAAATCTTGGGATGGGGAAAGGGGTAGGCAGCAAGAGGATTCAACAAACGAAAAA
 561 CATAAAAACTTTGTATATGACTTTTAAAACAAGAGGACAACACAGTATTTTTCAAAATTGTATATAGCGCATATGCATGG
 641 ACAAAGCAAGCGTGGCACGTGTTTGCATAATGTTTAATTACAAAAAAATATTTATTCTTTAAAAATCTTCAAGATTATGT
 721 CTATTTGCTGTGCATTTTCTTTCAGTTTGCTTATCTTTCCCGGGTTGGGGTTGGGATAAAGGTGTGTCGGTTTAGCACCT
 801 CTGGAAGACCTATCTAGAGCTCTTTCACTTTCCTGAGGTTATTTTGCCCTTTCTGGTGTTGGTATGTCTGTTGCCGGCCA
 881 TGGGCCTCATGCCTTGAATTCCTGCTCTTGATCAGGGACAAGGGAGGTCAAGCTCTGACTAATGCCATGACCTGATTAAG
 961 GGGTACAGCAGGGAGTTTTGTTGCTACAGCTCATGAATTAACCTGTCCCAACCTAATCCCCCTCCATGGCATCATGCCTC
1041 TACCCAAGCCTTTGTGTGCCCATGTTATGCACACAGCTGTAGGCATTCTTAAGTCCCCTGTCGCATCCAGTGGAAGCATT
1121 TTAAAATTTCTTTTACTTTTTGGTTTTCCCTTAATTGCTGCTTTTCAGATTTTAGTTATGGCTCGTCTGCTCACCCCTTC
1201 TCTACATTAGGGTGTCAAAGAGAATGTTTTGCTTTAAATATAAATAGCCATTCATTTAGTCTCAGATTGTGAATTTAAAA
1281 TGGTGGATACCGAAATTGCTTGTGTGTGTTGCTGTGGGTTTGGTTTGAAGGCAAACACCCCTAGAACATGATATTCCCAT
1361 CTAGTGCATTTAAATAGAAATCACTGAGTTTGCTGCTTTTTTATTGTCAGCAGATAGGAGAATTAATAATGCATTTTAGC
1441 TGTGATGTCCATTTTTATGAAATTCCTACTAAGAGCTATGTTAAAAGTAAAGGATGGTGGTGGTTGTATTAACTATATAC
1521 CTGTTTAGGCCATTCTGGCTGTGGTATTTTTCAATAGGTCAGCATCTGTAAATCTGTCAGTTTTATACAGGAGTGCAGAG
1601 TGAACTAGGCAACTAGATTAAGAGGTCTAAATATGAAATACCAGTTGAGGCTGAGGACCTCTTCGTCTTCCTTTAAATGT
1681 CTTTTGCCTAGGGAGTGTTTACCATTTGTGAGGCAGCTTTGTCTGCTCTTACACTGTACATCCTATTACTCCATTGGGAA
1761 GTAGGTTCACTTTCCTCTGGCCTTTTGCCTAAGTTAGGCTTTGCTGAATCAACCCTACTTTTCCTTTTAGAAAAGGTTGT
1841 TACAGGAGATTTACTGGCAACTGTTCTTTTCCCATCAAAAATCAGTGAATGTTTGCTGAGTATAAATGCTGCTTCCTTAA
1921 ACCACTTGTCGCTTTAGGATCAACTTTACCTGTACCTTTTCTCCTTTCCTCCCTTGCCACCTCAGGTGCAAATCTGAACT
2001 CAGTGTCTGCTTCTTCCATTTTCTCGTCTCTCTCCCCTCTTCCCCCATTATCCATATGACATTATTTTACTTCAAATGAC
2081 AGCATCAATCTTAAAAAGATATACATTAAAACTAAGGAGTTTTTTTAAAGAAAGCCTGAATAAGTTCCTTTCCCTGGTAA
2161 CTTTGAAAAGCAGTCAGAGTTGCTATATAGATATATGTGGCTCCTTTAAAATGCTTTGTGTATGTGTGGTGTTTAAAAAA
2241 AAAAAATCTTACCAGTTAACTTTGCAGTGTCTAGGTTTGAGTGTCATAAATCCACGTGTTCCTGTTGCAACAAATACCCA
2321 AAAATTGTGTGTGCACTTCCTAATACCAGTCTTCACCCATGGAGGAACAGTGCTTTTTAGAGATGCTTTCTATTTCAATG
2401 TTGGCATACTGCCTGAGGGTATTGCAGTTGTGGGTGCATTCCCTAATTTGTATGATCAAGATGAACTGGCCCTTTTCTAC
2481 TTCCAAGCTTTTAACAGATACCACCATATTTGACAGAATTCCCAGAGTGAATTGCTTGTGTTATTAGTAGATTCAGTGCC
2561 CCCAGCTGGGATAGGCAAGCCATGACAGCTTCCCTGTTTCACCTACAGAAGTCTTATCTGAGGGATCTATTCACAGTAAG
2641 CACCAAGGTCTCCATGTCTTGAGGTCAGTTTCATTGTCTTTTGAAAAGTGCATGCTTCATTTGAACAATTCATTCAGCAG
2721 CAGATGGACTTTCAGTGATTTAAAATAAAATTTTGATCCAAAGCTCAGGACACAAACCACAGTGGTAAAATTGAGTAGCA
2801 TATAATATCAGACTAAATTATCTGTAATTTTCCACAACCCAGATTGTATGTGTTTTATGTGTGTTTAAATAAATATGTTA
2881 GATACACGTGTATACATACACCCATATACAACAGATCCAAGACTGGCTGACTTCATTTGAAATGGTTGAATCTGCTGTGT
2961 AATAAAGTGGTTCAACCATGATTAGGAACTGAAATTTAGTAGAAGAGGGAAAAGGAGTTAATGTAACAAATTATTTTAGC
3041 TACAAACCCCGGTAATAGAGCACTTGGGGGATGGGATGGGGTGGGTTGGTGAGACAATCAGAATGGTAAATTGATTAAAT
3121 GCTCCTAACCCTGTAATTTTGTGCATAGAGCACCCTATGCTGTGGAAATAACTGTTCTTAGATTTCATTGTAACTGGACT
3201 GTTCAGGTTGCCCAGAGGGAAAGAACATTCCTAATTCTAATAAAATAAACTTTTATTTTGTTAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAA--UACACGACGAu 5'
             |||:|| |  :| ||||||| 
Target 5' tagAAATCACTGAGTTTGCTGCTt 3'
1375 - 1398 161.00 -12.40
2
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || |||  ||||||| 
Target 5' ggttttCCCTTAATTGCTGCTt 3'
1142 - 1163 156.00 -10.70
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | :| :| ||  ||||||| 
Target 5' tgCTGAGTA-TAAATGCTGCTt 3'
1894 - 1914 147.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13637419 4 COSMIC
COSN31587005 21 COSMIC
COSN5400607 34 COSMIC
COSN30464082 45 COSMIC
COSN30144325 53 COSMIC
COSN19690825 55 COSMIC
COSN30128026 56 COSMIC
COSN30101294 59 COSMIC
COSN30104870 60 COSMIC
COSN26790082 160 COSMIC
COSN23014851 210 COSMIC
COSN20078211 213 COSMIC
COSN9638612 585 COSMIC
COSN6279522 1066 COSMIC
COSN191393 1130 COSMIC
COSN20092990 1186 COSMIC
COSN14999882 2003 COSMIC
COSN15662874 2083 COSMIC
COSN15662875 2085 COSMIC
COSN20112235 2247 COSMIC
COSN16806996 2327 COSMIC
COSN26699963 2794 COSMIC
COSN6279523 3269 COSMIC
COSN5400608 3292 COSMIC
COSN27771152 3300 COSMIC
COSN15846120 3327 COSMIC
COSN6279524 3539 COSMIC
COSN32065619 3545 COSMIC
COSN26731491 3909 COSMIC
COSN2381852 3939 COSMIC
COSN30468804 3944 COSMIC
COSN30157508 3978 COSMIC
COSN26587049 4006 COSMIC
COSN1081494 4012 COSMIC
COSN31537044 4014 COSMIC
COSN518187 4025 COSMIC
COSN1683882 4094 COSMIC
COSN2493455 4657 COSMIC
COSN22705761 4899 COSMIC
COSN26325772 4988 COSMIC
COSN25860466 5285 COSMIC
COSN17425219 5395 COSMIC
COSN6279525 6395 COSMIC
COSN29211805 6408 COSMIC
COSN32091895 6600 COSMIC
COSN1683883 7297 COSMIC
COSN27126441 7305 COSMIC
COSN22550637 7358 COSMIC
COSN15948815 7401 COSMIC
COSN25031613 7429 COSMIC
COSN16044820 7866 COSMIC
COSN26007310 7992 COSMIC
COSN4621831 8300 COSMIC
COSN1683884 8379 COSMIC
COSN8477552 8679 COSMIC
COSN29081694 8806 COSMIC
COSN28457873 9567 COSMIC
COSN5400610 9781 COSMIC
COSN22310306 10035 COSMIC
COSN8477553 10036 COSMIC
COSN15780748 10472 COSMIC
COSN24709989 10896 COSMIC
COSN6279526 10939 COSMIC
COSN9091032 11443 COSMIC
COSN21777330 12023 COSMIC
COSN21067933 12184 COSMIC
COSN22221735 12451 COSMIC
COSN27346684 12535 COSMIC
COSN24909469 13952 COSMIC
COSN27584389 14150 COSMIC
COSN5400611 14173 COSMIC
COSN1683885 14577 COSMIC
COSN25707760 14619 COSMIC
COSN16983530 14948 COSMIC
COSN8390002 15189 COSMIC
COSN16678305 15440 COSMIC
COSN22250138 16025 COSMIC
