miRTarBase - #MIRT063394 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ETNK1   
Synonyms EKI, EKI 1, EKI1, Nbla10396
Description ethanolamine kinase 1
Transcript NM_018638   
Other Transcripts NM_001039481   
Expression
Putative miRNA Targets on ETNK1
3'UTR of ETNK1
(miRNA target sites are highlighted)
>ETNK1|NM_018638|3'UTR
   1 AGAAGAGATTTAATTATTCTCCAGTAGCTGAGCAATGCTTGTGAATCTTTTCTTAAGAAATCCCAAAAAGCCAATATTAG
  81 TTAAAATTCTGTTGTTTAATTTGGTTATCTTGCTTTATAAATTATGCCTCTAAACAATCAAATCTATTTTTGAAATAGAC
 161 TGAATGATGTCAAGAAATATACCTACTGCTATCCGTATGTGGTGGATTAGAAATGTGTTAAATCTGCAAAAGGTATAAAG
 241 ATGTCAGTTTAATTTCTTTGATAATTTAACCTATGTTGTATGTGAATTATTTATTATAAACTTAGCACGATTCTGTGACT
 321 GTTTTTCTCTGTTTCACGTTCGTTGAGTGTAAGCAATGAAAATGTCCCAAATAAGTTTTTTAAGTTTTACTTTAATAAGA
 401 TTAATTTCAGTAAACATTCTAGTTGTTCAGTGTAACCTTTTTATCTTGATGCATTGTAAGTAAAATGAATCATTTACTCT
 481 TGAAATGCCAGTCATTGACTGATGTAGATAATTTAGGATTTTCATATAAAAATAGCTGTTTAGGAAGGTGAAATACATTC
 561 ACTGTCTCTGTTGGTGGTACATCTTGTTGAATTCAATATTAGAAAGTATTTCTTTTTGGGGTAATATAACTTAGAATTAA
 641 ATCCCTGTTTCTCTATGTAGTCTGGCAGTATAAATATAAATATTTACCATATAATCTTGGAATAAGTATTAGTTAATGTT
 721 ACCAAAATCTGTATTAAATAATGTTTTCAAATGCTAAATATGGTCGTTACTATTTTCAGTTTTAAAAATTTTATAGTATC
 801 AAATTGTTTCTAACCAAAAATTTCCTTTTACTTCTAGAGATGCTTTATGTTTTTGATTATTAAATAGTCACTAGTATTGC
 881 TAATTTTTGAAACAAATACACAAAATTTATCATATGTAGAAATAAGAAAATATTGTTTAGGTTAATTATTTTTTACCTAT
 961 CCAGAGTCATTCCTTACATTTCAGTTTCATGTTTCATTCCTCACATTTTAGTTTCATGTTTTAGTTTGATTCTATGTTTT
1041 TAGACTGATAGCAAATGATTACTTGATACATGTAAGTTCAGCGTTATATGTTGAGGCAGTTATATAATTAAATAAGGAAC
1121 ACTTAGGGCATTGATCTTGTACACTTAAAATCTGACAAATGACAAAATGTGAATTAAGCATAAATAGTCATGGCAGGAGG
1201 GCTTTTGTTTATTTCTCTTGTTTTTGTTTAACTGTATTTTTAATTTTGTCTGGTGGTAAGAGGGAGGTAATTATTGTATG
1281 GAAAGAAGTTAGATCTTTCAGATAGATAAATAGGCTTCAGGTTTTGAAGTCTGCTCTGTGTAGTTGAGCAGTCATGGTTA
1361 ACTTTACTTAGAAAATTAGTCTGACAAGCTTTGCACTTCGGTCACATAAGTGCCCATGTACAAAGTTGGCTTACTGGATC
1441 TGCATATTCAAAATATGCAACTACAAATTTATCCTCTGAGAAATCTTCTGAGGAGTCTAATGTATTCCAAATGACTTAAT
1521 ATTCTCAGACAAATGCTTTAAAATACTTGGATTATCTCAAGATTTTTGAAGCTAATAAAGTAAATAGAAACACAGGCCAT
1601 TTTAAATGGTAAATTCTAGTTACATAAATATAATCTTAAAGTATGTTTGTATCTGTAACAGTGTTAGACCAGATTTGGTT
1681 TCTACCTCCCCAATGTTATAAATGTTCACTTTTGTTTTTATAAACCATATTACTGTAAGATCAATAGAACTTTGCCTAGT
1761 TAAGTGAATGGAACCAATTAAACAACTAGTAGCTTTTTATAATGTTAGTGTGAACTTGAAAAATTGTTTTTGGTGGAATT
1841 TTTGTCTGTGGTTAGAACATTTTCATAAAACAGATAAAGAATGTGTAATACTCTTAATTTTTTTTTTTTTTTTTTTTTTT
1921 TTTTTGCTTTCTGCCTTCTAAAGTGCAACAGTATATATCTTGTAGAACTGTGGGAGGAGAGAAGATAATTTTTCTACCTT
2001 ACTCCATATTCTTACTTCAAACTATTTTGAATAGAGGTTCACTGAGCCATTGCTGATAGACTGTGCATAGCTACTAGCTG
2081 TCACACTATTGTAGGTTTTTTGGAGAGATTCATAGGGAAGTGAATGTAACCAGGAATAAAGGCTCTCACTTTAGCTCTGG
2161 GACTATGCAGTGGATCTTGGGAACAAAATAAGATATCTAATCTATTTTCCCCATTCTGGCTAGATTTTGGTTGTTGTGAT
2241 GCTCCTACTTCCTGTATAGGTTTTTGGGATCATGGTGCAGGCTAGTAATAGGATTCAGAATTGCTTCCCTTTTATATCGA
2321 CCATGTAAGGGATTCTAAAGGAGGGTAAATCTCAAAGTGCTCTGAAATCATCCCTCTAAAATCTGTCCTGTGGTGTGCTA
2401 AGATGTCTGTTGCCTTTTTATGTTAAGCTAAGGAACTTGAATGCCTTACCTAATAACTCAACTAGTAGTAAGCTCATTTT
2481 GTAAATATGAAAATGGCTGTAAGAAGTGGCATTCATGTATATTCAATGTTAGTCAATAGACCATAGTGGCCTGGATGCTT
2561 TAACAAGCCAAATTCCGCAATTTTTTTTCCTTTTTTCCCCTTCATACTTGTATGATCTCACCTGACCAGTGATTTCTTTT
2641 CCTCCTAACCCCATGCTACCACCATTTTCTGGAAATCAAAGAGATGTGGTAGTAAATCATACAGTACACACGATCATCTG
2721 AGATCAATATGAGCACAAAACTCATCAAGTAGGTCTGCCTGGAATGTATATAAAAAATGTAAATAAAAATTTGTAAATTA
2801 GTGTGAACTGTATCTTGCATATGAGACTGTGTATTGTTTTGCATTCTCTTCCCTTTTGTAGAAATTTTTCTGTAAGGAAA
2881 TGATTCAGCTTGTTGGTTTTAGAGTAAAAATAGCCAACAGTTGTGGCTACACAGTGAGATCACAGGAACTGGAAATAGGG
2961 TTTGTCGGCTTTGGTTAATGTCAGTACTCATTTATTTAGCCTCTCAGTGCTTAATAAGACTTTTCTTTATTTTTTAGTTA
3041 GCCGTTAGGTTTTGTGAGGTTAGATTCCTGGAAGCAGTGAATTTATACACTGTTATATTAATAGAGCTCCGTTCTTTGAG
3121 TCATGATTCCAAGCTAAAGGAAATTAAAAATGTAATTTAATAATTTCCTATTTTTAGGGTTGTTAATTTTTTTCTACAAA
3201 AAAACCTTGAAATTTTAGATATCCCAATGTGAATCTAATTTCCATATATACAGAAATTAGACAAATAATAAGTCTTTAGT
3281 TCAACTTAAGCATATCTCAAATGACTTCTCTAAATTTAAAGTTGATCATGATAGGATCATAAAAGACAGAAAAGACTTAA
3361 GTAATCTTGTAATGACAATTATTTCCATTTTTGCTGAACTAAAAATATTTAACTTCATAAATATGTTACTACAGCTTCCA
3441 GATTTAAAGAAAAAAAGTTTCCCCCACTCTCAATTAAAAGTTAGAACCCTCCACTTTTAAAATTATACAAATATTTCTTT
3521 TTTACATTACACAGAAGCCTTCTGTACCATTTTACGAATTTCTGTCTTCATAATATAAGTGAAAATACTGTCATTTCAAT
3601 TTTCTGCTTTAAATTGTTTTTAATAAGCATTCCAAAGTGATACAGACTTAAGCTTTTAATCAATCAGTCATTCAGTTGAT
3681 AGACAAAGTTAGCGATGCTTTATGCTAGGAAACTTGTTGACAGTAACCTGTGCGACTTTATGCAGAAGACAAATGCTAGT
3761 AATTATTATGCACAGAGGAAAAATCATTTTAAGTATGTGGTAAAGCAGCTTCATCTTTCAAAATTGATTTGCTCTGGTTT
3841 TTCTTTAGTCCATTAGATTCCAGAATGTCCTTTTACTGGGAATTTAGTTATGTATTAAGATAACCTGTTTTCAGTTCTTT
3921 TTGAAAAGAAGACATTATTTATATTGAACCACCTTATTTTAAAATTTTTAACTTTTATATACCACTTGTGTGATTCCAGT
