miRTarBase - #MIRT068655 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AKAP11   
Synonyms AKAP-11, AKAP220, PPP1R44, PRKA11
Description A-kinase anchoring protein 11
Transcript NM_016248   
Expression
Putative miRNA Targets on AKAP11
3'UTR of AKAP11
(miRNA target sites are highlighted)
>AKAP11|NM_016248|3'UTR
   1 AGCAAACCCCAAACCAGTATATTTTAGTATTTGTTTGGGGAGGGGAACAAGCCAATAAAGATGTTTAGGATAAAATTTGA
  81 ATAGTGAATATTAACATCGTAAGTCAGTTGGGAGGCAAGTAAATATAGCTTTCTGAGCGCTTTGTGTTATCACTCGGTGT
 161 ATATAGTTCATACTTTTGTAATCTGTCAAAATACTACCTTCATTTATTCTTCTATACACATGTGTAGTGTGTCAAGACCC
 241 TAAGAACATGTATTTGAAGGAAGGTCTAACCAGGGGGTTTTCAGGGGCATTGTCTGACCACATTCTTTTTGTATCCAAAT
 321 AGTGCTGCTAGAAACTGCACTGAAGTGGCTGAGGATAGGTTCCAGTGATAGAGTTATAATTTTGCTCCTTTGCAAACAAA
 401 TGGTATCTAATTAATAACTAGTCTGACATCAGAAAATAAAATTGAGGCTGATTTTTAAAAATTTCTAGTAGATTTTTGGC
 481 CTTTCCTGTTTTTAAAAATCAGTTTCATTTTCATATTTCATAGATCAGCTATTGGTAGCTTTTTGATTTCCCCAAACTAT
 561 TTAATTTCTTAGCAGAAACATTAGTATTTTAGGTTTCTATAAACACTATAAGTGATAGTTTCCCCCATCCTTTCATTGAC
 641 ATTATTTGCCAATGCTGCCAGTCATTCTGGCATGAAAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
 721 GTAAGGGAGTACTTTAACCTTGCCAGTTTGTTCCCTCTTTTATTTTACTGTTTTCTTTTTAGAAACCCACTGTTAAAATT
 801 TAAAAAGGTGCTTTAAAATAAAACGCCTATAAAGATTGTGCAGTAAGAATTTTTATTGACAATAATTAAAATTTTTTTTG
 881 ACAATTTTGGGTTCCCAACTTATCTTACAAGTGAAAACTTAAATTGTAAAACATGTTGAAATTTTAAAAATTAATGTTAA
 961 TATGGAAATGCATTTAGAGAAGCCCAGTAGTTTTTATTGTTGGATTTTTGAAAAAACCTCTACCAAGAATGTGGTGTTTT
1041 TTTTGTTTGTTTGTTTGTTTGTTTTAGAAAAATTGGGATTTCCCCCCACCCCGCCCCACCCAGATAAACTATATCTACAC
1121 TGTCTCGTCAAGTTCTCTGACACGATCTTTCTGGGCTCTACATTTCCTACTAGTTTGTGTCCAGAAACTGCAAGTTGACA
1201 TGAATAGAGGACAAAGGTTGTGTCTTGCTTTTGTCTCTCTCTTCCCTCCCTGCAACTCTCTCTCCCCTCCTCCCACTCTC
1281 TTCCCCCTCCCCCCTCCTCCCACTGTCTCTCACCTCCCCCACCCCCCACTCTCTCTCATCTCTCGCTGTGTCCTGTGTAT
1361 GTGTGGGTGTGTGTGTATTTGGGTGTGTAAATGTTGGTTCTTCCACTACTGGATTTTGTAATCTAGGATAAATCACTTTT
1441 TTTGGGGACTTTGATTTTGCTCCATTACGTTTTCATTTTTTCTGAGCACTGACTGTTCTGAAAGCTGCACAAAACGTAGA
1521 AAGAAGACATAGCGCCTGCCAGGGAATAGGAAATGAGGGCACTTACACATTAATGTGAATTAGTAATTGTGGTATAGAAA
1601 TGTTTTATAGTGAAAGATTCAAATTTGCTTTTCAAGAAAAATGCCAAAAGCTATTTAAATAATTCGAGGTTACATCGTAG
1681 GTTTTGATTTTTCTCAATTTAAGATACAGAAATACAGCAAGCCTTAATATAAAGTTTCCTAAAGTTTCTTCAAGTATTTT
1761 TTAAGGTGGAGAAATGCAGGAATTGTATAACCAGAATTGTTCCTGCCTTTAGCTTTTCAGAACTTGAGATGTGGCAGCAC
1841 TGGACTGGGTTTTTTTAAATGTTAGGACTAGGAATGTTTGCTCTTGTTAATTATGAATTAATTGATTATTAAGTTTAGAA
1921 TGCATTTTTACAAGTATCTAACTATCAAATTGTGTTTAGTAACTTGAGTGTATGCACAAGTTTGATCAACAGCAAAATAG
2001 AGTTCTGAATTTCTTTTAAAGTGATGATATATTATTTTGTGAAACTTTGTGTTTGAAAATGTTTATTTCTGTTTATGGTG
2081 TAATCATTCTGAGGTGAGGCTTTTCTTATTTCCTTTGCATTTTGCTAGAGCTGTGCTGAGTTCAGCATTTGCTTATTTAA
2161 CCACTACATAATGACAGACCAGTTATTAGGTATTAGCATGTGTGGTAATAATAATAGTGGAACTTCACACTTACATCAAT
2241 TCAGTGCAGGGGCATAGAATAAAATATTAAATATTGGCAGATGTATGAAAAGAAGTGTGAGTTAAAAATATTGAATATTG
2321 GCAGGTGTGAAAACAAGTGTCAAAATTCCTCATATAGAGAAAATAATTTTGAGTTTAGAGTATTATCTTTTAATTAAGTG
2401 TAGTCTAAACTTAACTTTCTGTAAAGGCACTTTGTGGTTTTTCCAAAGATGTTCTAGATCTATTTGGTTGCTCTATAGTC
2481 AAACAGCTCTTTTGAAGACAACTGTCTTATTTTATTACAAATTGGCTTGACATATTTATACTGTAACATTGTAATATTGC
2561 TGTGCTGTACATTTTGGCCCTTACGAAATACGTCTTTTTCAGAACTGTTAAAGTTTTGATGTACATCGAGCTGAATTCTG
2641 TTTTTACCAGTTTCAAAACCTTCAAGTGATATGTGGAAAAAAGTGAATGAGACCTCTGATAGGGGGTTTTCAGAACCTTG
2721 TTCACACCAAAATGTGACAGTTCTTTCATGTTTTCCTAAACCAAGTTAAAATTACATGTATATTTTGGTGTTAAGGTTGA
2801 TTTTTAAGATACTTCTGATTTGTACAAAAGGAATGTTTCCTTTATAAATCACAGAAGAAAATGACAATATCTGTTGGATA
2881 TTTGATATAATTTAATGGTGTTATAAAACCTTTAAGAGGATTCATGGTGAATATATGTGATAACATCTTTATACTTTGAA
2961 AAATGTTCCACTTACCCTTCAGATATTTGTTGTAAGTTAATTCAATTCTTAATACTTTAATTTTGCTCCAACAAGGGCTT
3041 TATGTTGCTGGTAAGAGAATTTATTTACTAAATGCACTATGTATAAAGTGAAAGATAGTTTACTTATCTGACTTTGATAT
3121 TAGATGGCTGACATTAGTGCACATAATGCAGAGTTTAACCTTGATTCTTCAACAGAGTCCAGATTTAAATGTCTACTTAG
