miRTarBase - #MIRT061244 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AMOTL1   
Synonyms JEAP
Description angiomotin like 1
Transcript NM_130847   
Expression
Putative miRNA Targets on AMOTL1
3'UTR of AMOTL1
(miRNA target sites are highlighted)
>AMOTL1|NM_130847|3'UTR
   1 CTGCCATCCCTGTGGAATTTCAGTACAGAACACTGACAAACAAGGAAAGCGGCAGAGAAAGAAGAAAGACCTAGAAGGTT
  81 GTAGATGGGAAATCAGGAATGATTTGAACTGATAAAGATTTCAGACTCATAAGAACACATTTTATAAATGTTAAACACAA
 161 AAACTACATGACTGAAGATAGAAGAGAATGCGATGGATTTTATTACACATGGTGGAAGAGAGAAGAGGCGTGTAGGTTTG
 241 CAAACAAAGTTAAGAAATAGGAAACTGAATTTTTCATTGTACAGAAAATGTATCTCTTGGGGAGGGCCTGTGTACCCCCA
 321 TTCTCTGATTATAAACAGATAAACCCAAATGTGGATCATCCTTGGAATACCCCCATTCTCCTTGCCTCTTAGCATGTTTG
 401 ATTTAAGAAAAGCCTCCAGGAAATCTTGAGAGCCTGTCTTGGCATAATGCAGTGTCACCTGTGCCAACCATGGGGTGTCC
 481 CGTGAGTGTGAGTGTGGCAGTGAGAAGAAGCATCGAGGGCGAGGGGAATATGAAAGTTGGTCTTCACCTAATTACCTGTT
 561 TGGTTTGGATTTTCAAGAGATGATTGGGCTTCTTAGCTTTTCTGAATTCTGCAGTATTTTCTAAACAGGATAGATTATGA
 641 TCTCGGTCCCCATCCATCCTAACTTCTGAGTTCATCTCTGTCTCTGCTTTACAGTCTTTAATTTTTTGTTGTTCCTTCAT
 721 TTTTTTCTTTTTAATAAGACATAGCAGAATTCCTTAGGTATGGGATTTATGAGACCAGTACCTGAACTGTCATCATTCCT
 801 ACTGTGTTTGATAGTGACCAGTAGGACAAAGCCACGTGCCGACTTCCTGGCTGCTTCACCTTTGCATAGCTGGGTTGCAG
 881 CTGCGAACCTCATTCTGACTGTGAACTAAGCAAGCTTTGAGGAGGCAGGAGATTCCGTGGGTCCCTGTGACATATTGCAT
 961 TAAGATCGTGGCACTTGCTTTTTTGTCTTTCACATCGGCTGTCTTGCAAGGAGCTTGACATTTCCAAATTCCATTGCTCT
1041 GTTTGGGGAAGACTTAGGACAGCACTCCAGGAAACAGATGACAATTTACAGACAGTTGTCTCAGTGGTTTCCAGAATCTC
1121 ACCAGCCTCCCGTATAGCTTCTTGTATTGAGGCTCATGAGCGTATTCACACTCTTTCCTCCCCCGCGCACGCCTCTGCTT
1201 GCTCTCGATCAGCATCCAGACCTCCGTGGCACCAGGTTGCCTCTGTTGTGAACTTCTTTTGTAACCTACCAGGCCAGTTG
1281 TATATACAGTGTTGTCAGGTTTTTCCGGGTTTCAGTTTTGAGGCAGTTTATTCAAAGTGAGACAGAAGTGCCACGGAAAA
1361 GAGGCAGGAGTGTGTTAGGTGGTGGGTCCATTAGACCTCTGCTGTGACATTGCATATTCAGCTCTGCAGACACTGGCTTC
1441 CTTTACAAATCTAAGAGATGCTGGATTAGAAAAGAGGAGAAGCTCATCGGGCCATCAGAGAGATGCTCCTACAGGGTCCT
1521 GATGTTTTTGTACCTCCAGGTCAGCTGGATCGCTGTTTTCCCAGTTCCCTTTGCTCATGCTTACTTAGAGGAAGAAAGAA
1601 AGGGGGGTACCTCTTCCAAGTACCTTCTAAATGAAACACTCAAGAGAGTGCTACTCAGGAAACTTTGCTTGGATCCTAAA
1681 ATGGACTGGTCTTGGGTGTGTAACCCCGGTGAAGTTATAGCCTCCCCAAATTGAGGTGACAGAAGGAAGACAAGAGGTGT
1761 AAGCTGGAGAGGGAAGGGAAGAAATCAGTGGCTTTGGCCAGCCTCTGTGCCACCCAGTACGACAGAGGAGTGGGAACTGG
1841 CCCTCTGGGGCTCTGCTTGGCCATAGGCACTGCACATTGTGCCACCTGCTCATCACCTCCTCTAGTCTCACACTGAGCAT
1921 CGGAGTACCTGTTGTGCAGACAGGAAAACTGAGGAGCTCTGAGAGGCTGAGCATGGAGCTCACCCCATGCCATAGGGTGT
2001 GGGAAGAGGGCACAGGAGGCCTCATCCATGGGGGAAAGGGTTGAGGATGGACATGGGTGGGGAGAGGGCATAGACATCCC
2081 TTCCTAATCTCTGTTCCCACCACATTTCATAGGAGATGAGTTAGGAGATGACAGCTAACTCTCTTAAGGACATTTTGACC
2161 CCAGTTTATGTTGGGGATGGACCAGAAAGGAAAATGTCTAGAGATAGGAAGGTAAATCAACTCTGCCAGCCCCTACCATC
2241 AGGTCTGGGCCACCCCAAACTTGGGCTGCCTCCCTTAGACATAGGTTAGAGTGAGAGACCCAGCTGTTTCTCCCGAAGCC
2321 TCGTCTTCATGCCCCAGACACCTGATTGCCCCAATCAGGTGTCAGACTTGCTTGCTCTTCGAGGTCCCCCTGAGCTGCCA
2401 AGTGTTTTCATTGTAAACAGACACATCGCCATGTTTCAGGGCTTCAACGGCATTGTATTTTGGACTTTGACCGTATTTTT
2481 TTTCTCTTAACCTACTGAGACTCTTCCTTAAGAACAGGATCTATAGCTTTAAAATGTCTTCTTCTATGGGAAATTTCCTG
2561 CCAAGCCAGGGCACTAAATTCTTTCATCATTAGAGCTTTCCTGAAGTCCGGCCATATACTGAGTACCTGCTCTGAGTTCT
2641 GGGCAGCTTACAATATCTTAAACAGATTTTCAGAAAAATAATGCAACTATATTTTCTAGTGTCAACTGTATGCAAACAGT
2721 GTGGTAAATACCTTTTAATTAGTCCTCCACCCACCTGGAGTACAGGGGGTGCGTTTATTATTCTGATTTCACTGATGAGG
2801 AAATGGGCTCAGAAAGGTTAAGTCCCTTCCTGAAATCTCACAGCCAGGAGAAGCTAGGATGATTTAAAACAAAGTTTGGA
2881 GAGGCACTGGGCATAGACCCTGGCTGTACAGCCTCTAACATGCGGCACTGCATCTTGGCAGTCTCTATGCCTGTCTGTGA
2961 TGTGTGTGTGCACGTGTAACTACACACACACACACACACACACACACACACACACACAGCTATCACACATCTCAGAGCCT
3041 AAGAAATAGGACTAAGCCCAGAACTCCTAGAATCACCTATAAATGCTAGGCATAGATGGAAATTATTGTGTTCCACCAGA
3121 AGCACAGCTCCAAACTATACCTAAAAAATATTTCTGCACTTCCCAGAGACCTGGACTTCAAACTTTCCCAGTGGAGCCTG
3201 ATTATAGAACTTGAGGGTCCTATCTCAGGATGAAGGGGAGAGGCCCTGGCTTCACGGGAAGGTATTCCAGCATTGTTCTG
3281 CTTCACCCTTGACTGCGTTGTCTGGCAGTTTCTGTGTGCTGCCAGGATATTATATGGAACTGGAGAAGTTGGAGTCAGGT
3361 CTCTGAAGCTAGAGTTTCACTAATTAGATGCCTCTGTACATGAGAACTATTACTGTCTGCAGGTCCATATAGCTAAGCTG
3441 CCAGGAAAAACACATTATCTTCCAAAACTTTCAGAGCATGTGCAGAACCCTTTCTTAGCGTTTTCTTCTCAGCATTTTCT
3521 CTGCCTCCCAGAGGCTGGCAGCCAGTGACACTGCAGAGTTCAGCATGTTCTAACCATGCACGCAGGGCAGGGGCTGCCTT
3601 GGCCCTCCTCAGGCTTTCGTTGGGAGAGCAGGCAGTGGTGGAGCCCTTCTGGGTGCAGTCCTCTGGGGTTGCTCTTTGGA
3681 ACTCATGTATGAGTTTGACTCCACAAGGCTTGGCATGGATACCAAAACAGTTGCAACAAATTAGTTCTGAACCTGGAACA
3761 GAGAATTCAGTGCTTCTGTTACTCAGGAAGGAGGTGTTCAGAATGCCCCGTGCAGAGCAGCCAGTCATTACTCTTGTTTG
3841 TTCTCACCTGGGTGCGCACCCTCATGATGCAGTGGCTGTAGCACCTTCATGCCAGGTGCTGAGAGAATGGGAAATTCTTC
3921 CTCCCCATTGACCTGAGTCCCAGAGACTTAGGGACACAGACTTCAGGTGAGGCTGCGGACCTCAGAAGCAGTGGATAATA
4001 GATTGGGGCATTAAAAGCTTTTGAGGCAGGGGGCTCATGTTTTGACTGCAGGGAGTTATGCTGAGCAAAGAGATGTGTTT
4081 TTCAAAACCAGGGTTCAAAACCAGTGTCCACGCTGGAGTAAGTGGAGCATGCTTCTCTGTGTTCTCTGAATGATCTTGCA
4161 CTCCTCTTAAGCAAAGGAGTACCATGACCATAGTCAGTGGGATCCCACAAATGTTCTTAAATGGGTAAGGCTTTAAGTAG
4241 CCAGAGAGTATCCAGCCTACCATTGGCTTCTCCACATCCTAAAACCTGAGACAGCCTTGGTATATGCTTTATAAATGTTT
4321 CTTTTCTTGTTGTTTAAGTAATTAAAGTGTTTAAAATGTCTTCATTAGATGTGACGATTGTTTAATGAGTTTGCCTCTGA
4401 CGTGTGGCTCCATGGGAGATAGGCAAAGTAATTAAGAAGTTACCAGAAATTGGTCGGCTGGGGAAATGCAAAAGTTAGCA