4001 GTCATGTCTTGGGTTTGATGTCGTTGGACAGAAAAGTGTATCAATTATTTTAAATGAATTTTTCCCCATGTTTGAGGCTT
4081 AGTCTGTAAATGTGTTGCTGTAACAGAAAATACTTGGGTATGCATTACTTGAATACTTGAAAACTGAAATTAATAAGATG
4161 TATTACATAATGAATTAGATTTCTCTGAACAGTTTTTACACTGAAAATCTTCATTTCTGGATTGCAGTTTGAAATGGAAT
4241 GAAGACCTGAATTATTTGGGTAGAAAAAATTATGATAGTGCTTATAAGAACTGTAAACTGTTTTAAACTATTTTGTGTTT
4321 GACGCATCAAACTTCAAGTTTTTTGTAAGTTTCTCTCCTGAAATTTTCTTTCTCTTCTATACTTTATGCACTTACTATAC
4401 TACTGATGTAATAAAAGAGCAGGGTTAAAAATATTGTATCTGTATTCATTGTGAATCCTGTAGCTTTTCTAGTTAACAAA
4481 AAATCGCTTTCTAAAATACTCTTAATCCCATTGTTTTGGTTAACATCTTACCCATTTGTTGTATTTCAAATGCCATTAAT
4561 CATTTTAGTACAACACCTATGTTTATAAAAATTTGAAAACATTACATATTGTATTTAAAACTAATTAGTGAAGAGTAAGA
4641 AAAAAACTAGCCAACAGAATTGTAGGTGATGCATTAGTTAAATTTCAAAACTCATAATAAAGGAACTTTCAGAGATTGGT
4721 TGAAACCCAGTGGTATCCCTGTAAATTAGCTCCTGTGACTGGAAAAGACCCCAAAAAGGCAGTAGAGGAGATTAGTGTTT
4801 ACTTGCTGTGGTTGTGGTGTGCTGCTACTTAATTATAGGTAGTGACACACTGAAATTCTTATTTGTCCAATAATCTGAAG
4881 TAGTTTCCTATATTTATCTGTACTAAATTGACTATAAATTGAGTCTGCAAAGAGGAAACTTTTTGACTGTACTGTATTTA
4961 GGAGCCTTTGTACAGCTTGGTCAAATTTCCATGATATGAAGTATTTGAGTTTTAAAATATACTGTTATTAAAAGGAAAAA
5041 GACATGGCCATTATTCCATGTGCTTAAATGATAATTTCCTTATTCAGTTTCAGAAGAAAAAGAATGAAATTGGGTAACTG
5121 TCATTGCGTTAGCTTTATGTTGAATTGGGAAATTGTGGCATAAAGCTTAAATTCGTGTTTATCAAATGTGAACCATAGTA
5201 GTATAATGCTGCTTTGTATATAATGTAAGTGCTACAAATAGTCTCAGCACTGAAAATGTATTGATACCTCTTAAATGAAT
5281 GCAACTTTTGATGTAGGTGTTTTGCTATGCCTCAGAAAATATCTGTCTGAGAATTTGTTAATCTGTTTGATAATGAAGAT
5361 ACTTCCTGTTTTCTTGTTTCATATTTTCATGTTCAAAATTTAAGTTTTACATTTTTACTACTGTTAATTTAAATAAAATT
5441 TGTTCTGTGGATAAAATGAGGTTGGCAGTGAAGAAAATTAAAAACAGCCTCATTCATGTAACTGGTTAAGTAAAAATACA
5521 TTTTCACTATGTGTTCATAAACTTTTAATGAAGCTGTTTGTCTTTCAGTTCAAATATAAGTGATGTTTAGGCTTTATTTC
5601 TGTTAATAAGGCTTTTTACCATTGATTAAATGAAGGAATGTATCTTTTTGAAGAGATTTATATTCTGTAAATAAAAATTC
5681 GTTGTAACAATAAAGTTGAGTTCTAACTACAGTGTATTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-----AUA-CACGACGAu 5'
            ::||||||     |||  ||||||| 
Target 5' tgTGAACCATAGTAGTATAATGCTGCTt 3'
5187 - 5214 160.00 -14.30
2
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              :::::| :||||||||| 
Target 5' ctgtGGTTGTGGTGTGCTGCTa 3'
4806 - 4827 158.00 -16.50
3
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            :|: |::|  |||||:|||| 
Target 5' ctTAGTCTGTAAATGTGTTGCTg 3'
4078 - 4100 144.00 -13.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31479638 6 COSMIC
COSN30479925 23 COSMIC
COSN31497651 27 COSMIC
COSN30466250 53 COSMIC
COSN24312772 58 COSMIC
COSN30474220 64 COSMIC
COSN30158886 98 COSMIC
COSN1146256 108 COSMIC
COSN19646404 109 COSMIC
COSN26175414 140 COSMIC
COSN30167621 149 COSMIC
COSN7322721 279 COSMIC
COSN1146257 329 COSMIC
COSN20092536 381 COSMIC
COSN16449994 736 COSMIC
COSN20109339 800 COSMIC
COSN7612998 1035 COSMIC
COSN4701929 1091 COSMIC
COSN30544896 1096 COSMIC
COSN30545022 1117 COSMIC
COSN31519152 1150 COSMIC
COSN30545029 1162 COSMIC
COSN31542043 1197 COSMIC
COSN30541165 1240 COSMIC
COSN31522321 1257 COSMIC
COSN22711525 1265 COSMIC
COSN31480830 1332 COSMIC
COSN30545027 1481 COSMIC
COSN31515377 1542 COSMIC
COSN28111783 1569 COSMIC
COSN31593982 1615 COSMIC
COSN31547662 1636 COSMIC
COSN30159367 1711 COSMIC
COSN31585329 1748 COSMIC
COSN19501468 1844 COSMIC
COSN15677893 1988 COSMIC
COSN25789434 2053 COSMIC
COSN1567314 2107 COSMIC
COSN26349263 2332 COSMIC
COSN31563726 2450 COSMIC
COSN31588386 2555 COSMIC
COSN31565665 2565 COSMIC
COSN22807082 2589 COSMIC
COSN26808666 2705 COSMIC
COSN27685454 2764 COSMIC
COSN31541269 2804 COSMIC
COSN31539166 2825 COSMIC
COSN8585873 2869 COSMIC
COSN31881820 2881 COSMIC
COSN20092537 2984 COSMIC
COSN5938735 3308 COSMIC
COSN8705943 3519 COSMIC
COSN31546818 3660 COSMIC
COSN25401860 3979 COSMIC
COSN25398957 4025 COSMIC
COSN7322722 4354 COSMIC
COSN20617071 4357 COSMIC
COSN22386145 4380 COSMIC
COSN27159974 4674 COSMIC
COSN25929220 4788 COSMIC
COSN20092538 4853 COSMIC
COSN7322723 4895 COSMIC
COSN31523679 4999 COSMIC
COSN31567741 5018 COSMIC
COSN31588109 5055 COSMIC
COSN31563727 5151 COSMIC
COSN21090763 5175 COSMIC
COSN31549270 5238 COSMIC
COSN30540805 5278 COSMIC
COSN31565944 5332 COSMIC
COSN20092539 5362 COSMIC
COSN31568879 5542 COSMIC
COSN31606781 5614 COSMIC
COSN31607870 5638 COSMIC
COSN28633573 5661 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1231807419 5 dbSNP
rs1309931478 7 dbSNP
rs377113417 11 dbSNP
rs539842901 22 dbSNP
rs1327869403 25 dbSNP
rs1360800265 26 dbSNP
rs181367012 28 dbSNP
rs1352799615 31 dbSNP
rs1435336407 32 dbSNP
rs1364976306 34 dbSNP
rs1318905779 35 dbSNP
rs781436816 35 dbSNP
rs745969645 39 dbSNP
rs1381372265 42 dbSNP
rs1285156741 43 dbSNP
rs369665317 44 dbSNP
rs1224722581 45 dbSNP
rs780747349 46 dbSNP
rs749812731 48 dbSNP