3201 TTAATTAGTTAGCTGATATTCTTCCACAATTAATATATTCAATTTCCCATCAGTATATCACTTTAAATTTTATGTTTTTC
3281 TAAGGAAACTTTCCACAGAATTTTAAACAACTGATGCATCCATACTCAGGGTGTAGGGAGAATACTTTGCATTTAAAAAC
3361 CCTGTCCACCTGTCACCAGCACAAGAGAATTAGAGCTTCAGTGAGAATTTAGAAAAATTATACTAAAGTGAGATGCATTT
3441 TTTCTCATTTTCAGCAAGACTCCTCTAAGCATTTACTCATTTACTGTATTCCTGCTCTGAAGATGTGGATACAGAATTAG
3521 TCACTCTTGTCACTTTATTTATTTATTGGTTTTTTTTTAACCATCTGTGTACATTCCTTTCATAGGGTAGAGTTCTAGTT
3601 CTAGAAGTTCTTATTTTGTTTTTGTTGTAATGTTTGAATACTATTTAATATCCGGTTTTAATATTGCTGGATTTGCTACC
3681 TTTGGTTACTTGTGCAGTGTTAAAAGTAATCCACTTTCTTGTTTAATATACCAGATACATAGCAAAAGCAGCTTGGAATA
3761 ATTATAGCTGTTTATTTGGCTGTGCTCAGTTACTATATTAAGATCTTGTACTGTGTAACAGTAACTCTTTTTTGCTTTTC
3841 AGTAATTTAATATGTTCACTTAACAAAATACGAACTTTGAGATGCACTAAAGTTTTGTTTCAGCAGTGGCTCAAAAAATT
3921 TCAGAAATTACTTTTGTAATTATTTGCAATTAATTGTTCTTTTATCTTACAATTGTTTAAGCCTGTGATCTTTCTTCTCC
4001 CAGCTAAGAGTTCTTCAATAAATTTAAGAAATACCTGGTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUA-CACGACGAu 5'
              | |||  || |||||||| 
Target 5' ttgtATCCA-AATAGTGCTGCTa 3'
309 - 330 153.00 -15.70
2
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||| : | |||  ||:|||| 
Target 5' aaCAAGGGCTTTA--TGTTGCTg 3'
3030 - 3050 136.00 -11.70
3
miRNA  3' gugUUUGGUAAUAC----ACGACGau 5'
             | |::||| ||    ||||||  
Target 5' ttgACATTATT-TGCCAATGCTGCca 3'
636 - 660 132.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30158294 46 COSMIC
COSN16998886 49 COSMIC
COSN30100894 52 COSMIC
COSN31525867 78 COSMIC
COSN16377654 365 COSMIC
COSN20110648 486 COSMIC
COSN6625126 490 COSMIC
COSN21166347 607 COSMIC
COSN31569977 612 COSMIC
COSN1158564 623 COSMIC
COSN27329189 723 COSMIC
COSN23883616 724 COSMIC
COSN8587592 725 COSMIC
COSN8587593 727 COSMIC
COSN26561400 811 COSMIC
COSN31551812 859 COSMIC
COSN31545301 872 COSMIC
COSN31537029 880 COSMIC
COSN6625127 1005 COSMIC
COSN6625128 1032 COSMIC
COSN29995015 1045 COSMIC
COSN16030424 1046 COSMIC
COSN20110653 1058 COSMIC
COSN1158565 1203 COSMIC
COSN17522842 1223 COSMIC
COSN7401912 1559 COSMIC
COSN26230326 1761 COSMIC
COSN8592368 1949 COSMIC
COSN7401913 2413 COSMIC
COSN17590848 2981 COSMIC
COSN17422293 3032 COSMIC
COSN23508173 3444 COSMIC
COSN17201630 3447 COSMIC
COSN31594629 3559 COSMIC
COSN29467828 3835 COSMIC
COSN31543819 3845 COSMIC
COSN24030439 3873 COSMIC
COSN31512744 3904 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759460870 16 dbSNP
rs1240203657 18 dbSNP
rs1308141878 20 dbSNP
rs765076840 22 dbSNP
rs752749799 30 dbSNP
rs1236302858 33 dbSNP
rs762628536 34 dbSNP
rs375743416 36 dbSNP
rs756432485 37 dbSNP
rs780410796 37 dbSNP
rs780213079 38 dbSNP
rs753873110 41 dbSNP
rs755143549 42 dbSNP
rs200810715 45 dbSNP
rs747397535 46 dbSNP
rs748728047 46 dbSNP
rs201678881 49 dbSNP
rs543556619 56 dbSNP
rs1406092484 64 dbSNP
rs1304295156 67 dbSNP
rs930821784 84 dbSNP
rs1372335397 91 dbSNP
rs1049283803 97 dbSNP
rs886695324 99 dbSNP
rs1232398176 100 dbSNP
rs1437400844 100 dbSNP
rs1243813802 104 dbSNP
rs1202452261 107 dbSNP
rs139308846 111 dbSNP
rs1343992642 115 dbSNP
rs1045458780 127 dbSNP
rs906939167 139 dbSNP
rs1344687187 140 dbSNP
rs1313561324 141 dbSNP
rs1245878416 145 dbSNP
rs1049250783 150 dbSNP
rs1314218968 151 dbSNP
rs1001310026 152 dbSNP
rs908971877 156 dbSNP
rs1363408181 160 dbSNP
rs1211336503 162 dbSNP
rs1162919853 174 dbSNP
rs1034120387 177 dbSNP
rs1432145517 178 dbSNP
rs1369169831 180 dbSNP
rs1189749189 186 dbSNP
rs1036003858 187 dbSNP
rs957192538 191 dbSNP
rs1392599713 196 dbSNP
rs573764773 209 dbSNP
rs542874913 211 dbSNP
rs1050607896 213 dbSNP
rs889322386 215 dbSNP
rs1360755146 220 dbSNP
rs762096001 228 dbSNP
rs1236278967 229 dbSNP
rs1334596156 233 dbSNP
rs1307263560 236 dbSNP
rs1001043355 237 dbSNP
rs1343466456 240 dbSNP
rs559410997 249 dbSNP
