miRTarBase - #MIRT054895 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SOX5   
Synonyms L-SOX5, L-SOX5B, L-SOX5F, LAMSHF
Description SRY-box 5
Transcript NM_006940   
Other Transcripts NM_152989 , NM_178010   
Expression
Putative miRNA Targets on SOX5
3'UTR of SOX5
(miRNA target sites are highlighted)
>SOX5|NM_006940|3'UTR
   1 TAAGGGTCAAAAGATTGTTGTGACCTTAGGACTTAAAGAAGCCCTAACTGGTTCATCCTTACCAGTGGCCAAGCACATTA
  81 ACTTTCTCATACACTGACTGTTACTTTAACTGTTAGTCTTAAATAGTTGGGACATCAGCTGACTAATAGACCTCAGCCTC
 161 AAAAGGCTTGGAAAGAAAAAACAAATACAACAAGCAAACAACAATATCAACAACAAGAGATTGAAATAAGCTATGGGTAA
 241 AATAATGCCAGTAATTCAGCTGCTACATCCAAGCACTGAAGTCTTACCCGTCAACTTTTTTTTTTTTTTAAATAAACTTT
 321 ATGGCTGTTTGTTCTACAATGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAAGTGGCTTGTGAATGTGTTTTGT
 401 TGTTTTGTGCTACAATTTTTAAAAAGAAAAAAGTTTTGTTTTGTTTTTTGGGGTTTCTGGGTTTTTTCCTTTTCTTTTTC
 481 TTTCCTTTCATTTTTTTTCTTTGTAATGCACCTGACAGAAAAAAAAGAAAAATGAATTTCTCTTTACTTCTCTCCACCTT
 561 CTCCATCTCTCTACTTTAAAGATGGAAGTCTGTGCATGAGGGGAAAGAGGGAAAAAGAGCCTGTTTTTAACTTCCTTGCT
 641 ATCCACCACAAAATAAGCAATTATTTTCTTTAGAGGACTTTATCTATTGCACACCACACTACATCTTTGAGCAAGTGCCA
 721 AATTTGTACTGAAGTGTTGACCAAGTTCATTTTTTCTCTTTACTTTTTCCTTTTCCTTCTTAAGTTAGGACAGTGTTAAA
 801 TCTTAGACAATCCCTTGAAAAACCTGAAATACCAGCAGCTGGTGAGATTTGACTTTTTTTTTTAATGGAAACTGTAGGTG
 881 CTGTTCTCAGGTGAAAAGAGAGAGAGAGAGAGAGACATAAGAAATTTAGAGAAAAATATTTTCTGATCTTGGATTTTTGT
 961 GTGTATGTATGTATGTGATTATGGTACTAATAATAGGAATAACGTTGGACCATTGTGAGTTAAACCCACATCTGGGGATG
1041 AAATCCCACATCCTCCCAAGTGACTGGTCTAGAAATAATCTTGACCTTGACTTTGCACTTCAAATGACAACTTAACCAAG
1121 TATAGGGCTCAGAAATTATATTTTTAAATGTCTGATTATTATTGGATGGATCAGGTGGCCCTGTGTAATAGAGGTGTGCA
1201 TGTATAACATGGAAGCTACTAGCAAACTGCTCCCAGATGTCCTTTCTCCCTGGTCAGTTGGTTCCATTAACGTTTGCTAC
1281 TTAGTGATTTTTGTTTTTCCTGTTGATATTTTGAGCAAAACAATCATTGTTTTCATTGAATATATTTGGCCATTTTTTCA
1361 GACAAATAGAATTAGCTTATTTCTTCAACATTCCATCCTTTCCCGATCAGGAAATGAAACTGATGATTTTATAAGGTATT
1441 TTTCACCCCTCCATGAAGTGAGGTGGAGGCCTTTAGCATTTCAGAAGTGTGGGCCATATGTAGTTCATGCCATAAAAAGT
1521 AGGATTTAATTAAAAGTCATTGCAGCCCAATAAAATGGAGCCTGGCTGCACCCAGGGATCCTTGCCACTGCTCTTCCCTT
1601 GCTGTCAGATTAATCCACTGAAGTCCAACTTTGGTTCAAGCAGAGTATTTGCAAAGAGCAACAACTGAATGTGATGGGAC