COSN29173584 16153 COSMIC
COSN15876474 16336 COSMIC
COSN17936019 16370 COSMIC
COSN22016855 16797 COSMIC
COSN7248075 16955 COSMIC
COSN22764117 17171 COSMIC
COSN24639600 17250 COSMIC
COSN7248076 17977 COSMIC
COSN23755856 18080 COSMIC
COSN1683886 18671 COSMIC
COSN16190575 18759 COSMIC
COSN22528639 18793 COSMIC
COSN16649087 18943 COSMIC
COSN5400612 18995 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1411307546 2 dbSNP
rs760259562 3 dbSNP
rs373702159 4 dbSNP
rs1473856879 8 dbSNP
rs1417865171 10 dbSNP
rs1158121438 14 dbSNP
rs536363940 19 dbSNP
rs754636589 20 dbSNP
rs1325495620 24 dbSNP
rs1329100317 33 dbSNP
rs765112850 39 dbSNP
rs752607588 40 dbSNP
rs14636 42 dbSNP
rs1237579763 44 dbSNP
rs1420810539 50 dbSNP
rs879240405 55 dbSNP
rs1017771075 60 dbSNP
rs1179902070 65 dbSNP
rs1221689454 87 dbSNP
rs1409944378 89 dbSNP
rs1285873305 113 dbSNP
rs1230221725 117 dbSNP
rs1351016894 123 dbSNP
rs902036291 132 dbSNP
rs1384828831 135 dbSNP
rs568813956 140 dbSNP
rs998082245 141 dbSNP
rs1021064677 143 dbSNP
rs967195032 148 dbSNP
rs185130672 159 dbSNP
rs1462137408 160 dbSNP
rs1052829038 161 dbSNP
rs979492152 165 dbSNP
rs1459575014 176 dbSNP
rs369951566 182 dbSNP
rs539036758 186 dbSNP
rs1364813012 207 dbSNP
rs778716277 209 dbSNP
rs4777517 210 dbSNP
rs1408589665 215 dbSNP
rs1464156944 216 dbSNP
rs1486075586 217 dbSNP
rs1265756130 223 dbSNP
rs917810917 228 dbSNP
rs1209990053 234 dbSNP
rs1351310925 239 dbSNP
rs1290720748 243 dbSNP
rs949227963 249 dbSNP
rs972959728 255 dbSNP
rs1310943880 257 dbSNP
rs1313781907 262 dbSNP
rs536843890 263 dbSNP
rs1319585991 264 dbSNP
rs1441991705 265 dbSNP
rs558463978 276 dbSNP
rs1006892580 278 dbSNP
rs1020126716 284 dbSNP
rs1437319752 287 dbSNP
rs1172555507 288 dbSNP
rs931046888 288 dbSNP
rs1291936997 297 dbSNP
rs1482425954 303 dbSNP
rs1203022254 304 dbSNP
rs901289485 308 dbSNP
rs994570324 312 dbSNP
rs1048106746 319 dbSNP
rs1174638299 322 dbSNP
rs1448511227 336 dbSNP
rs1245745414 338 dbSNP
rs551708955 348 dbSNP
rs1234516196 349 dbSNP
rs1189971718 352 dbSNP
rs1480883558 362 dbSNP
rs1254834698 364 dbSNP
rs1198730261 365 dbSNP
rs1484188135 367 dbSNP
rs1181069715 372 dbSNP
rs1025666486 378 dbSNP
rs1280802173 385 dbSNP
rs1411302745 387 dbSNP
rs150376988 389 dbSNP
rs534565281 390 dbSNP
rs1295614822 396 dbSNP
rs1230856766 397 dbSNP
rs889450655 399 dbSNP
rs1164427785 400 dbSNP
rs942343536 406 dbSNP
rs1394858344 408 dbSNP
rs1039292108 412 dbSNP
rs553351636 416 dbSNP
rs1389672509 421 dbSNP
rs997736228 423 dbSNP
rs1021533626 427 dbSNP
rs902647201 432 dbSNP
rs984718908 434 dbSNP
rs1309868373 445 dbSNP
rs189615573 448 dbSNP
rs1184708144 449 dbSNP
rs1444071215 450 dbSNP
rs756691332 452 dbSNP
rs1447894238 454 dbSNP
rs1204207485 456 dbSNP
rs778836795 458 dbSNP
rs979994287 460 dbSNP
rs1276475744 462 dbSNP
rs928371655 464 dbSNP
rs959372630 466 dbSNP
rs990806179 485 dbSNP
rs959841034 487 dbSNP
rs988871540 504 dbSNP
rs1024919926 512 dbSNP
rs912914505 514 dbSNP
rs953491525 522 dbSNP
rs947618288 526 dbSNP
rs1315308391 529 dbSNP
rs972624810 530 dbSNP
rs1340920227 545 dbSNP
rs180767928 555 dbSNP
rs1310229177 556 dbSNP
rs1389484198 557 dbSNP
rs952535396 559 dbSNP
rs1043294309 565 dbSNP
rs1274410468 566 dbSNP
rs1417923102 570 dbSNP
rs371637068 573 dbSNP
rs1308036369 576 dbSNP
rs750345690 582 dbSNP
rs1182183562 587 dbSNP
rs911358803 589 dbSNP
rs1438612197 591 dbSNP
rs768685327 591 dbSNP
rs1208153916 604 dbSNP
rs1235570987 604 dbSNP
rs1337099531 615 dbSNP
rs563770547 630 dbSNP
rs1273889213 636 dbSNP
rs1462461267 639 dbSNP
rs866402408 653 dbSNP
rs1247658097 660 dbSNP
rs910960686 662 dbSNP
rs1443337534 667 dbSNP
rs942851933 670 dbSNP
rs942395614 671 dbSNP
rs1321233271 682 dbSNP
rs1462664113 682 dbSNP
rs1040686713 689 dbSNP
rs923560009 689 dbSNP
rs1455588758 690 dbSNP
rs933577061 702 dbSNP
rs1420258600 705 dbSNP
rs1042606302 723 dbSNP
rs1041252820 724 dbSNP
rs1174542001 735 dbSNP
rs1469986379 739 dbSNP
rs1053901364 740 dbSNP
rs186712460 749 dbSNP
rs901232939 754 dbSNP
rs1453824506 756 dbSNP
rs895212803 761 dbSNP
rs1320237400 762 dbSNP
rs1012292549 763 dbSNP
rs1432386166 765 dbSNP
rs994291526 772 dbSNP
rs546431757 774 dbSNP
rs970717525 781 dbSNP
rs776701396 782 dbSNP
rs888465938 783 dbSNP
rs1025534091 784 dbSNP
rs1006101796 789 dbSNP
rs1016197006 790 dbSNP
rs952683526 797 dbSNP
rs970001809 799 dbSNP
rs554167457 807 dbSNP
rs564624188 813 dbSNP
rs1395878766 814 dbSNP
rs1035558512 819 dbSNP
rs1188030468 824 dbSNP
rs1463639506 826 dbSNP
rs1387534417 827 dbSNP
rs960030309 829 dbSNP
rs7495607 834 dbSNP
rs988597748 839 dbSNP
rs963759292 863 dbSNP
rs1442335488 865 dbSNP
rs866674128 871 dbSNP
rs376687341 876 dbSNP
rs1296349513 877 dbSNP
rs922276450 880 dbSNP
rs1187988662 881 dbSNP
rs978434680 885 dbSNP
rs16957159 891 dbSNP
rs549351411 892 dbSNP
rs1435051093 897 dbSNP
rs1389298325 908 dbSNP
rs1168243254 910 dbSNP
rs559335617 910 dbSNP
rs1426955376 915 dbSNP
rs1421810390 920 dbSNP
rs138123784 922 dbSNP
rs748343049 928 dbSNP
rs1472759979 948 dbSNP
rs566726020 950 dbSNP
rs1470548954 951 dbSNP
rs1213490382 954 dbSNP
rs1053954612 961 dbSNP
rs1274325137 962 dbSNP
rs895265225 964 dbSNP
rs1012343454 967 dbSNP
rs34202599 971 dbSNP
rs1046477120 977 dbSNP
rs1386844862 979 dbSNP
rs534025749 987 dbSNP
rs536708657 988 dbSNP
rs1047180999 1004 dbSNP
rs1295106480 1018 dbSNP
rs551953545 1019 dbSNP
rs1415291657 1029 dbSNP
rs1369793631 1036 dbSNP
rs1435109398 1037 dbSNP