rs956831415 250 dbSNP
rs978102656 251 dbSNP
rs35955076 266 dbSNP
rs1009553682 275 dbSNP
rs565036878 278 dbSNP
rs1025009571 285 dbSNP
rs1160256210 288 dbSNP
rs966033620 288 dbSNP
rs1473682585 291 dbSNP
rs1267258347 293 dbSNP
rs35509656 294 dbSNP
rs971296509 297 dbSNP
rs1367285513 306 dbSNP
rs190072162 323 dbSNP
rs774098622 324 dbSNP
rs1203830651 335 dbSNP
rs1349409077 338 dbSNP
rs930791091 342 dbSNP
rs1260783834 355 dbSNP
rs1229898569 368 dbSNP
rs1321011865 370 dbSNP
rs573119792 378 dbSNP
rs12583300 389 dbSNP
rs144281800 392 dbSNP
rs1316219190 403 dbSNP
rs1384411354 404 dbSNP
rs1265689640 405 dbSNP
rs547726734 415 dbSNP
rs1427485006 419 dbSNP
rs1478561214 420 dbSNP
rs908930451 428 dbSNP
rs940971865 429 dbSNP
rs1045408997 437 dbSNP
rs906845906 443 dbSNP
rs1035971277 444 dbSNP
rs530620468 451 dbSNP
rs1465730803 457 dbSNP
rs1459546485 458 dbSNP
rs1188559852 465 dbSNP
rs1262128182 468 dbSNP
rs1223742800 479 dbSNP
rs3038994 481 dbSNP
rs56054463 481 dbSNP
rs933572239 483 dbSNP
rs374762791 487 dbSNP
rs368243695 489 dbSNP
rs1966817 490 dbSNP
rs1437378998 502 dbSNP
rs889381760 504 dbSNP
rs563869570 514 dbSNP
rs1055512052 516 dbSNP
rs529484185 520 dbSNP
rs1368121793 521 dbSNP
rs1456408283 522 dbSNP
rs1391343174 525 dbSNP
rs1190990031 527 dbSNP
rs1011399190 532 dbSNP
rs1161446545 533 dbSNP
rs1020563661 537 dbSNP
rs1241974587 552 dbSNP
rs1210444434 558 dbSNP
rs903081836 560 dbSNP
rs1389558863 569 dbSNP
rs1008075325 570 dbSNP
rs1435690116 577 dbSNP
rs1319867944 578 dbSNP
rs1195029935 589 dbSNP
rs1342533666 595 dbSNP
rs1299734448 600 dbSNP
rs777054396 604 dbSNP
rs549579060 606 dbSNP
rs1359549072 609 dbSNP
rs1397598625 615 dbSNP
rs1009689085 620 dbSNP
rs9533063 623 dbSNP
rs1327036686 629 dbSNP
rs1320754230 633 dbSNP
rs1231132511 636 dbSNP
rs1171104801 637 dbSNP
rs1269470072 640 dbSNP
rs1384112162 642 dbSNP
rs1181966870 646 dbSNP
rs1329289688 650 dbSNP
rs1208625280 653 dbSNP
rs906495565 657 dbSNP
rs965984514 661 dbSNP
rs1240886394 668 dbSNP
rs974718407 673 dbSNP
rs1220223548 675 dbSNP
rs1479484814 677 dbSNP
rs1178746732 678 dbSNP
rs1182820576 678 dbSNP
rs1173736490 679 dbSNP
rs1294694374 679 dbSNP
rs1316977728 679 dbSNP
rs1330117614 679 dbSNP
rs1342973085 679 dbSNP
rs1367260717 679 dbSNP
rs1403528833 679 dbSNP
rs1413734149 679 dbSNP
rs1439199796 679 dbSNP
rs1457268804 679 dbSNP
rs1480028232 679 dbSNP
rs1491470302 679 dbSNP
rs200275770 679 dbSNP
rs3038992 679 dbSNP
rs56355088 679 dbSNP
rs878885951 679 dbSNP
rs67437928 680 dbSNP
rs1034653829 681 dbSNP
rs12872337 681 dbSNP
rs1484836440 681 dbSNP
rs74490914 682 dbSNP
rs1161705339 683 dbSNP
rs984966809 684 dbSNP
rs908062104 686 dbSNP
rs1312034465 688 dbSNP
rs958669622 691 dbSNP
rs1158285410 695 dbSNP
rs1343367457 697 dbSNP
rs985010260 698 dbSNP
rs1467333883 704 dbSNP
rs1016125956 707 dbSNP
rs940889737 712 dbSNP
rs1378251655 713 dbSNP
rs1435198241 714 dbSNP
rs1412504192 717 dbSNP
rs1289885183 719 dbSNP
rs1210070621 723 dbSNP
rs1162149878 724 dbSNP
rs1350513943 724 dbSNP
rs1261919303 727 dbSNP
rs1227276146 729 dbSNP
rs1282701726 730 dbSNP
rs535025961 732 dbSNP
rs1178005859 741 dbSNP
rs1426466537 743 dbSNP
rs71788303 746 dbSNP
rs775623965 746 dbSNP
rs1189060640 758 dbSNP
rs1450241316 766 dbSNP
rs551358561 767 dbSNP
rs1202058640 769 dbSNP
rs971826937 769 dbSNP
rs1483028985 773 dbSNP
rs928873648 775 dbSNP
rs1212702587 776 dbSNP
rs932952843 779 dbSNP
rs375275589 788 dbSNP
rs1274640854 790 dbSNP
rs1229775996 792 dbSNP
rs1366802095 793 dbSNP
rs985825883 800 dbSNP
rs1255739549 802 dbSNP
rs1394908540 806 dbSNP
rs910777860 808 dbSNP
rs936986942 810 dbSNP
rs1369711393 811 dbSNP
rs1484926127 812 dbSNP
rs1169202125 819 dbSNP
rs1431521784 824 dbSNP
rs367580025 825 dbSNP
rs1055500653 826 dbSNP
rs571310990 828 dbSNP
rs765305659 830 dbSNP
rs947148676 832 dbSNP