1681 TGCTTATGTAGATTTTGCCAGCCAAATGCCAAGGCAGTTGTAGGGCCTGTACAAATAAATGCAAAATCATTTCAAGTCAA
1761 TTGCCATTATTTGTATTGAAGTATCAGATAGATAGTAAATACTGCAACTAGTAGCTTGATGTGCTATAGTTTTCACTCCA
1841 GTCATCATTTTCCTATCTCACCCCCCGAAACACCACCCTAAAGTTGGATTTTTACATATAAATAAAAAAAGAATCCCTTT
1921 TATTTTTCTCTCTCTCAGAAGACTTGCTCTGGGGTTTTGCTTGGAGGAGCTGATCATATCCTGCATGTCAGAGATTTCAT
2001 TTTGTTTGTTTTTCTGTTTGTTTGTTTTTGATGACTTTATTTACATTTGAACTGCCTCTTTTTGCTAGTGTTGTAATGAT
2081 GATGATGATAAAATAATAATAATAATAGTAATAATAATAATAATGGTCAGCTGTTCCCAGATTAGTAAGTTATGTATAAT
2161 TTATTTTATTTCTCCCTTTCTATTTTATTCTGCTCTGATTTGGAAGTGCAGCCAATAAGCTGTTAGATATTTAAAACAAA
2241 TTTCCATCTCCAACTCATATATGTATGTATATGTATATATATATATACATATATATACACACATATACACACACACACAC
2321 ACATTTACCCACAATTTTACTTCTCTTTCCGTAAGTTTTCTCTTTTTTAAGAATTTTGGCCCCAACAATATCAGTTCTGA
2401 TGTTTAAAACAAAGGAGTGAATTAATAGGAGGGTCGTGTTCAATCTTAATTAACTTATGCTCTCATCACTCATTTTAGTT
2481 ATTTAATTGCCACAGTCATCTAGAGCCAATTTTTTTTTGTTTTTGTTTGTTTTGTTTTTAAGCACTCTGGATAAGGAAAA
2561 AATAGACACTTGTTTTTATATCATTTTTATGTACAATGTGAAAACAGATTTTTAAAAAATTTGTTCTCTGTCTTTGTTAA
2641 CAAATTCCTTCCGATTTATGTGGGTTCACCTCTCACGTTTGCTGGATACTTACTTTACACCATGTTATGAAAGATGCTTT
2721 GTTTTCATTTCATGAGTTTGGGCTACAAGAATACTTTGTTTTAGCTCCAGGTAGATGCCATTGAAGGCATTCATGGCTGA
2801 AATCAATTCTAACACACTTACCGATGAATTGACAACACTTTGGTGTTTGGTCTTTTTTTTGTTATATTTTGTTTTATTTG
2881 AAGGGGAAAACAAAATTGTTAATGGTGACTTTTAACTGCTGAAATTCAAAATTTGATTTTAGTTAGGTTTATGTCCGAGA
2961 CTAAACTGTGCATGAACCGAAACAAAAAGCAAGTTCATACCGCTGCATTCTGTTCTCTTGTTCTGACGGTTAATTCACTG
3041 GACATCAAATTTTCTTTGCCCTAGTTTTCCCCAAAAGAAAACAAAAGCAAAAATAGTTATATTAATGTTGAAAGTGCTTT
3121 GAAGTCACTTGATAAAAGGTGCTATGAATAGCAACTTACTGTGTTACTACATTGCCTTTTTGGCATTGGTTGATTTATAA
3201 TTTTGGTAAAGGATCCTAAAACCCTGTATTCTTTTTCTGTGCCCCATAATGACCAAAAAAGATAAAGAAAATGAGAGTAA
3281 GATCAAAAGATCAAACTAAAACATAAACAGTCTCCTTCCTGTCTGCTTTCTTACCTATCTGTTCACACTTTATCTCTTTC
3361 CCTTTCTCTCTCTCTCTCACATGCGCGCGCGCGCGCGCGCACACACACACACACACACACTTGCCCCAACACTGAGAAAT
3441 AATCTTGCCAGAATTCTGGTTTTTATAGTTGTTGTAGTCCGTTTCTCTAAAAATAGTCCTGTTTTCATATGAATCTAAGA
3521 GAACATTACCGGAGAAAATAAAGTTACTCATTTATAGTTACTAATAATAAGTTAGTGATTAACTTACCACAATTGGATAA