rs1305937483 1038 dbSNP
rs888413683 1043 dbSNP
rs1356429785 1045 dbSNP
rs1171260979 1049 dbSNP
rs1272514244 1051 dbSNP
rs570282075 1057 dbSNP
rs1005553543 1063 dbSNP
rs1415734128 1072 dbSNP
rs1190745503 1080 dbSNP
rs1045114504 1085 dbSNP
rs1251567282 1086 dbSNP
rs1175782333 1088 dbSNP
rs905762636 1093 dbSNP
rs748451903 1096 dbSNP
rs1220346470 1101 dbSNP
rs994151453 1102 dbSNP
rs796299119 1104 dbSNP
rs1287545092 1106 dbSNP
rs1233884509 1108 dbSNP
rs959903943 1111 dbSNP
rs769927629 1113 dbSNP
rs1285208184 1116 dbSNP
rs1451197481 1117 dbSNP
rs1219466525 1127 dbSNP
rs78355178 1129 dbSNP
rs1481061611 1130 dbSNP
rs376380971 1131 dbSNP
rs968476512 1133 dbSNP
rs1410265372 1134 dbSNP
rs552972419 1140 dbSNP
rs976488944 1145 dbSNP
rs1167125734 1160 dbSNP
rs1462433058 1168 dbSNP
rs142601417 1176 dbSNP
rs1471357858 1180 dbSNP
rs535475141 1184 dbSNP
rs1411826764 1185 dbSNP
rs972753008 1186 dbSNP
rs1396382585 1187 dbSNP
rs1421301481 1198 dbSNP
rs1025979105 1199 dbSNP
rs1017922891 1205 dbSNP
rs1404352675 1207 dbSNP
rs1190339751 1209 dbSNP
rs1300772329 1217 dbSNP
rs144759193 1219 dbSNP
rs1405527572 1225 dbSNP
rs967476555 1241 dbSNP
rs1307338557 1254 dbSNP
rs959734119 1265 dbSNP
rs749380520 1274 dbSNP
rs977049084 1284 dbSNP
rs1333826828 1286 dbSNP
rs922722067 1292 dbSNP
rs1240937568 1293 dbSNP
rs1317335612 1305 dbSNP
rs1279854967 1307 dbSNP
rs1368971759 1308 dbSNP
rs1328045809 1312 dbSNP
rs1441672254 1313 dbSNP
rs575811646 1313 dbSNP
rs1355946207 1327 dbSNP
rs1226770426 1336 dbSNP
rs1455801988 1352 dbSNP
rs1364796824 1357 dbSNP
rs866782360 1373 dbSNP
rs1294103331 1383 dbSNP
rs1490524453 1387 dbSNP
rs977096489 1388 dbSNP
rs924226372 1391 dbSNP
rs930167800 1398 dbSNP
rs1396468162 1415 dbSNP
rs1193740477 1416 dbSNP
rs989696094 1427 dbSNP
rs982982184 1433 dbSNP
rs909950615 1440 dbSNP
rs1440002920 1443 dbSNP
rs1486144293 1448 dbSNP
rs796525484 1452 dbSNP
rs948176520 1459 dbSNP
rs1368209467 1469 dbSNP
rs1364634470 1472 dbSNP
rs1472290589 1472 dbSNP
rs1293507787 1493 dbSNP
rs1046528064 1501 dbSNP
rs1386226264 1516 dbSNP
rs191147934 1527 dbSNP
rs557264137 1533 dbSNP
rs930008930 1540 dbSNP
rs1386630584 1551 dbSNP
rs1424729407 1555 dbSNP
rs1370897464 1558 dbSNP
rs546292521 1564 dbSNP
rs775067923 1577 dbSNP
rs1047052165 1578 dbSNP
rs888413059 1581 dbSNP
rs1429083389 1591 dbSNP
rs1167356744 1597 dbSNP
rs1045059334 1601 dbSNP
rs1005428797 1602 dbSNP
rs1208615123 1603 dbSNP
rs564686937 1612 dbSNP
rs1393020860 1625 dbSNP
rs577062248 1626 dbSNP
rs1211939200 1629 dbSNP
rs1338919177 1638 dbSNP
rs1329316375 1640 dbSNP
rs1339627888 1643 dbSNP
rs905212315 1644 dbSNP
rs1327551727 1655 dbSNP
rs17752969 1665 dbSNP
rs1317420246 1666 dbSNP
rs772539229 1669 dbSNP
rs559550196 1675 dbSNP
rs1057058711 1679 dbSNP
rs1313853434 1685 dbSNP
rs997962436 1687 dbSNP
rs183852898 1703 dbSNP
rs1029849999 1714 dbSNP
rs761060866 1724 dbSNP
rs1010024470 1733 dbSNP
rs1196865411 1734 dbSNP
rs1367350402 1737 dbSNP
rs1185802798 1743 dbSNP
rs1476139681 1751 dbSNP
rs1020095247 1755 dbSNP
rs904266216 1758 dbSNP
rs977524698 1759 dbSNP
rs1181108799 1765 dbSNP
rs1032686253 1771 dbSNP
rs999913716 1777 dbSNP
rs1271085779 1781 dbSNP
rs956985632 1782 dbSNP
rs1340199556 1795 dbSNP
rs1272617295 1797 dbSNP
rs1018332127 1812 dbSNP
rs1337507806 1813 dbSNP
rs1294293431 1814 dbSNP
rs989748120 1815 dbSNP
rs149276027 1818 dbSNP
rs1330525162 1819 dbSNP
rs1391612325 1827 dbSNP
rs1389460643 1829 dbSNP
rs1444800282 1834 dbSNP
rs1162101984 1836 dbSNP
rs555591670 1837 dbSNP
rs1462953814 1844 dbSNP
rs948228666 1851 dbSNP
rs982301189 1854 dbSNP
rs1468453234 1862 dbSNP
rs1136802 1867 dbSNP
rs572590054 1877 dbSNP
rs865966591 1893 dbSNP
rs1184326849 1894 dbSNP
rs1438592504 1897 dbSNP
rs765834118 1913 dbSNP
rs1211822315 1916 dbSNP
rs1337615436 1923 dbSNP
rs930086251 1924 dbSNP
rs144475179 1926 dbSNP
rs541508064 1931 dbSNP
rs867849436 1936 dbSNP
rs1168391420 1944 dbSNP
rs28649484 1945 dbSNP
rs188187817 1951 dbSNP
rs1281624915 1953 dbSNP
rs191074688 1954 dbSNP
rs1323348427 1958 dbSNP
rs1442403701 1970 dbSNP
rs1394545208 1972 dbSNP
rs1317603717 1979 dbSNP
rs1468023158 1981 dbSNP
rs910065778 2011 dbSNP
rs1338389526 2014 dbSNP
rs941403177 2018 dbSNP
rs980856736 2024 dbSNP
rs926584730 2026 dbSNP
rs528272826 2027 dbSNP
rs1352243942 2029 dbSNP
rs774703546 2033 dbSNP
rs1470636050 2037 dbSNP
rs1394659997 2038 dbSNP
rs546916151 2043 dbSNP
rs945994030 2044 dbSNP
rs568275612 2047 dbSNP
rs1039625867 2050 dbSNP
rs1293584966 2053 dbSNP
rs1041501632 2055 dbSNP
rs371061475 2059 dbSNP
rs899741429 2076 dbSNP
rs1228880286 2079 dbSNP
rs1445720645 2083 dbSNP
rs1286788754 2089 dbSNP
rs1255912404 2103 dbSNP
rs115691230 2105 dbSNP
rs1346733020 2106 dbSNP
rs999861517 2108 dbSNP
rs1235999943 2118 dbSNP
rs530140295 2120 dbSNP
rs1018030832 2127 dbSNP
rs141628879 2131 dbSNP
rs1428562431 2137 dbSNP
rs1346823773 2149 dbSNP
rs1318760376 2150 dbSNP
rs899614980 2154 dbSNP
rs1373363084 2169 dbSNP
rs1172079938 2173 dbSNP
rs1455736247 2183 dbSNP
rs1187514354 2188 dbSNP
rs1259101432 2193 dbSNP
rs796570682 2194 dbSNP
rs1244290304 2195 dbSNP
rs183280849 2196 dbSNP
rs187807452 2197 dbSNP
rs531740411 2205 dbSNP
rs150703476 2210 dbSNP
rs1029771671 2222 dbSNP
rs1212643864 2227 dbSNP
rs1377011229 2228 dbSNP
rs767704456 2233 dbSNP
rs1479376849 2234 dbSNP
rs1364014122 2235 dbSNP
rs1414090270 2235 dbSNP
rs559389283 2235 dbSNP
rs1436825430 2236 dbSNP
rs957037612 2238 dbSNP