4481 TTTCAGTAGTGAATTTCTCCTGGAACAAATGAGCAATTTTTCCTCTTTCTCTTAAGTAGTATACCCTTTTCTCACTTAGT
4561 AATTTAATGGTATATAAAGACATGTGTATAAGTGAGTGCATACATATGAGGTATGACTATAGGGTTGTTTGTGGGAATTT
4641 CTTTTCCTAACATACAGAAGATCAAAGTGTTCATCTCACCCCGCCCTCCTTAAAAGGTGTCTTTTGGGAGACTATGTGCT
4721 CATTGACTATAGTGCTGCCAAGTAAAAATATCTTGGGAACTCTTCTACTAGAATGGCCTTCAGGGCTTGGCATGTTCCTT
4801 TGGTTTACCCTTAGAGATGAGAAATCCTCCTCCTTTGAGGATGGATTTAAGTTCTGGAAATAATCTCAAGTGCTTGATAG
4881 CACAGTTGGATGAAAAAAGATGGCAATTAAGGTAAGTTACACCATTTTTGTTTCTAAAAAAATCCCTAAGAAATTTCTTG
4961 GAATGAGTCTTTGGCCTCAGAGCCTCTCAAAGTGTCCACTTCAAGGGGGGATCATCCTCATTAGCACACAGATTTTTAAA
5041 AATCAATTCTCTTGCCATGCCTCCTATGTGTTCACATCTCTGCATACACTACAGATATAAGTGCATAATCATTCATATAA
5121 ACATCTGGTAGGTATTCTGTAAAACTGTGTTTACTTTAGTGCATGTTATTGTCATGTTATGATGTGACTGGGGTGTTTCT
5201 TTGTCATGAAACTTTGCTTCTTCACAGAATTAGAATACTGCTCTCTCTATATTGAACTACATATACAGCGTTTTCTTGTA
5281 TCAGCCCCCAAAGTCTGGATGCCCGGTGTTGTGTTTACATGTGATTGTGCCTAGGAGTCTGTTCACATAGAGACACCTGT
5361 AAGTATTTATTACAAAACGGAATGTAAGCAAATATATCCACATTGGTTTTATTTGAATCAAGGTGTTTTTTTGTTTTTTG
5441 TTTTTTTTCCTTTTGAGGAGGAACAGGGAGCCTCCTCCTCCATGAGCACTTACAGAATTGTGTAAAATTCTGTGAAACAG
5521 TGGTAAGCATGGGCACCCGATTTCAGCTGTCCTGCTGCCGCTGCCCTCCAACCTGCTCTGTGTGTGTGTGTCGCTGTGCT
5601 TGGTGGCAGTGTGCCGTGCTCGTGCCGGCTCTTCCCAGCAGACTGGTATCTGGCTGTAACGTTTGACGTCTTCATATTGC
5681 CAGTCTGTATTGAGGGGTGATGTACATGGCCATACAGCCAAATGGGTCTGTGTACCAGTGTGGGGATTCCAAGAACACTG
5761 CCTGTCCCCCACAGCAAATATTGATGCTGTTGGTCAGCCAAAGATTTTCCTCTCCTTTGCTGCTTAAACTTGTGCCTTAA
5841 TATTGTACATAATAAATGGATAAAATGGCAAAATGACTCTTTTCTCTCGCTTGCTCCTTTCTTCCTTAAAGAACTTATAA
5921 ACTGATGCTCAATAAATGTTTCATTTCATTGTACCCCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |: |  | ||||||| 
Target 5' attttcCTCTCCTTTGCTGCTt 3'
5804 - 5825 144.00 -9.92
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||| :|||:  |||||:| 
Target 5' agCAAA-TATTG-ATGCTGTTg 3'
5773 - 5792 142.00 -12.10
3
miRNA  3' guguUUGGUAAUACACGACGau 5'
              |:::  |:||||||||  
Target 5' tggcAGTTTCTGTGTGCTGCca 3'
3303 - 3324 138.00 -15.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM9611436 1 COSMIC
COSN31587928 4 COSMIC
COSN30168483 11 COSMIC
COSN30532634 51 COSMIC
COSN24383259 78 COSMIC
COSN8879556 525 COSMIC
COSN22919045 533 COSMIC
COSN5711051 716 COSMIC
COSN23434589 914 COSMIC
COSN17075733 1068 COSMIC
COSN6407749 1156 COSMIC
COSN4700173 1861 COSMIC
COSN5711052 1874 COSMIC
COSN31960675 2007 COSMIC
COSN1550702 2229 COSMIC
COSN16034603 2546 COSMIC
COSN1550703 2571 COSMIC
COSN27212525 3019 COSMIC
COSN27284878 3019 COSMIC
COSN27297211 3019 COSMIC
COSN2469285 3256 COSMIC
COSN23873440 3692 COSMIC
COSN26703323 3953 COSMIC
COSN32057893 4073 COSMIC
COSN8286366 4288 COSMIC
COSN23814648 4364 COSMIC
COSN20127674 4457 COSMIC
COSN19080280 4861 COSMIC
COSN31561689 5270 COSMIC
COSN31530191 5276 COSMIC
COSN31481468 5333 COSMIC
COSN31536571 5386 COSMIC
COSN31577114 5433 COSMIC
COSN26505768 5441 COSMIC
COSN31537008 5442 COSMIC
COSN30540548 5472 COSMIC
COSN31523677 5504 COSMIC
COSN26664501 5547 COSMIC
COSN30542133 5561 COSMIC
COSN27353928 5591 COSMIC
COSN30542014 5598 COSMIC
COSN31589282 5716 COSMIC
COSN26603925 5754 COSMIC
COSN16418411 5843 COSMIC
COSN31569941 5880 COSMIC
COSN31607865 5916 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1019931589 5 dbSNP
rs1235973389 6 dbSNP
rs1254811647 7 dbSNP
rs1347748966 9 dbSNP
rs759016619 13 dbSNP
rs1192232875 20 dbSNP
rs767104994 22 dbSNP
rs1456630633 23 dbSNP
rs752243928 24 dbSNP
rs769782140 30 dbSNP
rs1196753702 31 dbSNP
rs1453921988 34 dbSNP
rs1196833386 44 dbSNP
rs773097565 49 dbSNP
rs375793570 51 dbSNP
rs1053085542 54 dbSNP
rs1021424439 60 dbSNP
rs747764423 61 dbSNP
rs1188889835 65 dbSNP
rs968420016 65 dbSNP
rs977501929 70 dbSNP
rs1011565290 71 dbSNP
rs1259929161 79 dbSNP
rs769722607 86 dbSNP
rs905977915 88 dbSNP
rs1443924540 89 dbSNP
rs1399527369 92 dbSNP
rs1165526559 96 dbSNP
rs1406980627 138 dbSNP
rs1001631257 139 dbSNP
rs553382502 145 dbSNP
rs548505386 151 dbSNP
rs1382399670 161 dbSNP
rs1176914276 169 dbSNP
rs1364754607 169 dbSNP
rs992445385 171 dbSNP
rs1224466803 180 dbSNP
rs1450338519 180 dbSNP
rs1289628567 189 dbSNP
rs896031669 190 dbSNP
rs1374308332 191 dbSNP
rs11020969 192 dbSNP
rs1025930062 193 dbSNP
rs1375562561 198 dbSNP
rs918148778 208 dbSNP
rs1438542131 210 dbSNP
rs950351063 219 dbSNP
rs984479094 230 dbSNP
rs1015997516 231 dbSNP
rs77309754 232 dbSNP
rs138931586 233 dbSNP
rs564253378 260 dbSNP
rs1439270970 261 dbSNP
rs1230955196 276 dbSNP
rs1279579096 277 dbSNP
rs531499958 279 dbSNP
rs1347197809 280 dbSNP
rs1211643442 289 dbSNP
rs1477326964 291 dbSNP
rs1246629468 293 dbSNP
rs142865632 298 dbSNP
rs989125142 303 dbSNP
rs1479748788 307 dbSNP
rs944025043 312 dbSNP
rs183488338 314 dbSNP
rs1220448700 326 dbSNP
rs1365476598 336 dbSNP
rs1274157097 340 dbSNP
rs899748755 345 dbSNP
rs539698660 350 dbSNP
rs996685957 352 dbSNP
rs111812451 355 dbSNP
rs1251685384 356 dbSNP
rs1421310660 365 dbSNP
rs1178404275 366 dbSNP
rs754001648 370 dbSNP
rs1461584454 371 dbSNP
rs777605680 373 dbSNP
rs746917095 381 dbSNP
rs905925506 382 dbSNP
rs1261499496 384 dbSNP
rs1435908787 386 dbSNP