rs535450267 52 dbSNP
rs779162414 53 dbSNP
rs987525040 55 dbSNP
rs1464663973 64 dbSNP
rs929561018 67 dbSNP
rs1169515559 75 dbSNP
rs12316161 79 dbSNP
rs778414521 80 dbSNP
rs138515741 81 dbSNP
rs541295954 111 dbSNP
rs1256865117 113 dbSNP
rs920055279 128 dbSNP
rs1482017491 136 dbSNP
rs1421118890 139 dbSNP
rs1012913763 161 dbSNP
rs931416035 166 dbSNP
rs1228725794 179 dbSNP
rs1340958202 182 dbSNP
rs1295876506 183 dbSNP
rs1247354691 187 dbSNP
rs771061531 192 dbSNP
rs186999399 195 dbSNP
rs908618360 196 dbSNP
rs1462377604 206 dbSNP
rs1394775711 218 dbSNP
rs377529341 222 dbSNP
rs577431418 223 dbSNP
rs1372528867 231 dbSNP
rs1308665480 240 dbSNP
rs1429365661 242 dbSNP
rs1388485359 243 dbSNP
rs938717813 246 dbSNP
rs1002923339 248 dbSNP
rs1035275354 249 dbSNP
rs1057440639 267 dbSNP
rs1368808213 271 dbSNP
rs956541399 274 dbSNP
rs771257770 279 dbSNP
rs543185232 283 dbSNP
rs988489248 287 dbSNP
rs1205176776 291 dbSNP
rs1022201900 294 dbSNP
rs1310525737 297 dbSNP
rs894402397 305 dbSNP
rs562651938 306 dbSNP
rs1357549289 311 dbSNP
rs1283938473 316 dbSNP
rs967722806 326 dbSNP
rs1042931612 328 dbSNP
rs776629924 330 dbSNP
rs985759472 338 dbSNP
rs759772817 339 dbSNP
rs1368778358 342 dbSNP
rs1325834377 343 dbSNP
rs1406139380 348 dbSNP
rs998675868 349 dbSNP
rs1162384720 368 dbSNP
rs1459821107 372 dbSNP
rs141163915 374 dbSNP
rs890200438 375 dbSNP
rs919438321 377 dbSNP
rs770047319 381 dbSNP
rs548340922 382 dbSNP
rs1017654030 385 dbSNP
rs1230650923 392 dbSNP
rs929477192 393 dbSNP
rs1049812344 396 dbSNP
rs1451777649 396 dbSNP
rs964329200 403 dbSNP
rs1331660800 405 dbSNP
rs374911721 411 dbSNP
rs370988717 414 dbSNP
rs1456431021 417 dbSNP
rs34490298 423 dbSNP
rs975613355 426 dbSNP
rs1027122605 427 dbSNP
rs1276651657 430 dbSNP
rs776159273 431 dbSNP
rs952909333 432 dbSNP
rs982892841 433 dbSNP
rs1330681583 435 dbSNP
rs1322657062 440 dbSNP
rs1180359514 452 dbSNP
rs1459740011 453 dbSNP
rs1044422855 467 dbSNP
rs1413404102 469 dbSNP
rs1159874570 471 dbSNP
rs1456608680 474 dbSNP
rs1475559250 480 dbSNP
rs1405200764 489 dbSNP
rs562093001 505 dbSNP
rs960390450 506 dbSNP
rs528011316 509 dbSNP
rs1191349837 512 dbSNP
rs548087781 525 dbSNP
rs1002974039 534 dbSNP
rs915875825 536 dbSNP
rs1208685579 555 dbSNP
rs948680761 558 dbSNP
rs746134393 565 dbSNP
rs1043025348 575 dbSNP
rs925843038 581 dbSNP
rs1344392241 582 dbSNP
rs1356679072 583 dbSNP
rs191738259 586 dbSNP
rs577984988 597 dbSNP
rs560095587 603 dbSNP
rs890219109 613 dbSNP
rs967943380 625 dbSNP
rs1434306438 627 dbSNP
rs1343295923 629 dbSNP
rs1354497555 638 dbSNP
rs1009023074 652 dbSNP
rs1233345707 658 dbSNP
rs1336090323 662 dbSNP
rs1382005611 669 dbSNP
rs1414603754 671 dbSNP
rs1423834031 673 dbSNP
rs1171408882 675 dbSNP
rs1450901809 677 dbSNP
rs540044656 689 dbSNP
rs1391194255 690 dbSNP
rs1038715221 707 dbSNP
rs1485180056 709 dbSNP
rs550354530 718 dbSNP
rs184027698 719 dbSNP
rs994446893 730 dbSNP
rs1217968955 734 dbSNP
rs375195492 766 dbSNP
rs761731500 767 dbSNP
rs976265388 773 dbSNP
rs1237116185 776 dbSNP
rs752184013 784 dbSNP
rs72185722 798 dbSNP
rs866000936 801 dbSNP
rs1016139385 812 dbSNP
rs1213845943 815 dbSNP
rs569804942 826 dbSNP
rs1285938869 834 dbSNP
rs1448635894 855 dbSNP
rs1374354206 856 dbSNP
rs1261132895 861 dbSNP
rs535539618 864 dbSNP
rs12317915 869 dbSNP
rs1370721510 875 dbSNP
rs984978454 879 dbSNP
rs1169026813 884 dbSNP
rs1422337809 892 dbSNP
rs1416381852 894 dbSNP
rs1182993419 896 dbSNP
rs1413094623 902 dbSNP
rs1472732071 912 dbSNP
rs1255515375 913 dbSNP
rs1175862323 942 dbSNP
rs970070441 956 dbSNP
rs909345089 962 dbSNP
rs750385766 964 dbSNP
rs978756486 968 dbSNP
rs1415019264 972 dbSNP
rs1314560665 974 dbSNP
rs1044643184 979 dbSNP
rs928641450 980 dbSNP
rs1411194128 998 dbSNP
rs938653635 1016 dbSNP
rs571990797 1028 dbSNP
rs925895227 1030 dbSNP
rs1352015566 1032 dbSNP
rs1165867200 1033 dbSNP
rs934530879 1035 dbSNP
rs1337805632 1036 dbSNP
rs1472988582 1044 dbSNP
rs1175732514 1046 dbSNP
rs891877999 1049 dbSNP
rs1267010831 1050 dbSNP
rs534286908 1053 dbSNP
rs1333885197 1055 dbSNP
rs1271255050 1061 dbSNP
rs1230125068 1063 dbSNP
rs1012037447 1069 dbSNP
rs558053532 1070 dbSNP
rs944484948 1072 dbSNP
rs1043575721 1077 dbSNP
rs903668419 1082 dbSNP
rs1369211228 1083 dbSNP
rs1007450297 1084 dbSNP
rs1440714014 1085 dbSNP
rs1017456829 1088 dbSNP
rs764018312 1096 dbSNP
rs1363326975 1098 dbSNP
rs577467868 1104 dbSNP
rs552262168 1105 dbSNP
rs900229748 1108 dbSNP
rs751432540 1114 dbSNP
rs1268404567 1115 dbSNP
rs950503151 1120 dbSNP
rs1048704068 1127 dbSNP
rs1467904127 1129 dbSNP
rs556735408 1137 dbSNP
rs187364222 1149 dbSNP
rs1016457595 1165 dbSNP
rs1329721955 1169 dbSNP
rs1283916448 1171 dbSNP
rs1236169789 1174 dbSNP
rs1487992185 1188 dbSNP
rs542294325 1189 dbSNP
rs1301605646 1197 dbSNP