rs537106344 834 dbSNP
rs902986078 835 dbSNP
rs1472268914 852 dbSNP
rs1479899066 855 dbSNP
rs1251518286 856 dbSNP
rs1008022926 857 dbSNP
rs945532694 863 dbSNP
rs1046485150 872 dbSNP
rs1290158996 872 dbSNP
rs557192179 872 dbSNP
rs1175567829 874 dbSNP
rs1243447316 875 dbSNP
rs1321724089 889 dbSNP
rs1314513613 891 dbSNP
rs1427422527 899 dbSNP
rs116959577 904 dbSNP
rs996126748 920 dbSNP
rs9533064 924 dbSNP
rs374203561 933 dbSNP
rs952146817 933 dbSNP
rs1411383293 935 dbSNP
rs1432653102 937 dbSNP
rs1162516982 945 dbSNP
rs1033706822 947 dbSNP
rs985258696 952 dbSNP
rs1006169016 953 dbSNP
rs1471715791 965 dbSNP
rs1015024407 978 dbSNP
rs373064678 984 dbSNP
rs1016046838 985 dbSNP
rs1183383684 997 dbSNP
rs961813513 1002 dbSNP
rs1209763291 1005 dbSNP
rs4942107 1005 dbSNP
rs1236476452 1011 dbSNP
rs954503692 1013 dbSNP
rs573047198 1022 dbSNP
rs1408904095 1024 dbSNP
rs928862328 1030 dbSNP
rs1562707 1032 dbSNP
rs182088289 1035 dbSNP
rs1301218111 1036 dbSNP
rs200524748 1037 dbSNP
rs1346123857 1038 dbSNP
rs1455666278 1039 dbSNP
rs113733041 1042 dbSNP
rs1198837660 1042 dbSNP
rs141184519 1042 dbSNP
rs869310567 1042 dbSNP
rs989711142 1042 dbSNP
rs1206304585 1043 dbSNP
rs914166913 1043 dbSNP
rs945500106 1045 dbSNP
rs9594726 1046 dbSNP
rs1482842535 1047 dbSNP
rs1202771581 1050 dbSNP
rs1248493153 1051 dbSNP
rs1478424808 1053 dbSNP
rs1191651680 1054 dbSNP
rs1046622669 1057 dbSNP
rs906600024 1058 dbSNP
rs1452266118 1062 dbSNP
rs1387989550 1066 dbSNP
rs938136378 1072 dbSNP
rs947086030 1078 dbSNP
rs1458998254 1084 dbSNP
rs1400561142 1086 dbSNP
rs976805827 1089 dbSNP
rs1055525818 1090 dbSNP
rs1326501370 1093 dbSNP
rs560796612 1094 dbSNP
rs1005968211 1097 dbSNP
rs1436614879 1099 dbSNP
rs1293390696 1103 dbSNP
rs1369450479 1104 dbSNP
rs1231326891 1107 dbSNP
rs1346781028 1112 dbSNP
rs1037545986 1113 dbSNP
rs116187451 1114 dbSNP
rs993267478 1118 dbSNP
rs1364609210 1121 dbSNP
rs1298382323 1124 dbSNP
rs1030150862 1127 dbSNP
rs1338945154 1128 dbSNP
rs902936354 1132 dbSNP
rs954605185 1135 dbSNP
rs1007350901 1144 dbSNP
rs1292318291 1156 dbSNP
rs1429643908 1158 dbSNP
rs148729821 1159 dbSNP
rs1040891777 1163 dbSNP
rs957695968 1168 dbSNP
rs899746654 1173 dbSNP
rs996745255 1179 dbSNP
rs1443982754 1186 dbSNP
rs549300683 1203 dbSNP
rs1048327181 1205 dbSNP
rs1342823416 1209 dbSNP
rs1276628880 1214 dbSNP
rs767285847 1222 dbSNP
rs61562522 1225 dbSNP
rs768220223 1231 dbSNP
rs1354253263 1236 dbSNP
rs1006231196 1245 dbSNP
rs928149413 1247 dbSNP
rs1015418977 1250 dbSNP
rs1342677958 1251 dbSNP
rs938090623 1253 dbSNP
rs528713021 1254 dbSNP
rs1165757787 1256 dbSNP
rs1170960890 1256 dbSNP
rs1371732490 1256 dbSNP
rs1403168100 1257 dbSNP
rs1163528461 1264 dbSNP
rs909964315 1267 dbSNP
rs1037011788 1270 dbSNP
rs1181213995 1270 dbSNP
rs1405387621 1276 dbSNP
rs1163562294 1279 dbSNP
rs1289204974 1281 dbSNP
rs1391730774 1284 dbSNP
rs149186541 1285 dbSNP
rs897727764 1286 dbSNP
rs1437858498 1288 dbSNP
rs1321859500 1289 dbSNP
rs993409977 1289 dbSNP
rs1300483034 1292 dbSNP
rs371485493 1294 dbSNP
rs1323677107 1295 dbSNP
rs1406548340 1295 dbSNP
rs1429099925 1296 dbSNP
rs1157869247 1298 dbSNP
rs1286104944 1299 dbSNP
rs1357336190 1303 dbSNP
rs1228033417 1304 dbSNP
rs1271319978 1305 dbSNP
rs1331373578 1306 dbSNP
rs1210461054 1307 dbSNP
rs1248605629 1309 dbSNP
rs1446148382 1311 dbSNP
rs1413876674 1313 dbSNP
rs1190777783 1314 dbSNP
rs1239049650 1316 dbSNP
rs1051543868 1317 dbSNP
rs1222424844 1322 dbSNP
rs1472917832 1322 dbSNP
rs571273591 1327 dbSNP
rs1414987212 1328 dbSNP
rs1217790511 1329 dbSNP
rs1367541978 1329 dbSNP
rs1458375990 1329 dbSNP
rs1003027769 1330 dbSNP
rs1384877835 1331 dbSNP
rs1035881684 1333 dbSNP
rs1319541495 1334 dbSNP
rs1399259753 1337 dbSNP
rs1457416605 1345 dbSNP
rs1413640819 1358 dbSNP
rs958878612 1360 dbSNP
rs992121363 1361 dbSNP