rs1487796552 395 dbSNP
rs1174908561 399 dbSNP
rs1211679281 411 dbSNP
rs1031817888 416 dbSNP
rs959761088 452 dbSNP
rs371080614 458 dbSNP
rs1219194619 459 dbSNP
rs553639282 469 dbSNP
rs371843976 475 dbSNP
rs1298446042 482 dbSNP
rs1399156162 482 dbSNP
rs566691261 483 dbSNP
rs980913690 489 dbSNP
rs920063663 493 dbSNP
rs1446045050 503 dbSNP
rs201376260 504 dbSNP
rs767541695 515 dbSNP
rs994376656 516 dbSNP
rs565736102 521 dbSNP
rs533396551 522 dbSNP
rs1170486934 526 dbSNP
rs1236427264 529 dbSNP
rs1475727075 532 dbSNP
rs752917830 544 dbSNP
rs1183267607 548 dbSNP
rs760831521 556 dbSNP
rs1305908021 557 dbSNP
rs551928491 564 dbSNP
rs188140155 566 dbSNP
rs1319998697 567 dbSNP
rs1256061157 581 dbSNP
rs779110010 581 dbSNP
rs74452510 584 dbSNP
rs535089774 585 dbSNP
rs964418183 592 dbSNP
rs932529189 614 dbSNP
rs1378636885 615 dbSNP
rs1332209850 617 dbSNP
rs1449072288 627 dbSNP
rs567664417 628 dbSNP
rs144557782 631 dbSNP
rs1458830824 639 dbSNP
rs999080205 640 dbSNP
rs757826909 645 dbSNP
rs1052906260 646 dbSNP
rs553205361 647 dbSNP
rs1421689269 648 dbSNP
rs1384215319 657 dbSNP
rs555567829 661 dbSNP
rs1458695820 676 dbSNP
rs895549916 700 dbSNP
rs1455034020 709 dbSNP
rs1197964578 717 dbSNP
rs1196126509 720 dbSNP
rs372476575 720 dbSNP
rs1416753296 728 dbSNP
rs1427455265 734 dbSNP
rs1170665571 735 dbSNP
rs1488734875 742 dbSNP
rs1374391619 748 dbSNP
rs1242338169 753 dbSNP
rs367649351 759 dbSNP
rs574178916 761 dbSNP
rs1374805746 765 dbSNP
rs1308562086 770 dbSNP
rs1387872661 772 dbSNP
rs1393429577 776 dbSNP
rs191791751 788 dbSNP
rs1457706297 793 dbSNP
rs1364621541 796 dbSNP
rs1394953615 803 dbSNP
rs1158841548 805 dbSNP
rs1443008239 811 dbSNP
rs1301007695 814 dbSNP
rs969625739 819 dbSNP
rs1377966690 823 dbSNP
rs182141713 826 dbSNP
rs546679503 827 dbSNP
rs1269361601 833 dbSNP
rs112929291 836 dbSNP
rs775758472 838 dbSNP
rs1207894163 839 dbSNP
rs1490116514 841 dbSNP
rs1027174538 842 dbSNP
rs1365774445 856 dbSNP
rs952944388 858 dbSNP
rs983353850 861 dbSNP
rs947316407 871 dbSNP
rs1214102521 873 dbSNP
rs978696383 875 dbSNP
rs1386601045 877 dbSNP
rs927296371 885 dbSNP
rs1309424259 886 dbSNP
rs1421145320 900 dbSNP
rs937377893 902 dbSNP
rs1231689244 915 dbSNP
rs921242864 926 dbSNP
rs1157546663 930 dbSNP
rs76905793 932 dbSNP
rs557925336 937 dbSNP
rs369221352 938 dbSNP
rs895925170 939 dbSNP
rs1216070805 940 dbSNP
rs1240902296 955 dbSNP
rs1263648318 964 dbSNP
rs930111928 967 dbSNP
rs754567810 968 dbSNP
rs73520317 969 dbSNP
rs561621523 971 dbSNP
rs1254282673 972 dbSNP
rs1233179933 973 dbSNP
rs1319135777 977 dbSNP
rs1421045541 983 dbSNP
rs1473984703 988 dbSNP
rs528874690 992 dbSNP
rs1053322248 995 dbSNP
rs747866299 997 dbSNP
rs1396212493 998 dbSNP
rs1462864808 999 dbSNP
rs576772894 1002 dbSNP
rs1170233371 1004 dbSNP
rs769022998 1008 dbSNP
rs995883242 1010 dbSNP
rs541006876 1014 dbSNP
rs954502005 1015 dbSNP
rs1289454023 1027 dbSNP
rs1476703905 1031 dbSNP
rs1010453754 1033 dbSNP
rs1413149069 1036 dbSNP
rs1292956311 1038 dbSNP
rs796891305 1046 dbSNP
rs1020079272 1058 dbSNP
rs777663345 1059 dbSNP
rs953038707 1066 dbSNP
rs968563576 1076 dbSNP
rs1203111452 1082 dbSNP
rs1458652953 1083 dbSNP
rs1004393229 1090 dbSNP
rs1235477146 1093 dbSNP
rs1016151018 1102 dbSNP
rs559212402 1103 dbSNP
rs148451883 1112 dbSNP
rs1316788647 1128 dbSNP
rs559611526 1132 dbSNP
rs774183441 1133 dbSNP
rs954059422 1140 dbSNP
rs992861442 1145 dbSNP
rs978753344 1154 dbSNP
rs79528877 1156 dbSNP
rs531079356 1157 dbSNP
rs745736473 1158 dbSNP
rs202193655 1161 dbSNP
rs528266077 1162 dbSNP
rs934537867 1163 dbSNP
rs373935195 1165 dbSNP
rs917044896 1166 dbSNP
rs141696628 1171 dbSNP
rs1362513260 1172 dbSNP
rs1039963981 1174 dbSNP
rs1432980549 1174 dbSNP
rs1312428656 1185 dbSNP
rs1459705672 1187 dbSNP
rs760958099 1188 dbSNP
rs930314479 1191 dbSNP
rs561906408 1192 dbSNP
rs762107929 1196 dbSNP
rs1353856287 1203 dbSNP
rs1278084217 1205 dbSNP
rs1373146015 1207 dbSNP
rs1388896779 1208 dbSNP
rs1163211595 1212 dbSNP
rs1224817672 1219 dbSNP
rs1287016269 1226 dbSNP
rs1051449942 1227 dbSNP
rs1176783114 1230 dbSNP
rs1209479474 1233 dbSNP
rs1280449238 1236 dbSNP
rs890164489 1237 dbSNP
rs1009987199 1249 dbSNP
rs1179303949 1251 dbSNP
rs765598532 1266 dbSNP
rs1221306897 1268 dbSNP
rs968510593 1283 dbSNP
rs1000010273 1286 dbSNP
rs1221563675 1286 dbSNP
rs1034206572 1287 dbSNP
rs1372590014 1288 dbSNP
rs1470416968 1295 dbSNP
rs958663050 1298 dbSNP
rs1438473055 1308 dbSNP
rs1178844386 1315 dbSNP
rs1393145973 1316 dbSNP
rs1362686069 1318 dbSNP
rs993204042 1319 dbSNP
rs1400168044 1320 dbSNP
rs1426529087 1327 dbSNP
rs372306836 1342 dbSNP
rs917259189 1346 dbSNP
rs750971514 1349 dbSNP
rs546971385 1355 dbSNP
rs150534812 1356 dbSNP
rs1268640458 1360 dbSNP
rs909995851 1361 dbSNP
rs941489468 1364 dbSNP
rs139832860 1375 dbSNP
rs1033397746 1386 dbSNP
rs557131202 1395 dbSNP
rs191299808 1397 dbSNP
rs921484550 1398 dbSNP
rs1315845056 1411 dbSNP
rs934265909 1412 dbSNP
rs1443437148 1420 dbSNP
rs1051824276 1434 dbSNP
rs767202450 1446 dbSNP
rs536817521 1449 dbSNP
rs1369362618 1453 dbSNP
rs945732917 1461 dbSNP
rs949927398 1465 dbSNP
rs1041432160 1466 dbSNP
rs1303496140 1469 dbSNP
rs555277957 1470 dbSNP