rs201147670 1199 dbSNP
rs749728658 1204 dbSNP
rs1369283683 1208 dbSNP
rs1322911133 1211 dbSNP
rs970193084 1231 dbSNP
rs1244320389 1233 dbSNP
rs980377185 1237 dbSNP
rs1004400410 1241 dbSNP
rs1477332608 1249 dbSNP
rs1467701636 1253 dbSNP
rs1190903751 1255 dbSNP
rs1378250828 1257 dbSNP
rs1173287581 1261 dbSNP
rs1452763427 1262 dbSNP
rs1396097501 1264 dbSNP
rs1434898560 1266 dbSNP
rs562008074 1277 dbSNP
rs1393057828 1290 dbSNP
rs928865824 1300 dbSNP
rs368140470 1303 dbSNP
rs1483971441 1310 dbSNP
rs1256032796 1311 dbSNP
rs988831737 1317 dbSNP
rs913191925 1321 dbSNP
rs1300277520 1337 dbSNP
rs1015778390 1350 dbSNP
rs1043100183 1355 dbSNP
rs1294117824 1361 dbSNP
rs903720846 1366 dbSNP
rs1403037483 1374 dbSNP
rs1312293968 1384 dbSNP
rs960516880 1389 dbSNP
rs1014409026 1390 dbSNP
rs1328070452 1395 dbSNP
rs943197527 1400 dbSNP
rs1475651086 1401 dbSNP
rs527708735 1407 dbSNP
rs541021922 1410 dbSNP
rs1425437136 1422 dbSNP
rs1023510470 1424 dbSNP
rs997808970 1426 dbSNP
rs1025990629 1427 dbSNP
rs1276410310 1439 dbSNP
rs1302365930 1445 dbSNP
rs1339180259 1453 dbSNP
rs545670617 1460 dbSNP
rs1249933311 1463 dbSNP
rs886078589 1467 dbSNP
rs12312458 1477 dbSNP
rs368508362 1481 dbSNP
rs1341529154 1484 dbSNP
rs753350750 1496 dbSNP
rs774323107 1500 dbSNP
rs1352396761 1501 dbSNP
rs1032972469 1503 dbSNP
rs1236286212 1505 dbSNP
rs955958070 1522 dbSNP
rs1350321049 1540 dbSNP
rs1165880133 1546 dbSNP
rs1459388538 1561 dbSNP
rs754515271 1575 dbSNP
rs200138533 1584 dbSNP
rs1473969705 1597 dbSNP
rs1253303585 1598 dbSNP
rs1182114983 1599 dbSNP
rs1436811198 1608 dbSNP
rs778750102 1618 dbSNP
rs1286431476 1620 dbSNP
rs1450349346 1622 dbSNP
rs1221502935 1624 dbSNP
rs1016007130 1625 dbSNP
rs11046535 1631 dbSNP
rs764190513 1632 dbSNP
rs1331356334 1634 dbSNP
rs911799023 1634 dbSNP
rs1035823971 1635 dbSNP
rs757017372 1671 dbSNP
rs141532899 1688 dbSNP
rs1441769769 1690 dbSNP
rs754014240 1691 dbSNP
rs1378084693 1693 dbSNP
rs74068270 1694 dbSNP
rs758857992 1696 dbSNP
rs989440467 1703 dbSNP
rs1158574752 1708 dbSNP
rs974597640 1709 dbSNP
rs1386539837 1713 dbSNP
rs1469309474 1730 dbSNP
rs921718605 1742 dbSNP
rs1230888272 1746 dbSNP
rs1325116758 1751 dbSNP
rs913251041 1758 dbSNP
rs947357839 1768 dbSNP
rs1212392882 1771 dbSNP
rs930360022 1780 dbSNP
rs1306820461 1786 dbSNP
rs189725623 1798 dbSNP
rs1223360179 1811 dbSNP
rs1348618696 1814 dbSNP
rs886079022 1817 dbSNP
rs570239071 1830 dbSNP
rs1235264079 1831 dbSNP
rs1371498992 1848 dbSNP
rs2129613 1849 dbSNP
rs896067465 1854 dbSNP
rs942748149 1858 dbSNP
rs1014870983 1859 dbSNP
rs549076289 1866 dbSNP
rs1274349775 1868 dbSNP
rs1405131630 1871 dbSNP
rs773841031 1872 dbSNP
rs1454410916 1875 dbSNP
rs1197078861 1876 dbSNP
rs1394872625 1880 dbSNP
rs755194709 1881 dbSNP
rs1192069391 1888 dbSNP
rs1451715104 1892 dbSNP
rs1243261646 1894 dbSNP
rs1215683099 1896 dbSNP
rs1023100252 1897 dbSNP
rs1171351307 1898 dbSNP
rs1186480006 1898 dbSNP
rs1188660348 1898 dbSNP
rs1207533710 1898 dbSNP
rs1239296588 1898 dbSNP
rs1278527880 1898 dbSNP
rs1309078422 1898 dbSNP
rs1335554369 1898 dbSNP
rs1342955681 1898 dbSNP
rs1374545665 1898 dbSNP
rs1392103093 1898 dbSNP
rs1420632484 1898 dbSNP
rs1429897083 1898 dbSNP
rs1434955845 1898 dbSNP
rs1451779327 1898 dbSNP
rs1474683475 1898 dbSNP
rs1485381301 1898 dbSNP
rs3983448 1898 dbSNP
rs577546967 1898 dbSNP
rs5796967 1898 dbSNP
rs905949924 1899 dbSNP
rs1273395931 1900 dbSNP
rs1436825675 1900 dbSNP
rs1213932673 1902 dbSNP
rs1359699667 1905 dbSNP
rs1000256957 1912 dbSNP
rs1414929819 1925 dbSNP
rs1491331990 1925 dbSNP
rs1354248901 1926 dbSNP
rs1420971795 1926 dbSNP
rs1452591374 1927 dbSNP
rs1171705216 1928 dbSNP
rs1033023149 1930 dbSNP
rs1365235096 1930 dbSNP
rs1471506894 1931 dbSNP
rs956054550 1932 dbSNP
rs765953812 1933 dbSNP
rs1418472878 1934 dbSNP
rs1462949108 1939 dbSNP
rs1328990981 1941 dbSNP
rs1170113543 1950 dbSNP
rs1395531369 1952 dbSNP
rs372570437 1956 dbSNP
rs1019316522 1958 dbSNP
rs965978890 1963 dbSNP
rs1255451057 1965 dbSNP
rs11046536 1966 dbSNP
rs138002691 1971 dbSNP
rs1481053580 1975 dbSNP
rs561565726 1990 dbSNP
rs1233248723 1994 dbSNP
rs1203646352 1995 dbSNP
rs1016062372 1998 dbSNP
rs1275027624 2001 dbSNP
rs113726303 2007 dbSNP
rs182376718 2011 dbSNP
rs930410764 2012 dbSNP
rs1333566016 2021 dbSNP
rs1392783105 2033 dbSNP
rs771375399 2033 dbSNP
rs867198687 2036 dbSNP
rs571255044 2037 dbSNP
rs1337501078 2049 dbSNP
rs1440534040 2056 dbSNP
rs1217371018 2057 dbSNP
rs907615061 2064 dbSNP
rs940393100 2067 dbSNP
rs536926706 2072 dbSNP
rs1035875302 2073 dbSNP
rs1056126322 2087 dbSNP
rs556774121 2089 dbSNP
rs960460991 2091 dbSNP
rs896064033 2093 dbSNP
rs1419744221 2094 dbSNP
rs1407609213 2096 dbSNP
rs138138439 2097 dbSNP
rs573518527 2102 dbSNP