rs951580755 2244 dbSNP
rs1169860411 2248 dbSNP
rs1012573642 2251 dbSNP
rs1023934790 2257 dbSNP
rs750398967 2264 dbSNP
rs573430176 2274 dbSNP
rs1287329829 2275 dbSNP
rs1190430430 2277 dbSNP
rs540459737 2286 dbSNP
rs1201970030 2305 dbSNP
rs951608013 2319 dbSNP
rs981380072 2321 dbSNP
rs191556936 2322 dbSNP
rs1232616767 2328 dbSNP
rs909958235 2332 dbSNP
rs1300600477 2348 dbSNP
rs766291337 2358 dbSNP
rs961096675 2363 dbSNP
rs941389608 2371 dbSNP
rs1225841725 2374 dbSNP
rs1297858630 2386 dbSNP
rs992161436 2391 dbSNP
rs1356408343 2397 dbSNP
rs1039675276 2399 dbSNP
rs1461382698 2405 dbSNP
rs1416276220 2407 dbSNP
rs1167578785 2408 dbSNP
rs564056954 2414 dbSNP
rs1175180647 2415 dbSNP
rs763707639 2432 dbSNP
rs141006963 2439 dbSNP
rs945945508 2447 dbSNP
rs933931058 2450 dbSNP
rs1258565475 2451 dbSNP
rs753555089 2453 dbSNP
rs1051413189 2467 dbSNP
rs1041620433 2469 dbSNP
rs925755705 2471 dbSNP
rs935829630 2472 dbSNP
rs16957161 2478 dbSNP
rs1054239483 2480 dbSNP
rs1316189662 2486 dbSNP
rs1304577759 2487 dbSNP
rs1267506950 2493 dbSNP
rs532649256 2504 dbSNP
rs1375714929 2515 dbSNP
rs1332163908 2530 dbSNP
rs773445732 2534 dbSNP
rs1440199831 2535 dbSNP
rs1392346627 2539 dbSNP
rs1328599429 2541 dbSNP
rs1201463378 2544 dbSNP
rs562957982 2547 dbSNP
rs1363598997 2563 dbSNP
rs998355740 2566 dbSNP
rs1012624343 2567 dbSNP
rs978631799 2568 dbSNP
rs1156601041 2570 dbSNP
rs925808865 2577 dbSNP
rs1380483091 2581 dbSNP
rs1365768896 2587 dbSNP
rs1454469578 2595 dbSNP
rs1254326256 2596 dbSNP
rs1210416168 2597 dbSNP
rs1483150524 2601 dbSNP
rs530407760 2603 dbSNP
rs1217629738 2614 dbSNP
rs1318978874 2617 dbSNP
rs1310325523 2618 dbSNP
rs1363761597 2630 dbSNP
rs886775194 2631 dbSNP
rs1004432252 2642 dbSNP
rs1305649230 2649 dbSNP
rs1387866882 2662 dbSNP
rs1407338297 2664 dbSNP
rs763416419 2667 dbSNP
rs934578439 2672 dbSNP
rs1222435837 2673 dbSNP
rs112478355 2677 dbSNP
rs951608761 2690 dbSNP
rs1309518125 2713 dbSNP
rs983337507 2714 dbSNP
rs1318385912 2719 dbSNP
rs144852504 2720 dbSNP
rs1427880521 2725 dbSNP
rs1002355543 2730 dbSNP
rs1034294543 2733 dbSNP
rs184308754 2734 dbSNP
rs992672471 2741 dbSNP
rs1210458109 2747 dbSNP
rs913867149 2756 dbSNP
rs1257867225 2757 dbSNP
rs1234001342 2787 dbSNP
rs528151450 2792 dbSNP
rs1224705046 2795 dbSNP
rs1325913099 2798 dbSNP
rs933959407 2801 dbSNP
rs1341582049 2803 dbSNP
rs1480232388 2806 dbSNP
rs1175300942 2808 dbSNP
rs1172678073 2809 dbSNP
rs1461088299 2810 dbSNP
rs147936206 2812 dbSNP
rs966691471 2815 dbSNP
rs1172524857 2818 dbSNP
rs979437222 2819 dbSNP
rs1252350106 2825 dbSNP
rs568217779 2826 dbSNP
rs1185482240 2827 dbSNP
rs1484827217 2843 dbSNP
rs1258595787 2845 dbSNP
rs1163133073 2849 dbSNP
rs1201222835 2858 dbSNP
rs1338901551 2860 dbSNP
rs1249677700 2877 dbSNP
rs935943800 2888 dbSNP
rs529220513 2889 dbSNP
rs1293091440 2900 dbSNP
rs550880216 2907 dbSNP
rs1164227879 2909 dbSNP
rs892942694 2911 dbSNP
rs1334446110 2929 dbSNP
rs921113985 2930 dbSNP
rs1370488297 2935 dbSNP
rs1440595138 2941 dbSNP
rs933714824 2946 dbSNP
rs571269515 2951 dbSNP
rs758395479 2959 dbSNP
rs1044146528 2971 dbSNP
rs906881713 2972 dbSNP
rs1002940661 2974 dbSNP
rs1476090629 2976 dbSNP
rs1368829930 2995 dbSNP
rs1188584503 3010 dbSNP
rs1437400241 3014 dbSNP
rs1248512069 3025 dbSNP
rs1003877392 3029 dbSNP
rs1458621760 3038 dbSNP
rs1038063595 3040 dbSNP
rs1273161373 3045 dbSNP
rs1231964562 3046 dbSNP
rs1313908901 3047 dbSNP
rs1358984934 3047 dbSNP
rs757455356 3050 dbSNP
rs371105268 3051 dbSNP
rs1333584840 3052 dbSNP
rs779118016 3065 dbSNP
rs1017064804 3067 dbSNP
rs1446947861 3070 dbSNP
rs1393061032 3071 dbSNP
rs962811969 3072 dbSNP
rs1462938871 3078 dbSNP
rs552361852 3079 dbSNP
rs896651525 3090 dbSNP
rs1028333355 3096 dbSNP
rs1013639289 3098 dbSNP
rs1020988367 3106 dbSNP
rs565899334 3112 dbSNP
rs534868401 3120 dbSNP
rs1252443807 3123 dbSNP
rs1202333687 3124 dbSNP
rs987186250 3125 dbSNP
rs1453767007 3131 dbSNP
rs1291078144 3135 dbSNP
rs924588727 3137 dbSNP
rs17825866 3140 dbSNP
rs1311056293 3151 dbSNP
rs1480832016 3153 dbSNP
rs1240422009 3155 dbSNP
rs775999549 3158 dbSNP
rs957286599 3162 dbSNP
rs1241544006 3163 dbSNP
rs1331567844 3175 dbSNP
rs914428926 3202 dbSNP
rs1398780816 3205 dbSNP
rs948508358 3207 dbSNP
rs1160748664 3209 dbSNP
rs1044197854 3214 dbSNP
rs906930104 3220 dbSNP
rs1191785930 3232 dbSNP
rs1479303959 3239 dbSNP
rs1247853208 3242 dbSNP
rs1193064637 3251 dbSNP
rs1445707112 3263 dbSNP
rs1288592708 3275 dbSNP
rs1216904250 3276 dbSNP
rs1182002094 3281 dbSNP
rs59027462 3296 dbSNP
rs1346623027 3297 dbSNP
rs938401293 3304 dbSNP
rs768608913 3307 dbSNP
rs975737466 3311 dbSNP
rs1418831307 3313 dbSNP
rs188443654 3316 dbSNP
rs886070986 3319 dbSNP
rs1004423555 3320 dbSNP
rs1017116849 3326 dbSNP
rs898679007 3327 dbSNP
rs1173157974 3328 dbSNP
rs192529122 3329 dbSNP
rs374148379 3330 dbSNP
rs955638804 3331 dbSNP
rs1335064316 3339 dbSNP
rs1380167350 3351 dbSNP
rs1406623075 3364 dbSNP
rs1454207777 3373 dbSNP
rs1315195088 3381 dbSNP
rs1360618471 3382 dbSNP
rs908271208 3384 dbSNP
rs1265804994 3391 dbSNP
rs1194787295 3394 dbSNP
rs140047055 3400 dbSNP
rs1032093915 3405 dbSNP
rs1038016167 3407 dbSNP
rs1275016457 3409 dbSNP
rs1312333415 3412 dbSNP
rs1271663731 3417 dbSNP
rs1307949267 3418 dbSNP
rs150011709 3420 dbSNP
rs1260982171 3421 dbSNP
rs990081830 3424 dbSNP
rs938239496 3425 dbSNP
rs1055794371 3428 dbSNP
rs1353299028 3436 dbSNP
rs1204522393 3440 dbSNP