rs1349491304 1476 dbSNP
rs143173954 1478 dbSNP
rs927054936 1479 dbSNP
rs1193692906 1480 dbSNP
rs1429187415 1481 dbSNP
rs200232036 1483 dbSNP
rs1478991689 1488 dbSNP
rs369933050 1489 dbSNP
rs1034154036 1490 dbSNP
rs752219321 1501 dbSNP
rs940358125 1506 dbSNP
rs1211614548 1508 dbSNP
rs894344046 1513 dbSNP
rs901420121 1518 dbSNP
rs1194261971 1531 dbSNP
rs56707429 1533 dbSNP
rs1479077848 1534 dbSNP
rs1214215664 1540 dbSNP
rs1024676212 1552 dbSNP
rs577525953 1553 dbSNP
rs1450518239 1555 dbSNP
rs1419025989 1556 dbSNP
rs1410765755 1557 dbSNP
rs1332670993 1559 dbSNP
rs1467599948 1564 dbSNP
rs889885582 1578 dbSNP
rs1000256990 1579 dbSNP
rs1427626410 1598 dbSNP
rs982803709 1604 dbSNP
rs1183143807 1605 dbSNP
rs185537725 1606 dbSNP
rs190460628 1610 dbSNP
rs1199213726 1614 dbSNP
rs1458988503 1619 dbSNP
rs777313601 1630 dbSNP
rs1203548411 1637 dbSNP
rs1188775386 1642 dbSNP
rs748930204 1645 dbSNP
rs531142346 1654 dbSNP
rs1244007198 1656 dbSNP
rs1382159350 1673 dbSNP
rs921441662 1684 dbSNP
rs971254391 1692 dbSNP
rs1449658223 1693 dbSNP
rs146651253 1697 dbSNP
rs757005321 1699 dbSNP
rs193054190 1702 dbSNP
rs1269099438 1705 dbSNP
rs373095129 1706 dbSNP
rs927106596 1708 dbSNP
rs945693463 1709 dbSNP
rs984978004 1710 dbSNP
rs1041377943 1716 dbSNP
rs1176450158 1729 dbSNP
rs1488705227 1730 dbSNP
rs907612211 1733 dbSNP
rs867652242 1743 dbSNP
rs1220554874 1751 dbSNP
rs1358912678 1752 dbSNP
rs745865390 1762 dbSNP
rs528774922 1766 dbSNP
rs904248171 1772 dbSNP
rs1242392144 1776 dbSNP
rs1334560331 1793 dbSNP
rs1039998278 1808 dbSNP
rs1387816003 1817 dbSNP
rs1333972260 1818 dbSNP
rs546939167 1821 dbSNP
rs1254862403 1822 dbSNP
rs1364563712 1833 dbSNP
rs771994623 1834 dbSNP
rs935754197 1835 dbSNP
rs1361519697 1841 dbSNP
rs1049939253 1843 dbSNP
rs1433647906 1845 dbSNP
rs1241610637 1846 dbSNP
rs185281541 1861 dbSNP
rs1197010483 1865 dbSNP
rs1490264894 1867 dbSNP
rs775588134 1868 dbSNP
rs1218939153 1880 dbSNP
rs1348669181 1888 dbSNP
rs1475861690 1889 dbSNP
rs1055507723 1893 dbSNP
rs747070061 1896 dbSNP
rs1314382994 1902 dbSNP
rs1014532576 1907 dbSNP
rs1281845185 1908 dbSNP
rs564283906 1914 dbSNP
rs1000355992 1920 dbSNP
rs533378867 1922 dbSNP
rs1461285441 1923 dbSNP
rs1004184983 1928 dbSNP
rs1016952643 1930 dbSNP
rs1393448675 1936 dbSNP
rs538632038 1940 dbSNP
rs1382163849 1943 dbSNP
rs1287711737 1945 dbSNP
rs1466549109 1950 dbSNP
rs975489886 1954 dbSNP
rs377295524 1956 dbSNP
rs891839020 1970 dbSNP
rs1479968817 1987 dbSNP
rs1424019448 1989 dbSNP
rs1010661412 1994 dbSNP
rs368746673 1997 dbSNP
rs1316930913 2000 dbSNP
rs971306839 2003 dbSNP
rs955551868 2006 dbSNP
rs115401209 2015 dbSNP
rs1034218063 2027 dbSNP
rs776753164 2031 dbSNP
rs762031745 2034 dbSNP
rs951918344 2035 dbSNP
rs765535810 2036 dbSNP
rs568994484 2040 dbSNP
rs1291112535 2041 dbSNP
rs1333846649 2051 dbSNP
rs1427987743 2055 dbSNP
rs907617671 2067 dbSNP
rs1396086561 2069 dbSNP
rs1177248728 2070 dbSNP
rs914129936 2071 dbSNP
rs1267018683 2074 dbSNP
rs1334645686 2084 dbSNP
rs1469184089 2091 dbSNP
rs1348383515 2092 dbSNP
rs1400777709 2102 dbSNP
rs976165474 2103 dbSNP
rs922906934 2104 dbSNP
rs1204484734 2109 dbSNP
rs1283630223 2110 dbSNP
rs927277515 2110 dbSNP
rs1050032660 2113 dbSNP
rs945639620 2116 dbSNP
rs536874923 2127 dbSNP
rs1196076538 2143 dbSNP
rs1255620039 2154 dbSNP
rs925618898 2164 dbSNP
rs935701657 2166 dbSNP
rs911469161 2169 dbSNP
rs1275632228 2173 dbSNP
rs936205578 2177 dbSNP
rs1337096997 2178 dbSNP
rs1055534770 2180 dbSNP
rs1269199284 2189 dbSNP
rs915667901 2195 dbSNP
rs1189018242 2199 dbSNP
rs949889925 2208 dbSNP
rs891888781 2212 dbSNP
rs1377544510 2215 dbSNP
rs333017 2219 dbSNP
rs1045775102 2225 dbSNP
rs1158558414 2226 dbSNP
rs1385027173 2229 dbSNP
rs1421036651 2230 dbSNP
rs1310582080 2235 dbSNP
rs1354377657 2237 dbSNP
rs573892075 2238 dbSNP
rs1183058709 2239 dbSNP
rs1440914712 2253 dbSNP
rs1415034440 2256 dbSNP
rs1314528515 2261 dbSNP
rs534926443 2262 dbSNP
rs1333822834 2265 dbSNP
rs1238211445 2276 dbSNP
rs907243699 2277 dbSNP
rs552944072 2286 dbSNP
rs34239560 2288 dbSNP
rs71459750 2288 dbSNP
rs1361065123 2290 dbSNP
rs1289037705 2301 dbSNP
rs1218818051 2304 dbSNP
rs1004132537 2311 dbSNP
rs1408494476 2313 dbSNP
rs577588373 2315 dbSNP
rs1038332317 2316 dbSNP
rs763591419 2323 dbSNP
rs996875763 2324 dbSNP
rs962117758 2330 dbSNP
rs975880001 2331 dbSNP
rs1363934652 2335 dbSNP
rs1030072611 2340 dbSNP
rs1420354146 2341 dbSNP
rs1181689873 2342 dbSNP
rs953059035 2346 dbSNP
rs373357322 2352 dbSNP
rs955658279 2355 dbSNP
rs1247658423 2357 dbSNP
rs1202031080 2360 dbSNP
rs377505031 2371 dbSNP
rs1021543558 2381 dbSNP
rs966888322 2382 dbSNP
rs1317019182 2386 dbSNP
rs544641639 2406 dbSNP
rs979646246 2413 dbSNP
rs925566546 2426 dbSNP
rs59559050 2428 dbSNP
rs764841483 2429 dbSNP
rs991579895 2432 dbSNP
rs1394026146 2437 dbSNP
rs1343919909 2439 dbSNP
rs796859931 2449 dbSNP
rs375580385 2450 dbSNP
rs1390564591 2451 dbSNP
rs1045829089 2469 dbSNP
rs907296294 2470 dbSNP
rs1045527451 2473 dbSNP
rs1345534185 2474 dbSNP
rs1400702066 2474 dbSNP
rs1426463481 2475 dbSNP
rs1307467771 2476 dbSNP
rs188621296 2482 dbSNP
rs761175374 2489 dbSNP
rs1198259296 2493 dbSNP