rs1048796 2104 dbSNP
rs1479561140 2106 dbSNP
rs1254606603 2113 dbSNP
rs963188369 2114 dbSNP
rs1467934612 2115 dbSNP
rs542431700 2132 dbSNP
rs968782858 2139 dbSNP
rs1240641475 2143 dbSNP
rs1044604086 2144 dbSNP
rs978734088 2166 dbSNP
rs1221684151 2174 dbSNP
rs1484521010 2177 dbSNP
rs911188142 2178 dbSNP
rs1326939034 2185 dbSNP
rs964109835 2194 dbSNP
rs1393002339 2197 dbSNP
rs906001933 2198 dbSNP
rs1344656302 2202 dbSNP
rs976779840 2202 dbSNP
rs1157239705 2203 dbSNP
rs3741784 2205 dbSNP
rs933135171 2205 dbSNP
rs1453565917 2210 dbSNP
rs572411559 2214 dbSNP
rs1047671721 2217 dbSNP
rs1206797419 2226 dbSNP
rs1168417561 2227 dbSNP
rs1033118196 2231 dbSNP
rs1372471538 2232 dbSNP
rs1485931284 2233 dbSNP
rs541453826 2248 dbSNP
rs1213240764 2255 dbSNP
rs941889383 2256 dbSNP
rs78491157 2258 dbSNP
rs1234094780 2267 dbSNP
rs1400264466 2268 dbSNP
rs1414403140 2280 dbSNP
rs1018910827 2292 dbSNP
rs905501306 2299 dbSNP
rs533693556 2301 dbSNP
rs1436825408 2310 dbSNP
rs1376362226 2315 dbSNP
rs996081331 2317 dbSNP
rs544110802 2319 dbSNP
rs1433919189 2323 dbSNP
rs1375688458 2324 dbSNP
rs951907040 2328 dbSNP
rs769856870 2343 dbSNP
rs563935688 2344 dbSNP
rs1195276921 2348 dbSNP
rs1057265877 2349 dbSNP
rs896015260 2352 dbSNP
rs1190792730 2359 dbSNP
rs1486359993 2360 dbSNP
rs1280660366 2366 dbSNP
rs149508913 2371 dbSNP
rs1327602729 2373 dbSNP
rs1230060248 2382 dbSNP
rs1254646579 2387 dbSNP
rs1346208169 2397 dbSNP
rs1345239569 2407 dbSNP
rs907664263 2410 dbSNP
rs1280656294 2411 dbSNP
rs1010813746 2421 dbSNP
rs775745585 2425 dbSNP
rs969382904 2434 dbSNP
rs1184326359 2440 dbSNP
rs1312537246 2452 dbSNP
rs1413119222 2455 dbSNP
rs1260941839 2456 dbSNP
rs186999182 2458 dbSNP
rs1372492865 2464 dbSNP
rs1018247857 2466 dbSNP
rs1475926811 2470 dbSNP
rs917568358 2474 dbSNP
rs963993419 2475 dbSNP
rs976832189 2494 dbSNP
rs1393076180 2495 dbSNP
rs922669711 2496 dbSNP
rs1196814647 2497 dbSNP
rs1339120305 2500 dbSNP
rs749410768 2510 dbSNP
rs950360746 2527 dbSNP
rs954606073 2535 dbSNP
rs1235644729 2541 dbSNP
rs771905686 2545 dbSNP
rs1417936215 2552 dbSNP
rs1288428544 2554 dbSNP
rs879350926 2557 dbSNP
rs1292696288 2558 dbSNP
rs927511133 2567 dbSNP
rs1231699530 2575 dbSNP
rs895979343 2577 dbSNP
rs565776222 2578 dbSNP
rs1391808381 2581 dbSNP
rs569555566 2581 dbSNP
rs891880648 2581 dbSNP
rs1370684395 2584 dbSNP
rs1462906332 2589 dbSNP
rs941941882 2590 dbSNP
rs528170240 2600 dbSNP
rs1235524955 2612 dbSNP
rs550990470 2618 dbSNP
rs1010279735 2619 dbSNP
rs1471523109 2625 dbSNP
rs191819215 2631 dbSNP
rs1182051102 2634 dbSNP
rs1437652523 2651 dbSNP
rs901873702 2655 dbSNP
rs1236685885 2661 dbSNP
rs996117164 2663 dbSNP
rs561560806 2665 dbSNP
rs596408 2670 dbSNP
rs1469256217 2685 dbSNP
rs1028907622 2697 dbSNP
rs140515218 2712 dbSNP
rs936977508 2713 dbSNP
rs1006017948 2728 dbSNP
rs1206849081 2730 dbSNP
rs371733321 2737 dbSNP
rs962121342 2744 dbSNP
rs991895105 2745 dbSNP
rs567403332 2760 dbSNP
rs969104620 2761 dbSNP
rs1194103358 2763 dbSNP
rs536459334 2769 dbSNP
rs1009952942 2772 dbSNP
rs1395218016 2772 dbSNP
rs1042291871 2778 dbSNP
rs980431070 2782 dbSNP
rs1386448216 2785 dbSNP
rs1158816626 2800 dbSNP
rs1378864043 2802 dbSNP
rs552886415 2810 dbSNP
rs1195815141 2828 dbSNP
rs1454977701 2828 dbSNP
rs778425276 2830 dbSNP
rs1219967495 2834 dbSNP
rs1448847838 2839 dbSNP
rs927561919 2840 dbSNP
rs936201153 2844 dbSNP
rs142855454 2857 dbSNP
rs1455453638 2865 dbSNP
rs1324429025 2873 dbSNP
rs1054628256 2875 dbSNP
rs913375455 2899 dbSNP
rs1314952833 2902 dbSNP
rs1000425560 2905 dbSNP
rs147436953 2908 dbSNP
rs1434155289 2913 dbSNP
rs1040486782 2918 dbSNP
rs148713215 2929 dbSNP
rs1174153752 2931 dbSNP
rs1328360644 2933 dbSNP
rs1372636649 2934 dbSNP
rs901924753 2946 dbSNP
rs932021287 2947 dbSNP
rs1399758056 2957 dbSNP
rs386761153 2967 dbSNP
rs760684955 2967 dbSNP
rs578080344 2968 dbSNP
rs543809363 2969 dbSNP
rs1190006037 2974 dbSNP
rs1316964239 2980 dbSNP
rs563974229 2984 dbSNP
rs1015186523 2985 dbSNP
rs1271193836 2990 dbSNP
rs1487343822 2991 dbSNP
rs1282800702 3002 dbSNP
rs574210981 3004 dbSNP
rs543252393 3006 dbSNP
rs1277590775 3015 dbSNP
rs1377834276 3020 dbSNP
rs1217418049 3026 dbSNP
rs927187982 3028 dbSNP
rs1024764458 3044 dbSNP
rs992911231 3045 dbSNP
rs1479750258 3055 dbSNP
rs1014929960 3068 dbSNP
rs183177623 3086 dbSNP
rs1314365010 3089 dbSNP
rs1420950226 3090 dbSNP
rs188649483 3095 dbSNP
rs867392964 3096 dbSNP
rs957625446 3097 dbSNP
rs1420926778 3098 dbSNP
rs1167825075 3103 dbSNP
rs1476907878 3109 dbSNP
rs551078278 3111 dbSNP
rs142295135 3112 dbSNP
rs946277863 3115 dbSNP
rs1236682905 3126 dbSNP
rs1207838209 3127 dbSNP
rs976650490 3128 dbSNP
rs764830472 3146 dbSNP
rs1353145942 3163 dbSNP
rs900094956 3168 dbSNP
rs1315555620 3179 dbSNP