rs914836463 1362 dbSNP
rs1017327409 1364 dbSNP
rs1246243500 1364 dbSNP
rs1291690849 1364 dbSNP
rs1188208431 1366 dbSNP
rs1465537347 1367 dbSNP
rs879131506 1367 dbSNP
rs968749622 1370 dbSNP
rs977155317 1371 dbSNP
rs879005810 1378 dbSNP
rs879188125 1380 dbSNP
rs537070939 1383 dbSNP
rs550981189 1384 dbSNP
rs943819571 1386 dbSNP
rs1237122908 1391 dbSNP
rs1362454593 1392 dbSNP
rs1296271532 1401 dbSNP
rs1435131053 1406 dbSNP
rs1040838078 1407 dbSNP
rs1363654525 1417 dbSNP
rs921075477 1431 dbSNP
rs1349858866 1437 dbSNP
rs567638338 1444 dbSNP
rs1048756334 1449 dbSNP
rs888374990 1460 dbSNP
rs189471826 1463 dbSNP
rs1020663279 1470 dbSNP
rs1168057619 1489 dbSNP
rs1450096830 1492 dbSNP
rs552890936 1516 dbSNP
rs1036392134 1517 dbSNP
rs1483160521 1520 dbSNP
rs1238386761 1526 dbSNP
rs1213420085 1528 dbSNP
rs897892685 1531 dbSNP
rs779797326 1533 dbSNP
rs1002932993 1534 dbSNP
rs1308749930 1534 dbSNP
rs181857674 1535 dbSNP
rs958826149 1542 dbSNP
rs991408525 1558 dbSNP
rs1407710957 1568 dbSNP
rs909944510 1569 dbSNP
rs1469027515 1571 dbSNP
rs1013088078 1576 dbSNP
rs1308485220 1579 dbSNP
rs754498202 1580 dbSNP
rs1022293739 1589 dbSNP
rs185082480 1590 dbSNP
rs747782490 1593 dbSNP
rs1374851588 1594 dbSNP
rs771483415 1611 dbSNP
rs924303703 1612 dbSNP
rs965035752 1617 dbSNP
rs1434521259 1619 dbSNP
rs1163006049 1628 dbSNP
rs1423494943 1647 dbSNP
rs1414743211 1654 dbSNP
rs1190530227 1657 dbSNP
rs976444581 1659 dbSNP
rs116583105 1666 dbSNP
rs781618594 1669 dbSNP
rs1181922189 1672 dbSNP
rs922291082 1677 dbSNP
rs1243377502 1682 dbSNP
rs1048256803 1698 dbSNP
rs909774514 1699 dbSNP
rs1294680639 1707 dbSNP
rs933997289 1713 dbSNP
rs1349647710 1719 dbSNP
rs939974812 1724 dbSNP
rs1051597707 1726 dbSNP
rs890383618 1730 dbSNP
rs1037371765 1731 dbSNP
rs575636660 1733 dbSNP
rs1291883376 1738 dbSNP
rs1457422341 1740 dbSNP
rs1250159930 1745 dbSNP
rs1167365273 1751 dbSNP
rs897800167 1754 dbSNP
rs1411667206 1757 dbSNP
rs938671761 1773 dbSNP
rs1334096661 1783 dbSNP
rs1421432544 1786 dbSNP
rs1057198345 1795 dbSNP
rs543844065 1796 dbSNP
rs1014659 1803 dbSNP
rs1021824338 1806 dbSNP
rs574445238 1808 dbSNP
rs904755048 1814 dbSNP
rs1010691943 1823 dbSNP
rs1206424212 1827 dbSNP
rs1345400714 1832 dbSNP
rs540326161 1835 dbSNP
rs770350535 1841 dbSNP
rs1020627299 1850 dbSNP
rs1329287921 1868 dbSNP
rs1031899341 1875 dbSNP
rs775816280 1882 dbSNP
rs902139844 1883 dbSNP
rs964983845 1885 dbSNP
rs75417951 1892 dbSNP
rs1455816074 1894 dbSNP
rs1205511366 1896 dbSNP
rs1249185053 1904 dbSNP
rs769454811 1907 dbSNP
rs1455614841 1917 dbSNP
rs1035248694 1935 dbSNP
rs528674670 1936 dbSNP
rs959907595 1937 dbSNP
rs1201594936 1938 dbSNP
rs990985661 1940 dbSNP
rs1186323172 1941 dbSNP
rs1028028821 1946 dbSNP
rs368932286 1953 dbSNP
rs1454067754 1964 dbSNP
rs1284449838 1967 dbSNP
rs1172152031 1969 dbSNP
rs1392491245 1980 dbSNP
rs1206680818 1996 dbSNP
rs768697504 1999 dbSNP
rs1255401398 2007 dbSNP
rs1233858785 2016 dbSNP
rs962766773 2019 dbSNP
rs1297866275 2022 dbSNP
rs1305762281 2030 dbSNP
rs953847250 2033 dbSNP
rs771380282 2046 dbSNP
rs1319148080 2048 dbSNP
rs1384339160 2048 dbSNP
rs190868170 2061 dbSNP
rs11549104 2078 dbSNP
rs1233546624 2079 dbSNP
rs781737173 2086 dbSNP
rs1300974338 2087 dbSNP
rs943312716 2094 dbSNP
rs1448284224 2095 dbSNP
rs939859686 2095 dbSNP
rs1242408367 2109 dbSNP
rs1194861204 2112 dbSNP
rs1440538978 2113 dbSNP
rs972610979 2120 dbSNP
rs1211287019 2132 dbSNP
rs1486625814 2133 dbSNP
rs1272310241 2134 dbSNP
rs946533127 2135 dbSNP
rs1341536184 2145 dbSNP
rs927867873 2148 dbSNP
rs746164079 2163 dbSNP
rs531144181 2169 dbSNP
rs1229856639 2171 dbSNP
rs1057186697 2178 dbSNP
rs181337326 2180 dbSNP
rs567702465 2181 dbSNP
rs1043552639 2182 dbSNP
rs895385908 2188 dbSNP
rs530094034 2193 dbSNP
rs1428612519 2206 dbSNP
rs114421472 2207 dbSNP