rs58571842 2498 dbSNP
rs561477698 2500 dbSNP
rs1006111813 2503 dbSNP
rs939866833 2522 dbSNP
rs1015235848 2526 dbSNP
rs897685743 2537 dbSNP
rs117829417 2547 dbSNP
rs1205444602 2551 dbSNP
rs1347316441 2553 dbSNP
rs1234212488 2558 dbSNP
rs1282331240 2559 dbSNP
rs1215383850 2564 dbSNP
rs866330014 2567 dbSNP
rs1258030780 2593 dbSNP
rs1479801079 2594 dbSNP
rs760133975 2602 dbSNP
rs1268545310 2606 dbSNP
rs898435904 2610 dbSNP
rs201369117 2611 dbSNP
rs1459429642 2613 dbSNP
rs996830813 2614 dbSNP
rs1050199681 2617 dbSNP
rs1339303847 2619 dbSNP
rs953068966 2624 dbSNP
rs1171559986 2626 dbSNP
rs1428809768 2629 dbSNP
rs1421178235 2631 dbSNP
rs1184303553 2633 dbSNP
rs1474815332 2640 dbSNP
rs1192380450 2644 dbSNP
rs1243169973 2649 dbSNP
rs891172506 2653 dbSNP
rs758153301 2664 dbSNP
rs535778912 2672 dbSNP
rs1177643235 2680 dbSNP
rs114648142 2682 dbSNP
rs1204936041 2686 dbSNP
rs957924677 2687 dbSNP
rs140192533 2690 dbSNP
rs1214163485 2692 dbSNP
rs1298463588 2699 dbSNP
rs550540548 2700 dbSNP
rs1402273670 2701 dbSNP
rs1001011461 2708 dbSNP
rs1317169558 2710 dbSNP
rs1451185025 2711 dbSNP
rs1032530479 2714 dbSNP
rs913468360 2716 dbSNP
rs1370301075 2725 dbSNP
rs1353083776 2726 dbSNP
rs333016 2729 dbSNP
rs1303532533 2732 dbSNP
rs1305926173 2734 dbSNP
rs1428644887 2740 dbSNP
rs375949858 2744 dbSNP
rs75068110 2745 dbSNP
rs1259106847 2747 dbSNP
rs76244730 2748 dbSNP
rs1242425642 2761 dbSNP
rs971123734 2764 dbSNP
rs981588429 2766 dbSNP
rs1230912879 2767 dbSNP
rs1055739025 2773 dbSNP
rs567456830 2774 dbSNP
rs887805454 2779 dbSNP
rs1192369178 2781 dbSNP
rs1243844526 2785 dbSNP
rs908317394 2791 dbSNP
rs534489711 2792 dbSNP
rs553245246 2807 dbSNP
rs1427546874 2810 dbSNP
rs1171018631 2817 dbSNP
rs1036315217 2818 dbSNP
rs973916411 2820 dbSNP
rs1459718165 2826 dbSNP
rs376468744 2828 dbSNP
rs1163992030 2836 dbSNP
rs1395070655 2844 dbSNP
rs919808709 2851 dbSNP
rs781262837 2858 dbSNP
rs932564137 2865 dbSNP
rs1438545201 2871 dbSNP
rs1295299280 2878 dbSNP
rs1422177772 2894 dbSNP
rs1367337405 2895 dbSNP
rs1159773744 2907 dbSNP
rs1360038306 2910 dbSNP
rs1049705884 2916 dbSNP
rs997353096 2916 dbSNP
rs758379769 2920 dbSNP
rs77719331 2924 dbSNP
rs1490589007 2925 dbSNP
rs1271280427 2926 dbSNP
rs944081608 2932 dbSNP
rs73520327 2934 dbSNP
rs1007340476 2939 dbSNP
rs1231790038 2953 dbSNP
rs1272960030 2956 dbSNP
rs1306806432 2961 dbSNP
rs71036343 2961 dbSNP
rs902623324 2970 dbSNP
rs1000957700 2971 dbSNP
rs796233662 2972 dbSNP
rs766679122 2973 dbSNP
rs1402662182 2974 dbSNP
rs73520328 2974 dbSNP
rs1020539655 2975 dbSNP
rs1485285876 2976 dbSNP
rs1193899403 2981 dbSNP
rs1012908276 2982 dbSNP
rs1193591546 2982 dbSNP
rs1221305080 2982 dbSNP
rs1254898105 2982 dbSNP
rs1295735397 2982 dbSNP
rs1330142547 2982 dbSNP
rs1382092061 2982 dbSNP
rs1383383843 2982 dbSNP
rs149500556 2982 dbSNP
rs746880919 2982 dbSNP
rs780482726 2982 dbSNP
rs1491273437 2983 dbSNP
rs1025255975 2984 dbSNP
rs1474036302 2984 dbSNP
rs749635296 2984 dbSNP
rs1491009464 2985 dbSNP
rs542380013 2987 dbSNP
rs748632392 2989 dbSNP
rs1247439671 2990 dbSNP
rs1414262224 2990 dbSNP
rs981586529 2991 dbSNP
rs866562609 2993 dbSNP
rs928781016 2994 dbSNP
rs958844760 2995 dbSNP
rs1453094354 2996 dbSNP
rs575272485 3000 dbSNP
rs1251563201 3015 dbSNP
rs1015326020 3018 dbSNP
rs781440940 3018 dbSNP
rs1362628019 3019 dbSNP
rs1384894813 3023 dbSNP
rs71473215 3025 dbSNP
rs1334497874 3026 dbSNP
rs1413666982 3030 dbSNP
rs1396888338 3034 dbSNP
rs1169889467 3035 dbSNP
rs1413172560 3052 dbSNP
rs1389636364 3053 dbSNP
rs961126128 3055 dbSNP
rs1164286851 3060 dbSNP
rs60984775 3066 dbSNP
rs554680134 3075 dbSNP
rs942081930 3080 dbSNP
rs1187411820 3086 dbSNP
rs371675586 3094 dbSNP
rs1438776725 3098 dbSNP
rs1253034365 3100 dbSNP
rs1197191491 3117 dbSNP
rs1339632726 3118 dbSNP
rs1036731770 3126 dbSNP
rs181411899 3129 dbSNP
rs540455393 3131 dbSNP
rs1361550804 3132 dbSNP
rs1447133098 3138 dbSNP
rs1336140431 3141 dbSNP
rs933201690 3146 dbSNP
rs1051663793 3148 dbSNP
rs333015 3159 dbSNP
rs35823280 3162 dbSNP
rs932535999 3164 dbSNP
rs1303878467 3165 dbSNP
rs565600416 3170 dbSNP
rs768626674 3172 dbSNP
rs35133003 3187 dbSNP
rs1459340016 3191 dbSNP
rs985767325 3197 dbSNP
rs1316878397 3203 dbSNP
rs1007392838 3208 dbSNP
rs1216643889 3208 dbSNP
rs1287563525 3211 dbSNP
rs912503430 3218 dbSNP
rs1250570464 3222 dbSNP
rs532693233 3226 dbSNP
rs1209792894 3236 dbSNP
rs1237825601 3238 dbSNP
rs1473684606 3239 dbSNP
rs1287055289 3241 dbSNP
rs781278141 3250 dbSNP
rs1227674892 3252 dbSNP
rs544241492 3256 dbSNP
rs1042381533 3257 dbSNP
rs902571230 3261 dbSNP
rs1349608776 3270 dbSNP
rs1440252532 3287 dbSNP
rs1304004647 3288 dbSNP
rs562550314 3297 dbSNP
rs936759643 3299 dbSNP
rs374971138 3309 dbSNP
rs1021013647 3313 dbSNP
rs1053835889 3317 dbSNP
rs1362605141 3325 dbSNP
rs967619640 3334 dbSNP
rs529989564 3335 dbSNP
rs895293541 3336 dbSNP
rs1161566325 3337 dbSNP
rs1472484064 3342 dbSNP
rs1430355040 3350 dbSNP
rs1481174853 3356 dbSNP
rs992063819 3368 dbSNP
rs1450587620 3373 dbSNP
rs1012441286 3374 dbSNP
rs1286297297 3378 dbSNP
rs17678217 3386 dbSNP
rs61065260 3388 dbSNP
rs1310808427 3392 dbSNP
rs972108847 3394 dbSNP