rs1297221745 3180 dbSNP
rs932028219 3197 dbSNP
rs1300702947 3198 dbSNP
rs998416735 3198 dbSNP
rs16925296 3205 dbSNP
rs1355450837 3207 dbSNP
rs118156699 3220 dbSNP
rs1464473770 3225 dbSNP
rs942024406 3230 dbSNP
rs1036303881 3245 dbSNP
rs1233860781 3259 dbSNP
rs1420128706 3270 dbSNP
rs897733655 3274 dbSNP
rs1165659137 3285 dbSNP
rs1474917857 3287 dbSNP
rs1411967966 3297 dbSNP
rs1004730718 3300 dbSNP
rs1471062264 3301 dbSNP
rs1017018517 3305 dbSNP
rs1197947901 3306 dbSNP
rs1456333052 3309 dbSNP
rs1048797 3310 dbSNP
rs1433994899 3319 dbSNP
rs538730246 3326 dbSNP
rs777024812 3330 dbSNP
rs192957454 3333 dbSNP
rs1310185910 3346 dbSNP
rs904943339 3347 dbSNP
rs1225069309 3348 dbSNP
rs374247340 3364 dbSNP
rs1001928274 3367 dbSNP
rs1233650781 3370 dbSNP
rs868662321 3379 dbSNP
rs1032023473 3383 dbSNP
rs1034146664 3387 dbSNP
rs958623929 3390 dbSNP
rs1327152023 3414 dbSNP
rs73082506 3417 dbSNP
rs988211858 3420 dbSNP
rs1020570860 3424 dbSNP
rs968002811 3445 dbSNP
rs916924570 3450 dbSNP
rs945717487 3450 dbSNP
rs1177848203 3452 dbSNP
rs538801369 3459 dbSNP
rs1254863956 3461 dbSNP
rs1475792597 3462 dbSNP
rs1194146681 3464 dbSNP
rs925700156 3466 dbSNP
rs1263117364 3472 dbSNP
rs73082509 3473 dbSNP
rs1317072910 3482 dbSNP
rs578109238 3487 dbSNP
rs986209046 3488 dbSNP
rs909280792 3490 dbSNP
rs942075353 3501 dbSNP
rs1304862366 3512 dbSNP
rs1386665564 3513 dbSNP
rs1409746764 3534 dbSNP
rs1036762869 3540 dbSNP
rs775052115 3547 dbSNP
rs781712396 3556 dbSNP
rs185624904 3557 dbSNP
rs1046245995 3560 dbSNP
rs1157055708 3561 dbSNP
rs746357660 3563 dbSNP
rs1417672110 3565 dbSNP
rs899983833 3567 dbSNP
rs1431262745 3568 dbSNP
rs565300918 3570 dbSNP
rs1354241440 3572 dbSNP
rs904995753 3574 dbSNP
rs1187834683 3576 dbSNP
rs1002023170 3580 dbSNP
rs1053574706 3581 dbSNP
rs1213968388 3583 dbSNP
rs35073632 3592 dbSNP
rs11541361 3600 dbSNP
rs1004209958 3607 dbSNP
rs1009245195 3608 dbSNP
rs1359851882 3618 dbSNP
rs1021002457 3621 dbSNP
rs1298354726 3626 dbSNP
rs1382893956 3629 dbSNP
rs1339891795 3634 dbSNP
rs1296611714 3635 dbSNP
rs574304538 3636 dbSNP
rs1416798009 3637 dbSNP
rs1377065491 3638 dbSNP
rs577672943 3650 dbSNP
rs1038504193 3656 dbSNP
rs1273449256 3658 dbSNP
rs879223883 3664 dbSNP
rs967674121 3665 dbSNP
rs151273751 3667 dbSNP
rs1422236229 3668 dbSNP
rs1279941040 3671 dbSNP
rs11046537 3676 dbSNP
rs1486410168 3685 dbSNP
rs1030528547 3693 dbSNP
rs1200298942 3694 dbSNP
rs559963424 3703 dbSNP
rs958547871 3711 dbSNP
rs1014616081 3714 dbSNP
rs953571701 3729 dbSNP
rs573380005 3734 dbSNP
rs977057946 3735 dbSNP
rs1235379569 3740 dbSNP
rs925586316 3741 dbSNP
rs1333743817 3743 dbSNP
rs909333053 3745 dbSNP
rs1395293514 3753 dbSNP
rs11046538 3760 dbSNP
rs1399759837 3762 dbSNP
rs762454958 3762 dbSNP
rs957132961 3767 dbSNP
rs1431207255 3771 dbSNP
rs139282010 3777 dbSNP
rs1167997873 3780 dbSNP
rs1475894118 3793 dbSNP
rs189378449 3794 dbSNP
rs530514982 3796 dbSNP
rs1368732685 3799 dbSNP
rs1186358047 3800 dbSNP
rs1253036948 3801 dbSNP
rs75654280 3801 dbSNP
rs919227252 3803 dbSNP
rs1335635284 3807 dbSNP
rs76167366 3814 dbSNP
rs1429973005 3825 dbSNP
rs528826768 3828 dbSNP
rs1174923507 3834 dbSNP
rs1270503888 3838 dbSNP
rs11046539 3849 dbSNP
rs1335528324 3854 dbSNP
rs11046540 3857 dbSNP
rs1051817445 3858 dbSNP
rs1338510739 3860 dbSNP
rs79556170 3868 dbSNP
rs774611289 3871 dbSNP
rs940228141 3881 dbSNP
rs1231858512 3886 dbSNP
rs1329196604 3889 dbSNP
rs926525446 3892 dbSNP
rs1462597593 3893 dbSNP
rs1302947073 3899 dbSNP
rs1038388406 3914 dbSNP
rs898474240 3916 dbSNP
rs763538122 3919 dbSNP
rs1179731780 3924 dbSNP
rs191164600 3929 dbSNP
rs1406832057 3948 dbSNP
rs546591682 3951 dbSNP
rs566729676 3954 dbSNP
rs376715235 3958 dbSNP
rs1053584864 3961 dbSNP
rs1213044177 3973 dbSNP
rs1282254705 3974 dbSNP
rs1452287971 3978 dbSNP
rs1446892727 3982 dbSNP
rs746842755 3985 dbSNP
rs770847639 4005 dbSNP
rs1208302295 4006 dbSNP
rs1353192559 4009 dbSNP
rs1009710214 4012 dbSNP
rs776770135 4023 dbSNP
rs1375835392 4027 dbSNP
rs1452953312 4038 dbSNP
rs1042069643 4039 dbSNP
rs1193462958 4044 dbSNP
rs1331188919 4054 dbSNP
rs1322227453 4060 dbSNP
rs1394037729 4061 dbSNP
rs900865271 4064 dbSNP
rs1158854929 4067 dbSNP
rs1173773252 4078 dbSNP
rs1419526728 4082 dbSNP
rs1378813631 4083 dbSNP
rs144306539 4090 dbSNP
rs571810536 4100 dbSNP
rs967326839 4112 dbSNP
rs1196920647 4114 dbSNP
rs998701301 4117 dbSNP
rs1030577968 4122 dbSNP
rs537521626 4125 dbSNP
rs759492997 4131 dbSNP
rs953620433 4134 dbSNP
rs557359781 4137 dbSNP
rs1016344965 4150 dbSNP
rs1399657076 4160 dbSNP
rs975165068 4161 dbSNP
rs1345711978 4165 dbSNP
rs1318865081 4166 dbSNP
rs1433743503 4167 dbSNP
rs547148093 4173 dbSNP
rs921014496 4176 dbSNP
rs1398954199 4178 dbSNP
rs972528840 4184 dbSNP