rs1169333241 2208 dbSNP
rs1471626382 2209 dbSNP
rs1367484734 2216 dbSNP
rs146766886 2221 dbSNP
rs1468427280 2222 dbSNP
rs775481596 2222 dbSNP
rs1192355760 2225 dbSNP
rs762017075 2226 dbSNP
rs200385224 2229 dbSNP
rs140377492 2231 dbSNP
rs767567427 2232 dbSNP
rs1197588111 2233 dbSNP
rs1371558097 2233 dbSNP
rs144097896 2235 dbSNP
rs1292838734 2237 dbSNP
rs1234356226 2240 dbSNP
rs1357745684 2253 dbSNP
rs983857152 2255 dbSNP
rs1287062194 2256 dbSNP
rs1409723435 2258 dbSNP
rs1393923006 2268 dbSNP
rs1355586133 2281 dbSNP
rs1440039139 2290 dbSNP
rs1017103243 2295 dbSNP
rs1389566803 2296 dbSNP
rs1323834541 2305 dbSNP
rs904275155 2327 dbSNP
rs867505824 2347 dbSNP
rs961198161 2352 dbSNP
rs1294339213 2356 dbSNP
rs773367335 2362 dbSNP
rs9533065 2365 dbSNP
rs1273240942 2369 dbSNP
rs975024123 2388 dbSNP
rs1184093064 2401 dbSNP
rs1449935169 2404 dbSNP
rs927857749 2421 dbSNP
rs556166011 2422 dbSNP
rs760338242 2431 dbSNP
rs1270607798 2447 dbSNP
rs538186174 2452 dbSNP
rs915890156 2455 dbSNP
rs150972859 2463 dbSNP
rs1374716075 2468 dbSNP
rs1186309007 2474 dbSNP
rs41382557 2476 dbSNP
rs1369590253 2483 dbSNP
rs1056124891 2490 dbSNP
rs1462661749 2490 dbSNP
rs1385937163 2518 dbSNP
rs894764733 2526 dbSNP
rs1401015562 2527 dbSNP
rs926035392 2528 dbSNP
rs1011922669 2531 dbSNP
rs934828910 2533 dbSNP
rs1189384997 2536 dbSNP
rs1477110030 2548 dbSNP
rs1053252411 2549 dbSNP
rs539913833 2554 dbSNP
rs1252422111 2555 dbSNP
rs1188557380 2560 dbSNP
rs79073661 2574 dbSNP
rs898770643 2578 dbSNP
rs1215529610 2579 dbSNP
rs994279675 2580 dbSNP
rs1025799658 2583 dbSNP
rs1217951773 2586 dbSNP
rs1459970653 2591 dbSNP
rs1346572114 2592 dbSNP
rs1303544496 2594 dbSNP
rs1442401962 2595 dbSNP
rs774336963 2596 dbSNP
rs955451335 2602 dbSNP
rs1346722548 2610 dbSNP
rs1008769650 2626 dbSNP
rs186413357 2628 dbSNP
rs41288313 2629 dbSNP
rs889422624 2635 dbSNP
rs1359661007 2636 dbSNP
rs1397398538 2639 dbSNP
rs1455595796 2641 dbSNP
rs1388628300 2643 dbSNP
rs1293548860 2649 dbSNP
rs1005632786 2666 dbSNP
rs967979591 2668 dbSNP
rs977905871 2672 dbSNP
rs1208406073 2673 dbSNP
rs1485643186 2675 dbSNP
rs1318032328 2681 dbSNP
rs1016681193 2689 dbSNP
rs1281597196 2695 dbSNP
rs565178956 2697 dbSNP
rs1294467617 2701 dbSNP
rs923803549 2701 dbSNP
rs1214765811 2720 dbSNP
rs939201791 2721 dbSNP
rs1300889109 2722 dbSNP
rs1413880765 2726 dbSNP
rs961452607 2727 dbSNP
rs1376001685 2734 dbSNP
rs1065235 2736 dbSNP
rs544895155 2780 dbSNP
rs1352811609 2782 dbSNP
rs960548085 2783 dbSNP
rs947688402 2785 dbSNP
rs1038025423 2811 dbSNP
rs990706585 2816 dbSNP
rs752468357 2821 dbSNP
rs74052986 2827 dbSNP
rs1180490778 2834 dbSNP
rs1475046437 2836 dbSNP
rs1258909312 2840 dbSNP
rs1213619307 2842 dbSNP
rs76735263 2854 dbSNP
rs1047219390 2868 dbSNP
rs1184423132 2874 dbSNP
rs1308910559 2875 dbSNP
rs926052643 2876 dbSNP
rs891247111 2878 dbSNP
rs1232530437 2887 dbSNP
rs867935033 2890 dbSNP
rs1295102765 2906 dbSNP
rs1419572048 2909 dbSNP
rs1407883742 2911 dbSNP
rs77315027 2929 dbSNP
rs528468657 2933 dbSNP
rs1343161703 2940 dbSNP
rs1462508091 2943 dbSNP
rs1053147829 2945 dbSNP
rs878988875 2948 dbSNP
rs922742399 2949 dbSNP
rs541185297 2951 dbSNP
rs561298827 2964 dbSNP
rs1049969063 2972 dbSNP
rs1418990499 2983 dbSNP
rs890072870 2986 dbSNP
rs1471910341 2988 dbSNP
rs964177975 3007 dbSNP
rs77627578 3025 dbSNP
rs1038472000 3032 dbSNP
rs766579723 3032 dbSNP
rs1212653171 3033 dbSNP
rs1335277945 3037 dbSNP
rs1274844455 3040 dbSNP
rs1309309562 3051 dbSNP
rs1226291490 3054 dbSNP
rs1335110690 3058 dbSNP
rs75236981 3060 dbSNP
rs191103681 3068 dbSNP
rs993894750 3075 dbSNP
rs1034781174 3076 dbSNP
rs770018428 3078 dbSNP
rs1324186695 3080 dbSNP
rs1440487059 3088 dbSNP
rs1395434061 3092 dbSNP
rs1167572731 3093 dbSNP
rs1451998577 3096 dbSNP
rs960494972 3099 dbSNP
rs1223694173 3104 dbSNP