rs1328192045 3448 dbSNP
rs948558647 3454 dbSNP
rs1241636996 3455 dbSNP
rs1426345048 3467 dbSNP
rs1474459581 3470 dbSNP
rs1171978448 3474 dbSNP
rs1412067775 3483 dbSNP
rs979930226 3489 dbSNP
rs1483338730 3495 dbSNP
rs1231818083 3502 dbSNP
rs146839748 3503 dbSNP
rs868629411 3503 dbSNP
rs938437124 3514 dbSNP
rs1258679434 3518 dbSNP
rs1232600488 3520 dbSNP
rs1332488538 3528 dbSNP
rs1420853481 3536 dbSNP
rs574143113 3539 dbSNP
rs1230247818 3540 dbSNP
rs1047433190 3547 dbSNP
rs544537093 3553 dbSNP
rs1014168774 3554 dbSNP
rs941670741 3557 dbSNP
rs1021102874 3558 dbSNP
rs902592889 3564 dbSNP
rs1332704211 3567 dbSNP
rs1174752270 3568 dbSNP
rs898731205 3571 dbSNP
rs1348513212 3572 dbSNP
rs1000923680 3578 dbSNP
rs997008528 3585 dbSNP
rs1424061314 3603 dbSNP
rs1406857525 3614 dbSNP
rs1408726393 3615 dbSNP
rs1032265237 3629 dbSNP
rs965080824 3630 dbSNP
rs1334402015 3649 dbSNP
rs1050339911 3655 dbSNP
rs974803791 3656 dbSNP
rs556416658 3659 dbSNP
rs1416738159 3660 dbSNP
rs1028654649 3661 dbSNP
rs185310647 3662 dbSNP
rs1031728807 3663 dbSNP
rs1316091600 3666 dbSNP
rs1283870573 3667 dbSNP
rs1432097262 3668 dbSNP
rs568054535 3669 dbSNP
rs145222485 3674 dbSNP
rs1440824578 3681 dbSNP
rs545232756 3682 dbSNP
rs1021591356 3688 dbSNP
rs1458772961 3689 dbSNP
rs908386116 3697 dbSNP
rs149150695 3703 dbSNP
rs143231608 3706 dbSNP
rs1380382791 3707 dbSNP
rs1192422320 3714 dbSNP
rs572874224 3730 dbSNP
rs1431394473 3737 dbSNP
rs540291594 3752 dbSNP
rs11629713 3753 dbSNP
rs1204612552 3760 dbSNP
rs1283840815 3764 dbSNP
rs928460237 3768 dbSNP
rs919569958 3769 dbSNP
rs937668429 3770 dbSNP
rs907602372 3779 dbSNP
rs1214738212 3783 dbSNP
rs1356037682 3786 dbSNP
rs1286867703 3789 dbSNP
rs764774590 3790 dbSNP
rs941721332 3791 dbSNP
rs1310487696 3795 dbSNP
rs1304137832 3803 dbSNP
rs1387848140 3806 dbSNP
rs1490343046 3810 dbSNP
rs1197850098 3819 dbSNP
rs1401499610 3823 dbSNP
rs1037325377 3824 dbSNP
rs772729893 3842 dbSNP
rs918145522 3853 dbSNP
rs1378853626 3859 dbSNP
rs1176774017 3863 dbSNP
rs932908984 3864 dbSNP
rs146527269 3867 dbSNP
rs891303919 3871 dbSNP
rs1284656055 3878 dbSNP
rs1042511073 3879 dbSNP
rs1359579089 3881 dbSNP
rs1489405990 3882 dbSNP
rs188794899 3885 dbSNP
rs1288374149 3886 dbSNP
rs747020218 3891 dbSNP
rs1182988683 3894 dbSNP
rs1240490872 3895 dbSNP
rs757327747 3900 dbSNP
rs1234615414 3901 dbSNP
rs781175382 3903 dbSNP
rs746086454 3908 dbSNP
rs1473837722 3918 dbSNP
rs550941973 3920 dbSNP
rs750725925 3928 dbSNP
rs1310846413 3932 dbSNP
rs1404480992 3933 dbSNP
rs775762051 3934 dbSNP
rs1402253095 3935 dbSNP
rs1444076655 3937 dbSNP
rs1308114046 3941 dbSNP
rs749669360 3942 dbSNP
rs1246367207 3943 dbSNP
rs769105916 3956 dbSNP
rs1341482597 3957 dbSNP
rs1356253254 3958 dbSNP
rs1053789818 3959 dbSNP
rs1311959732 3966 dbSNP
rs758978114 3969 dbSNP
rs900622609 3971 dbSNP
rs1403734724 3972 dbSNP
rs774874333 3973 dbSNP
rs1461447148 3974 dbSNP
rs751079265 3974 dbSNP
rs766744804 3974 dbSNP
rs765891587 3977 dbSNP
rs776063319 3979 dbSNP
rs996560227 3984 dbSNP
rs1172705615 3987 dbSNP
rs1478064263 3996 dbSNP
rs759224089 3997 dbSNP
rs562760607 3998 dbSNP
rs752489103 4005 dbSNP
rs1011619093 4006 dbSNP
rs1368026265 4012 dbSNP
rs1030358336 4013 dbSNP
rs758299822 4016 dbSNP
rs533218961 4017 dbSNP
rs1472412360 4019 dbSNP
rs955437229 4019 dbSNP
rs113971639 4021 dbSNP
rs139334001 4021 dbSNP
rs397740928 4021 dbSNP
rs56690734 4022 dbSNP
rs113700837 4023 dbSNP
rs79363602 4024 dbSNP
rs76528369 4026 dbSNP
rs751488457 4029 dbSNP
rs1008169352 4030 dbSNP
rs757195293 4031 dbSNP
rs1402474308 4033 dbSNP
rs781325978 4036 dbSNP
rs1201064589 4039 dbSNP
rs1331609791 4045 dbSNP
rs747855316 4047 dbSNP
rs1491051511 4048 dbSNP
rs1219750151 4050 dbSNP
rs970006503 4051 dbSNP
rs1001875411 4052 dbSNP
rs1280685803 4060 dbSNP
rs1015398359 4062 dbSNP
rs1218426587 4063 dbSNP
rs1390365189 4065 dbSNP
rs1397461599 4069 dbSNP
rs750469711 4071 dbSNP
rs756274443 4072 dbSNP
rs1285090732 4083 dbSNP
rs1358810007 4085 dbSNP
rs1220982004 4087 dbSNP
rs762480947 4087 dbSNP
rs960173086 4088 dbSNP
rs766227286 4089 dbSNP
rs1161203266 4091 dbSNP
rs551484645 4091 dbSNP
rs1370473664 4094 dbSNP
rs1271705093 4100 dbSNP
rs1188474848 4107 dbSNP
rs566826819 4112 dbSNP
rs534049898 4125 dbSNP
rs963087987 4131 dbSNP
rs549440116 4132 dbSNP
rs1181063601 4133 dbSNP
rs1181583983 4133 dbSNP
rs1307287217 4141 dbSNP
rs1289654096 4147 dbSNP
rs770858626 4155 dbSNP
rs1231487217 4161 dbSNP
rs959176689 4163 dbSNP
rs556640790 4175 dbSNP
rs567547183 4186 dbSNP
rs1238959137 4192 dbSNP
rs1374033523 4195 dbSNP
rs1310729980 4201 dbSNP
rs1330402086 4211 dbSNP
rs1321488521 4218 dbSNP
rs1380452434 4220 dbSNP
rs921623170 4223 dbSNP
rs1391187295 4225 dbSNP
rs949599709 4226 dbSNP
rs1042626173 4235 dbSNP
rs1161056583 4245 dbSNP
rs1419263205 4250 dbSNP
rs577079814 4251 dbSNP
rs1387226556 4264 dbSNP
rs924228416 4266 dbSNP
rs1327987678 4271 dbSNP
rs936838268 4281 dbSNP
rs1246685999 4292 dbSNP
rs1197332985 4294 dbSNP
rs1050462087 4299 dbSNP
rs1268424611 4304 dbSNP
rs1215452461 4311 dbSNP
rs1053979231 4318 dbSNP
rs754785636 4320 dbSNP
rs1351002155 4323 dbSNP
rs774492620 4325 dbSNP
rs538041502 4330 dbSNP
rs1287573503 4331 dbSNP
rs900570420 4333 dbSNP
rs996285754 4344 dbSNP
rs1240305900 4349 dbSNP
rs1052173128 4352 dbSNP
rs556299555 4356 dbSNP
rs1343639724 4364 dbSNP
rs767392574 4366 dbSNP
rs1438500514 4370 dbSNP
rs577920571 4384 dbSNP
rs539322151 4390 dbSNP
rs1297278795 4392 dbSNP