rs1359044593 4190 dbSNP
rs919335559 4191 dbSNP
rs955769861 4205 dbSNP
rs1390818623 4208 dbSNP
rs1425144655 4222 dbSNP
rs1171301183 4225 dbSNP
rs536619188 4226 dbSNP
rs1476449255 4228 dbSNP
rs1438434443 4237 dbSNP
rs1324975104 4242 dbSNP
rs1487390378 4249 dbSNP
rs1259865404 4251 dbSNP
rs1371924796 4253 dbSNP
rs1442769641 4274 dbSNP
rs1277882997 4276 dbSNP
rs971158946 4279 dbSNP
rs1319416360 4299 dbSNP
rs1278215237 4305 dbSNP
rs146646684 4309 dbSNP
rs908670225 4311 dbSNP
rs940272932 4317 dbSNP
rs369209435 4324 dbSNP
rs1350001303 4325 dbSNP
rs919953366 4334 dbSNP
rs754961074 4336 dbSNP
rs555124929 4337 dbSNP
rs1401127172 4340 dbSNP
rs1170140849 4346 dbSNP
rs1476872702 4353 dbSNP
rs1270574663 4366 dbSNP
rs1182638833 4380 dbSNP
rs1467533843 4381 dbSNP
rs146597393 4387 dbSNP
rs574736107 4388 dbSNP
rs989331377 4390 dbSNP
rs915051638 4398 dbSNP
rs1197524561 4402 dbSNP
rs1258627766 4402 dbSNP
rs1315494641 4406 dbSNP
rs1314467377 4407 dbSNP
rs1228487619 4412 dbSNP
rs945218052 4418 dbSNP
rs1200511919 4427 dbSNP
rs1282716017 4432 dbSNP
rs1230869935 4445 dbSNP
rs1378364454 4445 dbSNP
rs774826485 4448 dbSNP
rs900918854 4459 dbSNP
rs1045580756 4460 dbSNP
rs1412810106 4465 dbSNP
rs933683012 4465 dbSNP
rs1049349473 4472 dbSNP
rs1459821115 4474 dbSNP
rs183624495 4477 dbSNP
rs1238755932 4481 dbSNP
rs558719864 4486 dbSNP
rs1016399196 4487 dbSNP
rs996465984 4489 dbSNP
rs1028368331 4492 dbSNP
rs1320809862 4492 dbSNP
rs955160453 4502 dbSNP
rs1354829462 4503 dbSNP
rs540528377 4506 dbSNP
rs899358167 4509 dbSNP
rs1388334987 4512 dbSNP
rs1445153248 4526 dbSNP
rs993661198 4532 dbSNP
rs1369841151 4533 dbSNP
rs575027541 4535 dbSNP
rs1435841007 4539 dbSNP
rs1327093088 4544 dbSNP
rs1160659698 4550 dbSNP
rs1015786528 4554 dbSNP
rs1442940273 4561 dbSNP
rs559856726 4572 dbSNP
rs1333271075 4574 dbSNP
rs1437670241 4576 dbSNP
rs1233246941 4577 dbSNP
rs1191324030 4578 dbSNP
rs970804150 4582 dbSNP
rs1487858995 4595 dbSNP
rs982112430 4604 dbSNP
rs1033657033 4610 dbSNP
rs1218292441 4626 dbSNP
rs974355806 4633 dbSNP
rs1285690137 4634 dbSNP
rs1358883489 4640 dbSNP
rs1314535143 4644 dbSNP
rs959291268 4663 dbSNP
rs543890591 4666 dbSNP
rs1194496736 4671 dbSNP
rs141362576 4672 dbSNP
rs915145749 4673 dbSNP
rs1218773707 4678 dbSNP
rs1247972940 4684 dbSNP
rs529680959 4687 dbSNP
rs920172663 4695 dbSNP
rs1360933691 4696 dbSNP
rs938202372 4701 dbSNP
rs1297420795 4716 dbSNP
rs990841940 4717 dbSNP
rs1379347720 4719 dbSNP
rs751216735 4735 dbSNP
rs1176658482 4750 dbSNP
rs917880063 4751 dbSNP
rs540181010 4753 dbSNP
rs751665686 4761 dbSNP
rs1253369450 4769 dbSNP
rs977942336 4770 dbSNP
rs1488377327 4774 dbSNP
rs1262015729 4779 dbSNP
rs1214980979 4781 dbSNP
rs1484430815 4788 dbSNP
rs1474160489 4791 dbSNP
rs560197978 4792 dbSNP
rs1209969418 4805 dbSNP
rs1042849292 4812 dbSNP
rs532438668 4813 dbSNP
rs1336661414 4823 dbSNP
rs552447147 4830 dbSNP
rs1340190123 4837 dbSNP
rs1418543260 4838 dbSNP
rs569056650 4840 dbSNP
rs1404039980 4849 dbSNP
rs1303383846 4853 dbSNP
rs1465437091 4854 dbSNP
rs1165948720 4859 dbSNP
rs1172277471 4862 dbSNP
rs933701132 4871 dbSNP
rs16925301 4891 dbSNP
rs545512289 4899 dbSNP
rs1028003236 4901 dbSNP
rs1425947326 4906 dbSNP
rs567704431 4919 dbSNP
rs780204678 4947 dbSNP
rs899411784 4950 dbSNP
rs994081835 4954 dbSNP
rs1026445075 4959 dbSNP
rs906629166 4966 dbSNP
rs1277807087 4973 dbSNP
rs1225614070 4976 dbSNP
rs1003600881 4989 dbSNP
rs1015751213 4991 dbSNP
rs753914257 4995 dbSNP
rs1395237696 4998 dbSNP
rs1338286333 5003 dbSNP
rs959387052 5003 dbSNP
rs1333261973 5004 dbSNP
rs989480679 5006 dbSNP
rs536257779 5021 dbSNP
rs974238152 5037 dbSNP
rs1459060065 5048 dbSNP
rs1368680921 5059 dbSNP
rs553319139 5074 dbSNP
rs1484389595 5075 dbSNP
rs1209596323 5077 dbSNP
rs1256695244 5084 dbSNP
rs371266219 5097 dbSNP
rs1425502421 5102 dbSNP
rs1179765007 5111 dbSNP
rs200385491 5119 dbSNP
rs566868493 5124 dbSNP
rs991454553 5128 dbSNP
rs373083641 5129 dbSNP
rs922435951 5133 dbSNP
rs949403163 5154 dbSNP
rs1311414447 5158 dbSNP
rs558762857 5175 dbSNP
rs985205001 5176 dbSNP
rs1326358231 5184 dbSNP
rs188379423 5197 dbSNP
rs941067887 5202 dbSNP
rs1391059427 5212 dbSNP
rs1162245335 5214 dbSNP
rs1423161070 5219 dbSNP
rs1382500483 5220 dbSNP
rs1038007023 5221 dbSNP
rs544765547 5226 dbSNP
rs1159803130 5234 dbSNP
rs1439554355 5236 dbSNP
rs920848347 5238 dbSNP
rs1201171643 5239 dbSNP
rs554373409 5242 dbSNP
rs181259203 5246 dbSNP
rs906733430 5247 dbSNP
rs1287808632 5249 dbSNP
rs34050861 5253 dbSNP
rs1240595036 5258 dbSNP
rs1003697451 5268 dbSNP
rs1054226960 5276 dbSNP
rs914380021 5282 dbSNP
rs1055256542 5283 dbSNP
rs1331138711 5286 dbSNP
rs1295251269 5292 dbSNP
rs895225361 5293 dbSNP
rs143246609 5297 dbSNP
rs1322498338 5298 dbSNP
rs539890689 5304 dbSNP