rs919283105 3401 dbSNP
rs1365742278 3404 dbSNP
rs78290788 3408 dbSNP
rs546454496 3409 dbSNP
rs1051716973 3410 dbSNP
rs1319151046 3420 dbSNP
rs1405510408 3425 dbSNP
rs1407301283 3427 dbSNP
rs1179026023 3441 dbSNP
rs1470784341 3442 dbSNP
rs185296954 3444 dbSNP
rs542193683 3450 dbSNP
rs1015270754 3451 dbSNP
rs943187349 3458 dbSNP
rs1422593879 3463 dbSNP
rs1202108120 3472 dbSNP
rs1232095754 3474 dbSNP
rs1053998396 3476 dbSNP
rs1430155883 3484 dbSNP
rs538923733 3489 dbSNP
rs1009705270 3492 dbSNP
rs1042118532 3499 dbSNP
rs995248116 3501 dbSNP
rs1278219911 3508 dbSNP
rs1215331483 3514 dbSNP
rs1364184761 3522 dbSNP
rs1295409049 3529 dbSNP
rs1435094166 3531 dbSNP
rs1452699195 3532 dbSNP
rs1339160894 3543 dbSNP
rs1446233929 3544 dbSNP
rs1358899284 3546 dbSNP
rs1174932841 3553 dbSNP
rs1410119634 3556 dbSNP
rs557248802 3559 dbSNP
rs796921351 3560 dbSNP
rs1026763803 3563 dbSNP
rs568895746 3578 dbSNP
rs773757659 3582 dbSNP
rs953993856 3583 dbSNP
rs1035941119 3584 dbSNP
rs1416397570 3594 dbSNP
rs1482164241 3597 dbSNP
rs1236620071 3598 dbSNP
rs149842321 3603 dbSNP
rs1168700223 3605 dbSNP
rs763428484 3619 dbSNP
rs547491422 3620 dbSNP
rs1334010897 3621 dbSNP
rs1016815862 3624 dbSNP
rs1227731239 3636 dbSNP
rs572829545 3648 dbSNP
rs965329594 3656 dbSNP
rs978021338 3662 dbSNP
rs1227048545 3667 dbSNP
rs1368112441 3675 dbSNP
rs923938951 3688 dbSNP
rs188097118 3690 dbSNP
rs1442564564 3702 dbSNP
rs1372000741 3704 dbSNP
rs180894774 3704 dbSNP
rs576982244 3707 dbSNP
rs1305691012 3708 dbSNP
rs1428582312 3709 dbSNP
rs771381333 3710 dbSNP
rs916690028 3716 dbSNP
rs1385255599 3723 dbSNP
rs1166841895 3730 dbSNP
rs948193994 3734 dbSNP
rs1346601354 3737 dbSNP
rs954731910 3744 dbSNP
rs1177554240 3745 dbSNP
rs1481769490 3749 dbSNP
rs987429027 3754 dbSNP
rs1204652038 3760 dbSNP
rs775002501 3760 dbSNP
rs1212511025 3764 dbSNP
rs910477470 3770 dbSNP
rs943250372 3782 dbSNP
rs544504345 3789 dbSNP
rs1321629996 3791 dbSNP
rs989345138 3794 dbSNP
rs1225803396 3795 dbSNP
rs562810977 3796 dbSNP
rs760028803 3804 dbSNP
rs78112542 3810 dbSNP
rs1365660212 3811 dbSNP
rs1251015537 3821 dbSNP
rs906290947 3828 dbSNP
rs1456379763 3838 dbSNP
rs1036651283 3841 dbSNP
rs1054685696 3844 dbSNP
rs1247373392 3853 dbSNP
rs896812401 3856 dbSNP
rs114469763 3857 dbSNP
rs1480884191 3866 dbSNP
rs1269634490 3867 dbSNP
rs1013609253 3873 dbSNP
rs144449603 3878 dbSNP
rs1488464538 3879 dbSNP
rs1261860721 3883 dbSNP
rs145831572 3890 dbSNP
rs1267821506 3897 dbSNP
rs1466506572 3915 dbSNP
rs527780488 3924 dbSNP
rs1007099627 3933 dbSNP
rs993677455 3935 dbSNP
rs1289396113 3937 dbSNP
rs1458688304 3954 dbSNP
rs1392845551 3957 dbSNP
rs3210769 3958 dbSNP
rs1386270818 3970 dbSNP
rs1158133778 3973 dbSNP
rs1019444304 3975 dbSNP
rs546812025 3977 dbSNP
rs1332376050 3978 dbSNP
rs1196979232 3982 dbSNP
rs761413226 3984 dbSNP
rs987480019 3986 dbSNP
rs1191055692 3997 dbSNP
rs1463928435 4004 dbSNP
rs977968978 4005 dbSNP
rs923885443 4009 dbSNP
rs958009421 4011 dbSNP
rs1277220265 4020 dbSNP
rs1257424779 4024 dbSNP
rs1230551268 4030 dbSNP
rs1311117451 4032 dbSNP
rs1295668606 4034 dbSNP
rs989455680 4037 dbSNP
rs1362918960 4038 dbSNP
rs1340773178 4045 dbSNP
rs1017591539 4049 dbSNP
rs564936948 4052 dbSNP
rs1271055295 4060 dbSNP
rs1171054381 4067 dbSNP
rs989835093 4068 dbSNP
rs915157047 4069 dbSNP
rs1333992080 4071 dbSNP
rs187242125 4073 dbSNP
rs1046957263 4079 dbSNP
rs879082526 4080 dbSNP
rs1184707422 4093 dbSNP
rs1444513123 4101 dbSNP
rs1254436182 4102 dbSNP
rs148980605 4106 dbSNP
rs927726259 4109 dbSNP
rs1274799032 4112 dbSNP
rs939075251 4113 dbSNP
rs1339398982 4118 dbSNP
rs1296816252 4119 dbSNP
rs1246554742 4133 dbSNP
rs1342051954 4141 dbSNP
rs569157836 4153 dbSNP
rs536284587 4160 dbSNP
rs565644761 4163 dbSNP
rs1036596381 4165 dbSNP
rs1196215501 4167 dbSNP
rs114155664 4177 dbSNP
rs1389579382 4185 dbSNP
rs995142663 4190 dbSNP
rs1048066340 4191 dbSNP
rs1474021661 4192 dbSNP
rs1164391597 4199 dbSNP
rs994078677 4202 dbSNP
rs796709949 4204 dbSNP
rs1252132370 4209 dbSNP
rs890561099 4212 dbSNP
rs1481796503 4217 dbSNP
rs1009006951 4225 dbSNP
rs533661432 4226 dbSNP
rs1358359940 4249 dbSNP
rs1019816229 4255 dbSNP
rs1282264640 4267 dbSNP
rs1243759600 4271 dbSNP
rs1350842940 4282 dbSNP
rs1398409916 4285 dbSNP
rs192026431 4286 dbSNP
rs1370032637 4300 dbSNP
rs1303824306 4305 dbSNP
rs900999111 4312 dbSNP
rs1163143919 4327 dbSNP
rs1389163622 4327 dbSNP
rs1401471637 4327 dbSNP
rs965110243 4343 dbSNP
rs1414570105 4345 dbSNP
rs750028623 4359 dbSNP
rs1471400911 4361 dbSNP
rs999335120 4371 dbSNP
rs1198931302 4376 dbSNP
rs966619745 4377 dbSNP
rs1030849617 4382 dbSNP
rs977908465 4387 dbSNP
rs758224135 4390 dbSNP
rs989850019 4394 dbSNP
rs1285400483 4395 dbSNP
rs1023634834 4402 dbSNP
rs868244067 4413 dbSNP
rs969828902 4419 dbSNP
rs1488735913 4421 dbSNP
rs1219140401 4428 dbSNP
rs575405901 4430 dbSNP
rs1350077897 4433 dbSNP
rs1442245954 4434 dbSNP
rs577042302 4435 dbSNP
rs1038005148 4437 dbSNP
rs1323490526 4441 dbSNP
rs940814305 4444 dbSNP
rs972237390 4454 dbSNP
rs183569328 4456 dbSNP
rs930884394 4457 dbSNP
rs1172763861 4464 dbSNP
rs1478738912 4467 dbSNP
rs1051154532 4472 dbSNP
rs1446900712 4475 dbSNP