rs1382240217 4407 dbSNP
rs1399659246 4416 dbSNP
rs1015512875 4433 dbSNP
rs1160656042 4436 dbSNP
rs539291882 4455 dbSNP
rs557486801 4464 dbSNP
rs572784411 4466 dbSNP
rs995321661 4496 dbSNP
rs1479252514 4499 dbSNP
rs1378607188 4503 dbSNP
rs1193337205 4506 dbSNP
rs1487501459 4507 dbSNP
rs1293996804 4510 dbSNP
rs1216884198 4515 dbSNP
rs1441401395 4520 dbSNP
rs1275827581 4526 dbSNP
rs1053283764 4528 dbSNP
rs1345583069 4532 dbSNP
rs891936591 4536 dbSNP
rs1216625300 4541 dbSNP
rs754165076 4546 dbSNP
rs1342110697 4547 dbSNP
rs947454624 4557 dbSNP
rs181958245 4562 dbSNP
rs905875982 4572 dbSNP
rs1001530829 4576 dbSNP
rs1332229509 4584 dbSNP
rs561820440 4585 dbSNP
rs1407531217 4589 dbSNP
rs573921696 4590 dbSNP
rs779241035 4591 dbSNP
rs1426209705 4592 dbSNP
rs1193957674 4603 dbSNP
rs745939674 4604 dbSNP
rs1271377415 4605 dbSNP
rs1472224195 4609 dbSNP
rs917539363 4611 dbSNP
rs1005155367 4612 dbSNP
rs1442477243 4614 dbSNP
rs1257391367 4616 dbSNP
rs544426165 4620 dbSNP
rs970358947 4622 dbSNP
rs1196670252 4624 dbSNP
rs1238413243 4629 dbSNP
rs1319802920 4629 dbSNP
rs755997627 4633 dbSNP
rs1215411886 4634 dbSNP
rs977766391 4635 dbSNP
rs1378653959 4641 dbSNP
rs557581820 4652 dbSNP
rs936952371 4653 dbSNP
rs963159192 4666 dbSNP
rs1331323997 4667 dbSNP
rs1464465245 4670 dbSNP
rs1402919427 4672 dbSNP
rs990023471 4680 dbSNP
rs1028688326 4682 dbSNP
rs922139928 4686 dbSNP
rs111940048 4692 dbSNP
rs1302301849 4701 dbSNP
rs1237019751 4703 dbSNP
rs944311844 4715 dbSNP
rs1459003404 4727 dbSNP
rs1331715753 4728 dbSNP
rs1319665521 4730 dbSNP
rs1382352143 4734 dbSNP
rs1288068601 4735 dbSNP
rs932022573 4738 dbSNP
rs989430617 4739 dbSNP
rs1308545292 4742 dbSNP
rs1291069780 4745 dbSNP
rs1445261972 4746 dbSNP
rs562624120 4748 dbSNP
rs780485909 4749 dbSNP
rs947507437 4750 dbSNP
rs1317313701 4751 dbSNP
rs1341109433 4753 dbSNP
rs1227428010 4756 dbSNP
rs1311813104 4758 dbSNP
rs1424839754 4760 dbSNP
rs1379188720 4763 dbSNP
rs1156251195 4764 dbSNP
rs1440973848 4765 dbSNP
rs184810112 4766 dbSNP
rs1043191948 4769 dbSNP
rs905928474 4770 dbSNP
rs551619611 4774 dbSNP
rs1248176799 4776 dbSNP
rs1342001879 4781 dbSNP
rs940671888 4782 dbSNP
rs1360394856 4787 dbSNP
rs781512788 4796 dbSNP
rs1238127269 4800 dbSNP
rs1199694933 4805 dbSNP
rs1308423647 4806 dbSNP
rs1262855589 4814 dbSNP
rs1386692855 4832 dbSNP
rs1295586252 4836 dbSNP
rs897063300 4836 dbSNP
rs1405203319 4837 dbSNP
rs1359557524 4840 dbSNP
rs1295928604 4844 dbSNP
rs1421059441 4847 dbSNP
rs560319491 4855 dbSNP
rs1201349185 4862 dbSNP
rs1363859297 4864 dbSNP
rs995449943 4878 dbSNP
rs1175285444 4879 dbSNP
rs527663552 4883 dbSNP
rs1027211532 4895 dbSNP
rs1244514741 4895 dbSNP
rs1014767104 4896 dbSNP
rs1423871331 4896 dbSNP
rs1191771395 4898 dbSNP
rs1371275063 4903 dbSNP
rs1476331309 4904 dbSNP
rs894986504 4905 dbSNP
rs1012527900 4920 dbSNP
rs1486923897 4921 dbSNP
rs1261326619 4922 dbSNP
rs1233165871 4924 dbSNP
rs1024723185 4926 dbSNP
rs970473686 4927 dbSNP
rs757024522 4939 dbSNP
rs549255666 4943 dbSNP
rs189269614 4967 dbSNP
rs1275971022 4968 dbSNP
rs1338942048 4974 dbSNP
rs958256554 4976 dbSNP
rs1301705449 4979 dbSNP
rs1464505695 4979 dbSNP
rs994613954 4979 dbSNP
rs989748898 4988 dbSNP
rs28493570 5000 dbSNP
rs932163949 5019 dbSNP
rs988085947 5029 dbSNP
rs1262555079 5041 dbSNP
rs17753089 5042 dbSNP
rs1328730802 5043 dbSNP
rs989074880 5046 dbSNP
rs6495011 5050 dbSNP
rs1283088097 5051 dbSNP
rs761535197 5052 dbSNP
rs1204849456 5059 dbSNP
rs1317699637 5062 dbSNP
rs1276622899 5065 dbSNP
rs770458812 5067 dbSNP
rs1326606303 5068 dbSNP
rs1221365195 5070 dbSNP
rs764615197 5071 dbSNP
rs1393835674 5075 dbSNP
rs1231628163 5079 dbSNP
rs1380707184 5082 dbSNP
rs899183010 5091 dbSNP
rs1483332444 5111 dbSNP
rs539000390 5115 dbSNP
rs774220125 5117 dbSNP
rs1464986161 5121 dbSNP
rs1397855014 5124 dbSNP
rs1172503477 5125 dbSNP
rs181007024 5126 dbSNP
rs1448717821 5130 dbSNP
rs1048299603 5133 dbSNP
rs927393874 5137 dbSNP
rs937447375 5143 dbSNP
rs1428422297 5149 dbSNP
rs1244979915 5150 dbSNP
rs1479326226 5151 dbSNP
rs1184754178 5160 dbSNP
rs1178253601 5161 dbSNP
rs1378458780 5163 dbSNP
rs1256580052 5171 dbSNP
rs895093623 5179 dbSNP
rs1012063023 5184 dbSNP
rs917271721 5185 dbSNP
rs1287237960 5192 dbSNP
rs1360994679 5201 dbSNP
rs572800584 5207 dbSNP
rs906261492 5208 dbSNP
rs1374508229 5209 dbSNP
rs999246834 5217 dbSNP
rs1391822477 5220 dbSNP
rs1030582787 5221 dbSNP
rs957710751 5232 dbSNP
rs1036263164 5238 dbSNP
rs1387191395 5246 dbSNP
rs533775162 5248 dbSNP
rs989587547 5258 dbSNP
rs1164236864 5260 dbSNP
rs1029245040 5261 dbSNP
rs1236931468 5265 dbSNP
rs185947239 5268 dbSNP
rs953783553 5271 dbSNP
rs1184599957 5272 dbSNP
rs1438817131 5275 dbSNP
rs987645270 5279 dbSNP
rs899086901 5283 dbSNP
rs1490726883 5285 dbSNP
rs573781677 5286 dbSNP
rs1238843697 5287 dbSNP
rs1350856782 5288 dbSNP
rs544294492 5291 dbSNP
rs888908061 5292 dbSNP
rs1330301950 5294 dbSNP
rs1008667234 5298 dbSNP
rs1019080340 5304 dbSNP
rs1303955642 5306 dbSNP
rs34313663 5321 dbSNP
rs956426613 5328 dbSNP
rs1378540056 5334 dbSNP
rs962098138 5338 dbSNP
rs972145652 5339 dbSNP
rs920710937 5346 dbSNP
rs767517277 5348 dbSNP
rs930658566 5351 dbSNP
rs1009218189 5353 dbSNP
rs1344107800 5357 dbSNP
rs1020587997 5360 dbSNP
rs1197140883 5364 dbSNP
rs1490936927 5365 dbSNP
rs1269239212 5367 dbSNP
rs1407148301 5368 dbSNP
rs968951314 5370 dbSNP
rs1285664551 5372 dbSNP
rs1205675539 5375 dbSNP