rs1362854819 5312 dbSNP
rs1010917778 5316 dbSNP
rs1419472740 5319 dbSNP
rs9435 5320 dbSNP
rs1174800043 5322 dbSNP
rs1299335309 5322 dbSNP
rs369134827 5323 dbSNP
rs532482586 5329 dbSNP
rs1197541507 5332 dbSNP
rs999417904 5335 dbSNP
rs1209462249 5341 dbSNP
rs1264154507 5345 dbSNP
rs1256102065 5347 dbSNP
rs1446177793 5349 dbSNP
rs1484173411 5355 dbSNP
rs546133489 5362 dbSNP
rs1008303998 5369 dbSNP
rs765552447 5371 dbSNP
rs1282019280 5378 dbSNP
rs1221152863 5382 dbSNP
rs1342054585 5383 dbSNP
rs1465172029 5389 dbSNP
rs562742853 5392 dbSNP
rs531536123 5397 dbSNP
rs1036658726 5401 dbSNP
rs1336745978 5412 dbSNP
rs896914708 5412 dbSNP
rs1402109744 5419 dbSNP
rs1174439889 5421 dbSNP
rs995226558 5422 dbSNP
rs1027173236 5424 dbSNP
rs1193162193 5429 dbSNP
rs1474971441 5437 dbSNP
rs1240082551 5439 dbSNP
rs1189543578 5442 dbSNP
rs1443003466 5444 dbSNP
rs1262422889 5448 dbSNP
rs531346639 5453 dbSNP
rs1201288364 5465 dbSNP
rs959511428 5469 dbSNP
rs1258341995 5479 dbSNP
rs1012529969 5480 dbSNP
rs955231032 5481 dbSNP
rs1286391622 5490 dbSNP
rs985257232 5496 dbSNP
rs911003512 5503 dbSNP
rs1382761897 5519 dbSNP
rs1025640766 5526 dbSNP
rs970792737 5530 dbSNP
rs750078305 5533 dbSNP
rs962399134 5540 dbSNP
rs550759585 5548 dbSNP
rs548323016 5565 dbSNP
rs1408354938 5577 dbSNP
rs1416228537 5582 dbSNP
rs1176819145 5594 dbSNP
rs567693229 5598 dbSNP
rs1379475265 5604 dbSNP
rs115590851 5620 dbSNP
rs918231139 5621 dbSNP
rs546703845 5633 dbSNP
rs923912543 5634 dbSNP
rs1437714786 5638 dbSNP
rs1305464237 5639 dbSNP
rs958130439 5639 dbSNP
rs1368277487 5641 dbSNP
rs1233156118 5644 dbSNP
rs1301595597 5645 dbSNP
rs1359120295 5653 dbSNP
rs1313577761 5670 dbSNP
rs929618337 5672 dbSNP
rs530900742 5673 dbSNP
rs879541522 5680 dbSNP
rs914433980 5681 dbSNP
rs779072258 5682 dbSNP
rs867383693 5685 dbSNP
rs750553462 5689 dbSNP
rs1250931271 5690 dbSNP
rs1384330080 5693 dbSNP
rs1055266441 5701 dbSNP
rs1441398398 5706 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.693 1.2e-4 0.552 3.2e-3 23 Click to see details
GSE21032 Prostate cancer 0.373 2.6e-4 0.313 2.0e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.701 2.9e-4 0.823 4.2e-6 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.437 1.6e-2 0.385 3.2e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.569 2.1e-2 -0.599 1.5e-2 13 Click to see details
GSE19783 ER- ER- breast cancer 0.212 3.0e-2 0.155 8.6e-2 79 Click to see details
GSE19536 Breast cancer 0.166 4.9e-2 0.126 1.1e-1 100 Click to see details
GSE17498 Multiple myeloma -0.241 6.7e-2 -0.243 6.5e-2 40 Click to see details
GSE32688 Pancreatic cancer 0.254 8.0e-2 0.111 2.7e-1 32 Click to see details
GSE14794 Lymphoblastoid cells -0.146 8.5e-2 -0.138 9.7e-2 90 Click to see details
GSE27834 Pluripotent stem cells -0.327 1.1e-1 -0.368 8.0e-2 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.188 1.8e-1 0.205 1.6e-1 25 Click to see details
GSE17306 Multiple myeloma 0.124 2.0e-1 0.048 3.7e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.054 4.0e-1 -0.042 4.2e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.053 4.1e-1 -0.047 4.2e-1 20 Click to see details
GSE28544 Breast cancer 0.038 4.3e-1 0.481 8.7e-3 24 Click to see details
GSE21849 B cell lymphoma -0.03 4.4e-1 -0.007 4.9e-1 29 Click to see details
GSE38226 Liver fibrosis 0.028 4.5e-1 -0.018 4.7e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.014 4.6e-1 -0.049 3.5e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.002 5.0e-1 -0.098 3.8e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.002 5.0e-1 -0.098 3.8e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.692 0 0.641 0 18 Click to see details
BRCA -0.282 0 -0.252 0.01 84 Click to see details
STAD 0.378 0.02 0.393 0.01 32 Click to see details
HNSC -0.325 0.02 -0.254 0.05 42 Click to see details
PAAD 0.936 0.03 1.000 0.5 4 Click to see details
LUSC 0.236 0.08 0.322 0.02 38 Click to see details
LIHC -0.201 0.08 -0.178 0.11 49 Click to see details
CESC 0.941 0.11 1.000 0.5 3 Click to see details
PRAD 0.171 0.12 0.156 0.14 50 Click to see details
KIRP -0.187 0.15 -0.217 0.12 32 Click to see details
UCEC 0.218 0.18 0.089 0.36 19 Click to see details
THCA -0.107 0.21 -0.129 0.17 59 Click to see details
LUAD 0.15 0.32 0.203 0.26 12 Click to see details
KICH 0.09 0.33 0.175 0.2 25 Click to see details
COAD 0.098 0.41 -0.190 0.33 8 Click to see details
PCPG -0.238 0.42 -0.500 0.33 3 Click to see details
CHOL 0.042 0.46 0.133 0.37 9 Click to see details
ESCA -0.031 0.46 -0.164 0.31 11 Click to see details
KIRC 0.007 0.48 -0.002 0.49 68 Click to see details
KIRC 0.007 0.48 -0.002 0.49 68 Click to see details
KIRC 0.007 0.48 -0.002 0.49 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2