rs889448814 4477 dbSNP
rs1310748216 4479 dbSNP
rs75945866 4481 dbSNP
rs1396355885 4504 dbSNP
rs1249712963 4517 dbSNP
rs900547125 4521 dbSNP
rs1040777704 4527 dbSNP
rs1489863501 4528 dbSNP
rs1011334155 4539 dbSNP
rs1221095429 4541 dbSNP
rs1342963841 4542 dbSNP
rs1274328034 4544 dbSNP
rs1335962479 4556 dbSNP
rs1367951928 4565 dbSNP
rs900945547 4571 dbSNP
rs143732382 4573 dbSNP
rs147696170 4574 dbSNP
rs1308605310 4575 dbSNP
rs999421928 4582 dbSNP
rs1242538000 4584 dbSNP
rs564627752 4593 dbSNP
rs1254443078 4598 dbSNP
rs781167310 4599 dbSNP
rs1391983548 4604 dbSNP
rs1186540496 4607 dbSNP
rs1483059913 4608 dbSNP
rs1464282274 4610 dbSNP
rs748233303 4613 dbSNP
rs772619519 4619 dbSNP
rs1212589759 4624 dbSNP
rs533295671 4627 dbSNP
rs1010815834 4643 dbSNP
rs1201330022 4649 dbSNP
rs1024004155 4654 dbSNP
rs960566594 4657 dbSNP
rs1296076235 4661 dbSNP
rs373346225 4665 dbSNP
rs982538621 4668 dbSNP
rs1035072471 4682 dbSNP
rs962128829 4683 dbSNP
rs76940606 4684 dbSNP
rs974163460 4688 dbSNP
rs1311856370 4697 dbSNP
rs1429852137 4699 dbSNP
rs56967086 4702 dbSNP
rs796758203 4702 dbSNP
rs920756661 4715 dbSNP
rs1414327601 4724 dbSNP
rs1183353204 4727 dbSNP
rs560277020 4730 dbSNP
rs929613552 4735 dbSNP
rs1171239683 4738 dbSNP
rs930838270 4739 dbSNP
rs1376670850 4742 dbSNP
rs1466245887 4743 dbSNP
rs1048043489 4760 dbSNP
rs1206082232 4761 dbSNP
rs1174101117 4764 dbSNP
rs1394137176 4768 dbSNP
rs912148831 4785 dbSNP
rs1322838688 4786 dbSNP
rs572363808 4787 dbSNP
rs1315333705 4790 dbSNP
rs546004817 4791 dbSNP
rs1332001450 4794 dbSNP
rs1379064444 4800 dbSNP
rs1409983232 4806 dbSNP
rs1371940023 4809 dbSNP
rs1305623691 4813 dbSNP
rs1039170504 4819 dbSNP
rs910817228 4820 dbSNP
rs10607630 4825 dbSNP
rs374053680 4825 dbSNP
rs946799728 4830 dbSNP
rs1299297980 4836 dbSNP
rs1183169914 4852 dbSNP
rs532966245 4859 dbSNP
rs1249786586 4878 dbSNP
rs1041118202 4879 dbSNP
rs900894755 4912 dbSNP
rs1267778454 4915 dbSNP
rs935081333 4916 dbSNP
rs532383160 4917 dbSNP
rs1269154613 4923 dbSNP
rs1052170195 4925 dbSNP
rs999479164 4935 dbSNP
rs1285955531 4936 dbSNP
rs1351921905 4936 dbSNP
rs1034901775 4943 dbSNP
rs1295235977 4949 dbSNP
rs1434131016 4952 dbSNP
rs893627535 4953 dbSNP
rs549269200 4954 dbSNP
rs1011180545 4966 dbSNP
rs550776615 4967 dbSNP
rs1158591553 4995 dbSNP
rs771434296 5003 dbSNP
rs1433855922 5005 dbSNP
rs867006812 5009 dbSNP
rs1044966119 5010 dbSNP
rs76714816 5011 dbSNP
rs1003511713 5016 dbSNP
rs1035020757 5019 dbSNP
rs1210933792 5025 dbSNP
rs1327470411 5028 dbSNP
rs866297997 5047 dbSNP
rs1237814495 5049 dbSNP
rs1312271586 5052 dbSNP
rs1302763989 5053 dbSNP
rs962076864 5058 dbSNP
rs993571342 5060 dbSNP
rs762601664 5068 dbSNP
rs530008797 5071 dbSNP
rs1386108490 5078 dbSNP
rs952226256 5081 dbSNP
rs975335485 5088 dbSNP
rs1379501990 5090 dbSNP
rs548426529 5095 dbSNP
rs986718742 5098 dbSNP
rs1391355300 5099 dbSNP
rs776055082 5106 dbSNP
rs1463837411 5109 dbSNP
rs1291856280 5120 dbSNP
rs910772470 5121 dbSNP
rs966700287 5128 dbSNP
rs1204252937 5146 dbSNP
rs1483366189 5146 dbSNP
rs566345952 5154 dbSNP
rs922263753 5155 dbSNP
rs533043 5160 dbSNP
rs1298259264 5168 dbSNP
rs1230435082 5172 dbSNP
rs1338760113 5173 dbSNP
rs1218357117 5174 dbSNP
rs1362847469 5178 dbSNP
rs1165335501 5181 dbSNP
rs1294567430 5182 dbSNP
rs1052117009 5184 dbSNP
rs935340284 5193 dbSNP
rs914995065 5204 dbSNP
rs1301271960 5208 dbSNP
rs1434203723 5213 dbSNP
rs1371184558 5218 dbSNP
rs551999499 5226 dbSNP
rs185994967 5227 dbSNP
rs1372929655 5228 dbSNP
rs190060980 5232 dbSNP
rs1012187574 5235 dbSNP
rs905070024 5236 dbSNP
rs1208207271 5242 dbSNP
rs551653296 5244 dbSNP
rs1274721668 5246 dbSNP
rs1207277230 5247 dbSNP
rs1056426369 5250 dbSNP
rs1250585740 5251 dbSNP
rs1341987394 5252 dbSNP
rs1310868158 5260 dbSNP
rs897814642 5269 dbSNP
rs1260528084 5270 dbSNP
rs995746568 5271 dbSNP
rs1477298537 5299 dbSNP
rs1396369231 5304 dbSNP
rs1459789566 5305 dbSNP
rs993518976 5306 dbSNP
rs951078095 5307 dbSNP
rs1251968122 5320 dbSNP
rs1474667623 5320 dbSNP
rs1027715670 5324 dbSNP
rs1183670608 5328 dbSNP
rs1474178602 5333 dbSNP
rs986479817 5337 dbSNP
rs1272227539 5338 dbSNP
rs1349342459 5341 dbSNP
rs1458438808 5349 dbSNP
rs952237738 5354 dbSNP
rs1295388903 5357 dbSNP
rs1358210419 5358 dbSNP
rs1007688653 5362 dbSNP
rs556334597 5370 dbSNP
rs574833463 5379 dbSNP
rs963690673 5380 dbSNP
rs550373709 5383 dbSNP
rs540094128 5386 dbSNP
rs922170613 5391 dbSNP
rs968246769 5392 dbSNP
rs1324785642 5393 dbSNP
rs1389028739 5397 dbSNP
rs57092786 5399 dbSNP
rs572366304 5403 dbSNP
rs546163559 5409 dbSNP
rs1460630377 5413 dbSNP
rs766222481 5415 dbSNP
rs182382587 5423 dbSNP
rs1227070624 5424 dbSNP
rs759211923 5425 dbSNP
rs1312579887 5426 dbSNP
rs1322871304 5427 dbSNP
rs917942634 5435 dbSNP
rs1250965513 5438 dbSNP
rs1212807361 5440 dbSNP
rs201338110 5441 dbSNP
rs987780599 5442 dbSNP
rs751335170 5446 dbSNP
rs1246279167 5450 dbSNP
rs1275496029 5452 dbSNP
rs1236132353 5456 dbSNP
rs1369386444 5457 dbSNP
rs1283267885 5462 dbSNP
rs1325770018 5465 dbSNP
rs1436300878 5471 dbSNP
rs1391215700 5472 dbSNP
rs1487754765 5473 dbSNP
rs898369499 5485 dbSNP
rs946460130 5501 dbSNP
rs1398593519 5508 dbSNP