rs978974507 5382 dbSNP
rs770150123 5395 dbSNP
rs927486687 5400 dbSNP
rs1225155663 5417 dbSNP
rs556405935 5419 dbSNP
rs1284235918 5420 dbSNP
rs757893601 5424 dbSNP
rs917304649 5434 dbSNP
rs1237854354 5443 dbSNP
rs940735160 5447 dbSNP
rs1192486051 5450 dbSNP
rs1355223210 5451 dbSNP
rs947977114 5455 dbSNP
rs1476611372 5468 dbSNP
rs1243363992 5472 dbSNP
rs1217327035 5476 dbSNP
rs1441300531 5480 dbSNP
rs1046190429 5487 dbSNP
rs906376351 5490 dbSNP
rs1324021987 5491 dbSNP
rs1257120637 5497 dbSNP
rs1218286088 5505 dbSNP
rs999195891 5506 dbSNP
rs1052130269 5517 dbSNP
rs1272124065 5533 dbSNP
rs893588504 5535 dbSNP
rs1010555442 5539 dbSNP
rs1267760688 5543 dbSNP
rs1471204155 5552 dbSNP
rs1407337447 5553 dbSNP
rs1050283279 5556 dbSNP
rs1029106371 5566 dbSNP
rs1408546147 5566 dbSNP
rs888969573 5571 dbSNP
rs1009132554 5573 dbSNP
rs752574876 5577 dbSNP
rs543802648 5581 dbSNP
rs1040146680 5584 dbSNP
rs1185354853 5589 dbSNP
rs953627313 5595 dbSNP
rs1365663965 5600 dbSNP
rs780007378 5601 dbSNP
rs1420394425 5605 dbSNP
rs1275450522 5618 dbSNP
rs1215323469 5626 dbSNP
rs1355735441 5632 dbSNP
rs1312962302 5635 dbSNP
rs1455071945 5650 dbSNP
rs1009172563 5653 dbSNP
rs760479184 5658 dbSNP
rs751610523 5661 dbSNP
rs1162931397 5662 dbSNP
rs141091090 5673 dbSNP
rs1364281635 5674 dbSNP
rs1427059827 5680 dbSNP
rs1294538474 5684 dbSNP
rs1373016658 5685 dbSNP
rs892205608 5687 dbSNP
rs1390530380 5693 dbSNP
rs1444693816 5699 dbSNP
rs962213029 5707 dbSNP
rs972264996 5709 dbSNP
rs765570921 5717 dbSNP
rs1240247583 5719 dbSNP
rs1481499886 5721 dbSNP
rs1233175182 5722 dbSNP
rs1205529663 5724 dbSNP
rs867130774 5727 dbSNP
rs1451203243 5728 dbSNP
rs1289830119 5732 dbSNP
rs1248309482 5733 dbSNP
rs1360248528 5742 dbSNP
rs1357254387 5745 dbSNP
rs1223629842 5746 dbSNP
rs1375992027 5754 dbSNP
rs1299065864 5756 dbSNP
rs372470363 5757 dbSNP
rs1009270623 5759 dbSNP
rs1021977183 5762 dbSNP
rs191438711 5765 dbSNP
rs1424822766 5774 dbSNP
rs1379090896 5781 dbSNP
rs967666601 5782 dbSNP
rs1420763927 5784 dbSNP
rs1408468009 5787 dbSNP
rs1192419046 5793 dbSNP
rs1175204298 5803 dbSNP
rs1479313180 5813 dbSNP
rs1240263348 5814 dbSNP
rs991474993 5817 dbSNP
rs1224986688 5840 dbSNP
rs915914905 5841 dbSNP
rs1440505741 5846 dbSNP
rs1183092214 5847 dbSNP
rs1490538979 5847 dbSNP
rs1285317310 5849 dbSNP
rs1214320414 5850 dbSNP
rs750645777 5851 dbSNP
rs758476661 5856 dbSNP
rs181128947 5859 dbSNP
rs1035002543 5860 dbSNP
rs1284870461 5862 dbSNP
rs1405105627 5862 dbSNP
rs1359378552 5863 dbSNP
rs1427155619 5867 dbSNP
rs560391770 5871 dbSNP
rs1286561583 5875 dbSNP
rs1454873371 5876 dbSNP
rs527723979 5884 dbSNP
rs1354379860 5886 dbSNP
rs752054033 5909 dbSNP
rs755497594 5912 dbSNP
rs1201869044 5913 dbSNP
rs144851503 5913 dbSNP
rs1480865073 5920 dbSNP
rs1261160723 5922 dbSNP
rs1184910970 5926 dbSNP
rs567685427 5930 dbSNP
rs1261896017 5933 dbSNP
rs1203573952 5936 dbSNP
rs748516139 5940 dbSNP
rs187032408 5946 dbSNP
rs1321858879 5949 dbSNP
rs1011087166 5951 dbSNP
rs770085737 5953 dbSNP
rs1223772039 5954 dbSNP
rs531708516 5954 dbSNP
rs1339496456 5955 dbSNP
rs1292954316 5957 dbSNP
rs1447034355 5961 dbSNP
rs1362020620 5964 dbSNP
rs1302203313 5966 dbSNP
rs1468108963 5974 dbSNP
rs374079492 5978 dbSNP
rs1408070473 5980 dbSNP
rs1176831188 5985 dbSNP
rs1464891775 5987 dbSNP
rs972085589 5987 dbSNP
rs74344953 5989 dbSNP
rs1379934738 5992 dbSNP
rs930618567 5999 dbSNP
rs1430437753 6003 dbSNP
rs1313358824 6013 dbSNP
rs986093238 6017 dbSNP
rs1306778786 6025 dbSNP
rs1183546462 6027 dbSNP
rs571537356 6038 dbSNP
rs910440924 6043 dbSNP
rs532738622 6054 dbSNP
rs1019204754 6057 dbSNP
rs1458424338 6057 dbSNP
rs1040600956 6061 dbSNP
rs1241439476 6062 dbSNP
rs547818805 6063 dbSNP
rs993653137 6069 dbSNP
rs1473810832 6073 dbSNP
rs1311340456 6074 dbSNP
rs1450390235 6085 dbSNP
rs1028250582 6086 dbSNP
rs1337281654 6097 dbSNP
rs1419429965 6105 dbSNP
rs1394052791 6109 dbSNP
rs1427219244 6112 dbSNP
rs1296684374 6118 dbSNP
rs748963230 6123 dbSNP
rs991983625 6124 dbSNP
rs1022929914 6143 dbSNP
rs375757691 6144 dbSNP
rs1442824015 6150 dbSNP
rs1387701399 6158 dbSNP
rs190746146 6166 dbSNP
rs981449158 6170 dbSNP
rs1437623025 6180 dbSNP
rs1248775320 6188 dbSNP
rs138682630 6191 dbSNP
rs1480728643 6196 dbSNP
rs1290558941 6197 dbSNP
rs935281172 6199 dbSNP
rs1335657239 6203 dbSNP
rs1315717281 6205 dbSNP
rs1171298652 6209 dbSNP
rs1333774347 6215 dbSNP
rs1330580976 6224 dbSNP
rs987908266 6232 dbSNP
rs1397531406 6242 dbSNP
rs1302775527 6246 dbSNP
rs915077540 6250 dbSNP
rs1403368283 6262 dbSNP
rs1367462607 6265 dbSNP
rs1164774428 6269 dbSNP
rs946447825 6275 dbSNP
rs1302875429 6285 dbSNP
rs1050609277 6289 dbSNP
rs1001852964 6298 dbSNP
rs1420021221 6303 dbSNP
rs1267824717 6305 dbSNP
rs866183997 6307 dbSNP
rs1219781542 6318 dbSNP
rs555420867 6326 dbSNP
rs1034648079 6334 dbSNP
rs944334933 6335 dbSNP
rs543683047 6345 dbSNP
rs182979612 6349 dbSNP
rs1014474715 6351 dbSNP
rs1024898578 6355 dbSNP
rs1318336006 6357 dbSNP
rs1040090711 6358 dbSNP
rs898050132 6363 dbSNP
rs537973953 6366 dbSNP
rs1324232650 6385 dbSNP
rs140252057 6386 dbSNP
rs1383493131 6391 dbSNP
rs1160799165 6397 dbSNP
rs1454686370 6399 dbSNP
rs993765838 6408 dbSNP
rs1261511788 6409 dbSNP
rs1481191877 6413 dbSNP
rs1269125637 6417 dbSNP
rs71397256 6425 dbSNP
rs770398928 6430 dbSNP
rs1191897842 6435 dbSNP
rs1444774913 6449 dbSNP
rs577806946 6450 dbSNP
rs4777518 6455 dbSNP
rs1322561141 6457 dbSNP
rs1013117210 6463 dbSNP