rs1012091518 3107 dbSNP
rs1420410905 3111 dbSNP
rs1305534952 3118 dbSNP
rs1314241328 3124 dbSNP
rs1023551778 3125 dbSNP
rs1254426115 3128 dbSNP
rs968404675 3134 dbSNP
rs1280142031 3138 dbSNP
rs1241070709 3144 dbSNP
rs1310327744 3150 dbSNP
rs1484813133 3150 dbSNP
rs1440191167 3154 dbSNP
rs947859625 3163 dbSNP
rs1328170615 3165 dbSNP
rs140822265 3175 dbSNP
rs925920910 3176 dbSNP
rs749779454 3178 dbSNP
rs1290006201 3183 dbSNP
rs1455830938 3190 dbSNP
rs79331403 3196 dbSNP
rs1480364062 3197 dbSNP
rs1454279665 3205 dbSNP
rs1047266422 3208 dbSNP
rs988820355 3217 dbSNP
rs1446262238 3230 dbSNP
rs1206624548 3232 dbSNP
rs1262207545 3232 dbSNP
rs891388524 3238 dbSNP
rs922690018 3243 dbSNP
rs1233750711 3255 dbSNP
rs567934903 3266 dbSNP
rs758173127 3274 dbSNP
rs986065960 3280 dbSNP
rs1305964757 3281 dbSNP
rs1455372570 3290 dbSNP
rs183166873 3293 dbSNP
rs1039894943 3295 dbSNP
rs376635417 3299 dbSNP
rs1038635894 3311 dbSNP
rs896797517 3326 dbSNP
rs1432443772 3331 dbSNP
rs1434861712 3332 dbSNP
rs1309523676 3333 dbSNP
rs1354564166 3339 dbSNP
rs903150953 3360 dbSNP
rs1165833034 3361 dbSNP
rs1474890677 3362 dbSNP
rs111918311 3370 dbSNP
rs1195068365 3373 dbSNP
rs1056189738 3377 dbSNP
rs896279177 3380 dbSNP
rs569068833 3382 dbSNP
rs960681043 3384 dbSNP
rs992390573 3390 dbSNP
rs1442371143 3412 dbSNP
rs1023504143 3413 dbSNP
rs1194097471 3414 dbSNP
rs1338993307 3416 dbSNP
rs1012074718 3422 dbSNP
rs530026162 3423 dbSNP
rs973756892 3427 dbSNP
rs1023919474 3429 dbSNP
rs1329959277 3433 dbSNP
rs1293265438 3435 dbSNP
rs1415903710 3437 dbSNP
rs1357860813 3438 dbSNP
rs576520993 3442 dbSNP
rs1326297962 3449 dbSNP
rs1408794556 3451 dbSNP
rs1396853556 3452 dbSNP
rs1169273756 3453 dbSNP
rs1346230805 3456 dbSNP
rs150125876 3458 dbSNP
rs138430778 3463 dbSNP
rs982430167 3466 dbSNP
rs1231050452 3469 dbSNP
rs1179759079 3479 dbSNP
rs1437312984 3489 dbSNP
rs1030882344 3493 dbSNP
rs545384629 3500 dbSNP
rs1274055131 3509 dbSNP
rs575806690 3514 dbSNP
rs912786954 3516 dbSNP
rs955998382 3519 dbSNP
rs1333199745 3523 dbSNP
rs1248584819 3524 dbSNP
rs1469760865 3532 dbSNP
rs1234222649 3534 dbSNP
rs544547372 3543 dbSNP
rs1194226332 3545 dbSNP
rs944330414 3548 dbSNP
rs1040268060 3549 dbSNP
rs11549103 3550 dbSNP
rs1440909449 3550 dbSNP
rs947538307 3550 dbSNP
rs1438295317 3551 dbSNP
rs1043134438 3556 dbSNP
rs1029693662 3564 dbSNP
rs1169222039 3573 dbSNP
rs903287798 3574 dbSNP
rs1157918103 3577 dbSNP
rs563968021 3583 dbSNP
rs878923334 3598 dbSNP
rs879248473 3604 dbSNP
rs985627764 3607 dbSNP
rs761822971 3608 dbSNP
rs911356738 3609 dbSNP
rs941551868 3611 dbSNP
rs1167700423 3622 dbSNP
rs575063473 3623 dbSNP
rs1396087465 3625 dbSNP
rs371005937 3632 dbSNP
rs1310838036 3644 dbSNP
rs896387381 3644 dbSNP
rs753973661 3651 dbSNP
rs540619163 3654 dbSNP
rs1369798248 3655 dbSNP
rs772359863 3659 dbSNP
rs1442906981 3666 dbSNP
rs918845722 3667 dbSNP
rs1343193754 3670 dbSNP
rs1437727135 3677 dbSNP
rs929628235 3679 dbSNP
rs1361508692 3680 dbSNP
rs1317606322 3691 dbSNP
rs1023978241 3692 dbSNP
rs773267579 3695 dbSNP
rs187491366 3715 dbSNP
rs1213098361 3719 dbSNP
rs1410010452 3721 dbSNP
rs560516244 3725 dbSNP
rs1452654123 3727 dbSNP
rs1394767005 3729 dbSNP
rs1194479392 3734 dbSNP
rs896226934 3736 dbSNP
rs973888025 3737 dbSNP
rs1335602034 3739 dbSNP
rs947822186 3740 dbSNP
rs1215451530 3749 dbSNP
rs1044832125 3754 dbSNP
rs1288700535 3758 dbSNP
rs1026666770 3787 dbSNP
rs766067692 3788 dbSNP
rs1303758178 3794 dbSNP
rs1220567896 3795 dbSNP
rs982399187 3797 dbSNP
rs912262372 3799 dbSNP
rs966011327 3800 dbSNP
rs975651673 3805 dbSNP
rs1466925773 3809 dbSNP
rs1000705423 3810 dbSNP
rs921523535 3812 dbSNP
rs947513978 3814 dbSNP
rs1195046289 3820 dbSNP
rs765583869 3825 dbSNP
rs924677855 3828 dbSNP
rs1474860370 3835 dbSNP
rs1184461389 3836 dbSNP
rs1419331365 3841 dbSNP