rs1406684670 5514 dbSNP
rs1172636160 5520 dbSNP
rs1478992840 5528 dbSNP
rs995361294 5530 dbSNP
rs1265033714 5532 dbSNP
rs1046903528 5534 dbSNP
rs886876195 5539 dbSNP
rs1213986825 5540 dbSNP
rs187051663 5560 dbSNP
rs926441738 5561 dbSNP
rs939193972 5574 dbSNP
rs1341707520 5576 dbSNP
rs1202275162 5579 dbSNP
rs1414383061 5579 dbSNP
rs141541178 5579 dbSNP
rs1425504474 5581 dbSNP
rs1303327038 5583 dbSNP
rs1056375340 5584 dbSNP
rs897762482 5593 dbSNP
rs754918508 5594 dbSNP
rs142383775 5597 dbSNP
rs1334357178 5603 dbSNP
rs887826380 5613 dbSNP
rs562683648 5616 dbSNP
rs529851922 5617 dbSNP
rs541778992 5622 dbSNP
rs560358991 5623 dbSNP
rs901990325 5627 dbSNP
rs997658342 5628 dbSNP
rs1184528480 5644 dbSNP
rs1474936960 5651 dbSNP
rs956854709 5657 dbSNP
rs527321102 5659 dbSNP
rs752532532 5661 dbSNP
rs146417156 5662 dbSNP
rs752726273 5662 dbSNP
rs1344911207 5671 dbSNP
rs987726517 5687 dbSNP
rs1022375650 5700 dbSNP
rs1380287552 5703 dbSNP
rs570259498 5707 dbSNP
rs1284439146 5708 dbSNP
rs1230597144 5711 dbSNP
rs967773676 5716 dbSNP
rs1352404790 5718 dbSNP
rs1311720645 5723 dbSNP
rs1430376293 5749 dbSNP
rs1240385217 5762 dbSNP
rs371447707 5763 dbSNP
rs980914813 5773 dbSNP
rs1310098430 5788 dbSNP
rs1409166340 5794 dbSNP
rs1414164356 5795 dbSNP
rs1209096732 5796 dbSNP
rs1474343037 5804 dbSNP
rs926414449 5814 dbSNP
rs1256966102 5820 dbSNP
rs939141844 5821 dbSNP
rs1182956391 5826 dbSNP
rs1484056331 5827 dbSNP
rs756266848 5830 dbSNP
rs992004643 5839 dbSNP
rs1204370587 5843 dbSNP
rs919138053 5844 dbSNP
rs929207543 5846 dbSNP
rs1049008235 5849 dbSNP
rs777941773 5850 dbSNP
rs1234800677 5856 dbSNP
rs943407256 5874 dbSNP
rs886970888 5877 dbSNP
rs1409927210 5878 dbSNP
rs1439118140 5880 dbSNP
rs112260569 5889 dbSNP
rs139001016 5890 dbSNP
rs901949789 5894 dbSNP
rs899546460 5895 dbSNP
rs1410361205 5897 dbSNP
rs749578787 5905 dbSNP
rs369309711 5912 dbSNP
rs1460111761 5915 dbSNP
rs1417456759 5917 dbSNP
rs536014146 5918 dbSNP
rs115377605 5919 dbSNP
rs1360165220 5921 dbSNP
rs1021685670 5923 dbSNP
rs757547590 5928 dbSNP
rs968393328 5931 dbSNP
rs779187344 5933 dbSNP
rs892002476 5945 dbSNP
rs1228547670 5952 dbSNP
rs1031203086 5953 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000317837.9 | 3UTR | CCUCUCCUUUGCUGCUUAAACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUGUGCCUUAAUAUUGUACAUAAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUGUGCCUUAAUAUUGUACAUAAUAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.365 9.4e-5 -0.379 5.0e-5 100 Click to see details
GSE19783 ER- ER- breast cancer -0.361 5.4e-4 -0.404 1.1e-4 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.577 3.9e-3 -0.426 3.1e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.458 1.1e-2 0.467 9.3e-3 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.371 3.7e-2 0.483 8.4e-3 24 Click to see details
GSE32688 Pancreatic cancer -0.287 5.6e-2 -0.107 2.8e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.287 9.2e-2 0.231 1.4e-1 23 Click to see details
GSE27834 Pluripotent stem cells 0.32 1.1e-1 0.365 8.2e-2 16 Click to see details
GSE38226 Liver fibrosis 0.201 1.9e-1 0.220 1.7e-1 21 Click to see details
GSE28544 Breast cancer 0.158 2.3e-1 0.453 1.3e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.222 2.3e-1 -0.319 1.4e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.213 2.5e-1 0.343 1.4e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.138 2.6e-1 -0.271 9.5e-2 25 Click to see details
GSE21849 B cell lymphoma -0.107 2.9e-1 0.362 2.7e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.057 4.1e-1 0.122 3.0e-1 20 Click to see details
GSE17306 Multiple myeloma -0.029 4.2e-1 0.040 3.9e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.02 4.4e-1 -0.053 3.4e-1 64 Click to see details
GSE21032 Prostate cancer -0.008 4.7e-1 -0.031 3.9e-1 83 Click to see details
GSE14794 Lymphoblastoid cells 0.001 5.0e-1 0.007 4.7e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.001 5.0e-1 0.007 4.7e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.753 0 -0.753 0 32 Click to see details
THCA -0.428 0 -0.441 0 59 Click to see details
BLCA -0.674 0 -0.666 0 18 Click to see details
KIRC 0.236 0.03 0.208 0.04 68 Click to see details
KICH 0.35 0.04 0.299 0.07 25 Click to see details
PAAD -0.88 0.06 -0.800 0.1 4 Click to see details
COAD -0.588 0.06 -0.762 0.01 8 Click to see details
CHOL 0.449 0.11 0.333 0.19 9 Click to see details
LIHC -0.158 0.14 -0.128 0.19 49 Click to see details
PCPG -0.688 0.26 -0.500 0.33 3 Click to see details
BRCA 0.066 0.28 0.048 0.33 84 Click to see details
KIRP -0.105 0.28 -0.046 0.4 32 Click to see details
LUAD 0.167 0.3 0.112 0.36 12 Click to see details
UCEC 0.104 0.34 0.040 0.44 19 Click to see details
PRAD -0.036 0.4 -0.019 0.45 50 Click to see details
CESC -0.265 0.41 -0.500 0.33 3 Click to see details
HNSC 0.02 0.45 -0.072 0.33 42 Click to see details
LUSC 0.015 0.46 -0.036 0.42 38 Click to see details
ESCA 0.006 0.49 0.018 0.48 11 Click to see details
ESCA 0.006 0.49 0.018 0.48 11 Click to see details
ESCA 0.006 0.49 0.018 0.48 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 be