rs1221934263 6464 dbSNP
rs781147859 6470 dbSNP
rs1241543666 6473 dbSNP
rs1275634329 6476 dbSNP
rs1430191227 6483 dbSNP
rs1320867927 6484 dbSNP
rs532855191 6485 dbSNP
rs1023469547 6486 dbSNP
rs1405852644 6492 dbSNP
rs971478703 6493 dbSNP
rs1174783158 6503 dbSNP
rs1196462527 6508 dbSNP
rs1424861481 6510 dbSNP
rs986534051 6519 dbSNP
rs1174641519 6520 dbSNP
rs1422654200 6525 dbSNP
rs910501243 6526 dbSNP
rs981396934 6526 dbSNP
rs1176213277 6529 dbSNP
rs1344063633 6530 dbSNP
rs944627860 6530 dbSNP
rs1031648795 6531 dbSNP
rs975985031 6535 dbSNP
rs538311622 6536 dbSNP
rs988466700 6538 dbSNP
rs945162078 6543 dbSNP
rs1043520463 6551 dbSNP
rs748634923 6557 dbSNP
rs903603406 6558 dbSNP
rs937726961 6567 dbSNP
rs1337540579 6576 dbSNP
rs915047431 6579 dbSNP
rs1237970143 6587 dbSNP
rs74022856 6597 dbSNP
rs896116238 6609 dbSNP
rs1454965996 6615 dbSNP
rs1360047979 6621 dbSNP
rs1327769736 6622 dbSNP
rs1299951687 6639 dbSNP
rs1340989758 6642 dbSNP
rs1404116360 6659 dbSNP
rs1281100350 6662 dbSNP
rs986004900 6672 dbSNP
rs1421051126 6673 dbSNP
rs1168729539 6674 dbSNP
rs910279752 6681 dbSNP
rs559604542 6685 dbSNP
rs1040039113 6696 dbSNP
rs1218808881 6697 dbSNP
rs1204133837 6698 dbSNP
rs542479712 6703 dbSNP
rs749454120 6704 dbSNP
rs1436245710 6713 dbSNP
rs1275354491 6722 dbSNP
rs757530235 6725 dbSNP
rs1358798974 6730 dbSNP
rs1248723326 6734 dbSNP
rs897496113 6739 dbSNP
rs1380388685 6740 dbSNP
rs1279286414 6742 dbSNP
rs993605921 6750 dbSNP
rs929507512 6753 dbSNP
rs1027732774 6756 dbSNP
rs1248795313 6762 dbSNP
rs1363102405 6767 dbSNP
rs1478831135 6776 dbSNP
rs1165405210 6805 dbSNP
rs1424289084 6806 dbSNP
rs1407012224 6811 dbSNP
rs1049767449 6813 dbSNP
rs560980600 6824 dbSNP
rs28661594 6825 dbSNP
rs1490207275 6828 dbSNP
rs1023163818 6837 dbSNP
rs907270169 6841 dbSNP
rs543559014 6845 dbSNP
rs368701262 6848 dbSNP
rs956048805 6852 dbSNP
rs1423875794 6854 dbSNP
rs1011611833 6856 dbSNP
rs772111854 6863 dbSNP
rs775964212 6868 dbSNP
rs1022631804 6874 dbSNP
rs1288605337 6874 dbSNP
rs913806354 6883 dbSNP
rs1343135209 6890 dbSNP
rs565030765 6894 dbSNP
rs968020426 6896 dbSNP
rs1344580005 6900 dbSNP
rs986339472 6901 dbSNP
rs979252742 6902 dbSNP
rs1332600945 6913 dbSNP
rs925073880 6914 dbSNP
rs747528673 6917 dbSNP
rs937761712 6918 dbSNP
rs910405107 6920 dbSNP
rs532462729 6923 dbSNP
rs975835157 6935 dbSNP
rs1267009934 6937 dbSNP
rs1193030335 6940 dbSNP
rs1488846941 6962 dbSNP
rs1242104972 6964 dbSNP
rs76400902 6966 dbSNP
rs1242440229 6975 dbSNP
rs1319110626 6978 dbSNP
rs374643664 6985 dbSNP
rs548372307 6989 dbSNP
rs1045988476 6998 dbSNP
rs1321035932 7001 dbSNP
rs1284774344 7004 dbSNP
rs928960175 7010 dbSNP
rs1360590726 7024 dbSNP
rs368198668 7031 dbSNP
rs1287048970 7036 dbSNP
rs368867283 7036 dbSNP
rs763980177 7042 dbSNP
rs1175502087 7043 dbSNP
rs879607268 7045 dbSNP
rs1427542062 7046 dbSNP
rs1178492828 7049 dbSNP
rs1049225099 7055 dbSNP
rs887911812 7056 dbSNP
rs1185317956 7058 dbSNP
rs750654335 7059 dbSNP
rs1292558842 7067 dbSNP
rs1466603873 7068 dbSNP
rs1008074371 7069 dbSNP
rs1460259312 7070 dbSNP
rs1257404703 7075 dbSNP
rs764923462 7079 dbSNP
rs28587886 7080 dbSNP
rs966468909 7081 dbSNP
rs1181470478 7084 dbSNP
rs997525626 7088 dbSNP
rs1271580154 7089 dbSNP
rs1335996181 7090 dbSNP
rs1450258111 7106 dbSNP
rs188049498 7108 dbSNP
rs1304813523 7110 dbSNP
rs548881097 7114 dbSNP
rs966625763 7116 dbSNP
rs979304970 7116 dbSNP
rs1231963772 7124 dbSNP
rs1391401877 7130 dbSNP
rs1451377748 7130 dbSNP
rs567298433 7132 dbSNP
rs1437394783 7139 dbSNP
rs763210544 7143 dbSNP
rs1258649700 7146 dbSNP
rs1200694703 7149 dbSNP
rs1380354274 7155 dbSNP
rs959209354 7157 dbSNP
rs991007708 7158 dbSNP
rs917658217 7159 dbSNP
rs1044936967 7160 dbSNP
rs907384471 7186 dbSNP
rs1002879731 7187 dbSNP
rs1036646217 7188 dbSNP
rs918216103 7196 dbSNP
rs1313101658 7203 dbSNP
rs929561555 7206 dbSNP
rs1053125554 7209 dbSNP
rs1296666697 7214 dbSNP
rs1049278537 7222 dbSNP
rs887956264 7235 dbSNP
rs1163539914 7243 dbSNP
rs1327889301 7247 dbSNP
rs891921113 7254 dbSNP
rs1443265175 7256 dbSNP
rs1370680500 7263 dbSNP
rs1188730541 7267 dbSNP
rs1011978368 7271 dbSNP
rs1449245770 7275 dbSNP
rs1007712899 7277 dbSNP
rs1039551390 7282 dbSNP
rs1310123591 7287 dbSNP
rs11410633 7289 dbSNP
rs1265932907 7289 dbSNP
rs397798322 7296 dbSNP
rs1243329440 7301 dbSNP
rs1286684926 7305 dbSNP
rs1286485360 7306 dbSNP
rs766460085 7313 dbSNP
rs1411854253 7314 dbSNP
rs537837094 7314 dbSNP
rs901919607 7316 dbSNP
rs1302680586 7319 dbSNP
rs1195620167 7342 dbSNP
rs577672559 7346 dbSNP
rs556333056 7351 dbSNP
rs1271264139 7353 dbSNP
rs1164328221 7355 dbSNP
rs997568001 7357 dbSNP
rs191021129 7359 dbSNP
rs1200108499 7365 dbSNP
rs1007478641 7366 dbSNP
rs770171988 7366 dbSNP
rs1017413016 7373 dbSNP
rs1032250230 7374 dbSNP
rs538329141 7381 dbSNP
rs965858405 7403 dbSNP
rs959492434 7411 dbSNP
rs1460494357 7422 dbSNP
rs553948963 7425 dbSNP
rs781672897 7431 dbSNP
rs1269732005 7432 dbSNP
rs918989513 7436 dbSNP
rs1228750956 7442 dbSNP
rs1330124537 7450 dbSNP
rs1184696085 7451 dbSNP
rs990668210 7452 dbSNP
rs950527395 7454 dbSNP
rs370813121 7461 dbSNP
rs1473055350 7469 dbSNP
rs1332846746 7471 dbSNP
rs1167156128 7474 dbSNP
rs1025176961 7484 dbSNP
rs1382118551 7493 dbSNP
rs572131916 7507 dbSNP
rs1323025507 7509 dbSNP
rs1458069681 7537 dbSNP
rs753189274 7542 dbSNP
rs972415101 7542 dbSNP
rs536172720 7544 dbSNP
rs756536113 7547 dbSNP
rs1377654259 7557 dbSNP