rs1461540668 3842 dbSNP
rs1164756677 3843 dbSNP
rs1392932259 3851 dbSNP
rs532603044 3853 dbSNP
rs776768240 3855 dbSNP
rs1030872489 3858 dbSNP
rs1057441512 3862 dbSNP
rs141162342 3871 dbSNP
rs191219695 3872 dbSNP
rs1345010710 3873 dbSNP
rs1013343092 3875 dbSNP
rs1211557891 3883 dbSNP
rs759544468 3890 dbSNP
rs1271846122 3894 dbSNP
rs1010178488 3907 dbSNP
rs1215003355 3909 dbSNP
rs1342116627 3915 dbSNP
rs1491137251 3932 dbSNP
rs577520981 3933 dbSNP
rs562636711 3937 dbSNP
rs531554928 3938 dbSNP
rs1303509418 3941 dbSNP
rs555016137 3950 dbSNP
rs548114292 3957 dbSNP
rs1026803065 3960 dbSNP
rs1353048854 3971 dbSNP
rs568329802 3973 dbSNP
rs34211775 3981 dbSNP
rs955419177 3983 dbSNP
rs1426192726 3986 dbSNP
rs1286196869 3998 dbSNP
rs1356126386 4006 dbSNP
rs375245475 4007 dbSNP
rs1258760079 4009 dbSNP
rs1183164045 4014 dbSNP
rs985920971 4015 dbSNP
rs1232767328 4019 dbSNP
rs1018368253 4022 dbSNP
rs1134954 4029 dbSNP
rs765202510 4032 dbSNP
rs1319506665 4034 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.65 3.9e-4 0.641 4.9e-4 23 Click to see details
GSE19536 Breast cancer 0.321 5.6e-4 0.295 1.4e-3 100 Click to see details
GSE21032 Prostate cancer 0.311 2.1e-3 0.259 9.0e-3 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.599 2.6e-3 0.627 1.5e-3 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.596 2.8e-3 0.507 1.1e-2 20 Click to see details
GSE28260 Renal cortex and medulla -0.583 1.8e-2 -0.505 3.9e-2 13 Click to see details
GSE19783 ER- ER- breast cancer 0.228 2.2e-2 0.179 5.7e-2 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.367 3.6e-2 0.379 3.1e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.224 3.8e-2 0.285 1.1e-2 64 Click to see details
GSE32688 Pancreatic cancer 0.176 1.7e-1 0.077 3.4e-1 32 Click to see details
GSE17498 Multiple myeloma -0.146 1.8e-1 -0.319 2.2e-2 40 Click to see details
GSE27834 Pluripotent stem cells -0.219 2.1e-1 -0.065 4.1e-1 16 Click to see details
GSE21849 B cell lymphoma 0.138 2.4e-1 0.072 3.6e-1 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.126 2.7e-1 0.190 1.8e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.187 2.8e-1 0.301 1.7e-1 12 Click to see details
GSE28544 Breast cancer 0.097 3.3e-1 0.358 4.3e-2 24 Click to see details
GSE38226 Liver fibrosis 0.098 3.4e-1 0.192 2.0e-1 21 Click to see details
GSE17306 Multiple myeloma 0.034 4.1e-1 0.071 3.1e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.024 4.1e-1 -0.031 3.9e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells 0.028 4.5e-1 0.059 3.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.028 4.5e-1 0.059 3.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.605 0 -0.615 0 32 Click to see details
PAAD 0.968 0.02 0.800 0.1 4 Click to see details
CHOL -0.638 0.03 -0.633 0.03 9 Click to see details
BLCA -0.436 0.04 -0.255 0.15 18 Click to see details
BRCA 0.186 0.05 0.159 0.07 84 Click to see details
KIRP -0.283 0.06 -0.309 0.04 32 Click to see details
ESCA 0.403 0.11 0.291 0.19 11 Click to see details
UCEC 0.293 0.11 0.244 0.16 19 Click to see details
THCA -0.132 0.16 -0.201 0.06 59 Click to see details
PCPG -0.87 0.16 -0.500 0.33 3 Click to see details
KICH 0.198 0.17 0.232 0.13 25 Click to see details
LIHC 0.126 0.19 0.096 0.26 49 Click to see details
CESC 0.718 0.25 0.500 0.33 3 Click to see details
PRAD -0.096 0.25 -0.008 0.48 50 Click to see details
HNSC 0.077 0.31 0.059 0.36 42 Click to see details
KIRC 0.044 0.36 0.032 0.4 68 Click to see details
LUAD -0.097 0.38 -0.042 0.45 12 Click to see details
COAD 0.093 0.41 -0.095 0.41 8 Click to see details
LUSC -0.013 0.47 -0.027 0.44 38 Click to see details
LUSC -0.013 0.47 -0.027 0.44 38 Click to see details
LUSC -0.013 0.47 -0.027 0.44 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C