3601 AATATAAAACTATTCTTCAGCACATTTATACCTAAATTAGTGAAGTCCATTTGTGAAGTTCATTTGGCATCTGCAGTTAA
3681 GAGTTAACCATGTATAAAATCCCTCCCAAAGAACATAATCATCGTTAGAACCAAATCCTCTTATAAAGAACAAATATAAA
3761 AAAGTTTTCTGTGGTGAAGCTATTTTATAGATTTGATTTCCGGAGTAGAATTTTACCTTAATTCACTTAAAGAAAATTAA
3841 CCATTTTTTGGTCCAACTTCAGATATTTTCTTAATCCAGAAGCTGTGACTGTTCCCAGAAGAAACCTCTTATATCACATT
3921 TAAAACATAAAAAATAATTACACTTTCACTCATTCTAATGGGTAAATTGTTGAATTGTAATAAACAACTGTATATTTACA
4001 AACAGGTTTATAAGGTATTTGTCTATCAAATTAATAATAAAATAAAACTTACGGGGTCTGCAAGGAAAACTATGAAGGCC
4081 ACTTAAAGTGGTTCAGGTATCCCTTTGTCTTGTAGGGCATAGCTGTTGGTTTAGCCAGGCTTTTACAGTATTTAATTTTA
4161 AAGTATCCTATAACTATCAACTTCCCAGGTTGAAGACGATGTGTTGAGTTTCCTACTGATTGATTGATTCCTGTCCTCCC
4241 CAGTGTTTCCGTCACTGGTTCACTAAAACAGTATTTATATAGCTCCACTGGCTCTAAAGCTCTTAGTCCTTCTAATATTT
4321 TGGATTTTACAAGTAAAAATGGAAAAAAAATAGAAAAGAGACAATCAAATGCCTGGAGCTTAAAACAAAGTATGTGCAAC
4401 CTACCATCTCACTTGAAATTTAATAAAATAATAAGTAATTATGTAAATATAACATAGAGTTATAGATTTATATTTTGTTC
4481 ATAACACATAGTGTAATATAAGTTGTATATTTTCATGTTTTTGGTTTTATGTTATCATTCATGCCACAATAAAAATAAAA
4561 CAGGAGTTTATGTGCTCTTAAAAAAAAGATGTGGGTTGCCACCAACCTGTTTTTCGTTTTTGTTTTTTGTTTATTTTATT
4641 TTATTTTTTTGCATTCTCCTTTTTCAGTATTACTGCCATGCAAGGCACCAATAAAAACAGCAAATGTGTTCTTTAAAAAA
4721 AAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||:: || ||||||:| 
Target 5' tggAAACTG-TAGGTGCTGTTc 3'
866 - 886 150.00 -12.80
2
miRNA  3' guguuuGGUAAU---ACACGACGAu 5'
                ||||||   | |||| || 
Target 5' ttggttCCATTAACGTTTGCTACTt 3'
1258 - 1282 128.00 -10.40
3
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |:||| | | ||||| 
Target 5' ccctttCTATTTTATTCTGCTc 3'
2174 - 2195 128.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN16348648 3 COSMIC
COSN31496511 8 COSMIC
COSN26996388 12 COSMIC
COSN510877 12 COSMIC
COSN30502484 37 COSMIC
COSN30474359 43 COSMIC
COSN30505843 44 COSMIC
COSN30519210 69 COSMIC
COSN30103244 73 COSMIC
COSN24398588 84 COSMIC
COSN1567552 105 COSMIC
COSN31513780 157 COSMIC
COSN31525299 181 COSMIC
COSN31566397 206 COSMIC
COSN26668067 250 COSMIC
COSN31607627 269 COSMIC
COSN20923266 295 COSMIC
COSN26551709 325 COSMIC
COSN26103513 432 COSMIC
COSN17076369 457 COSMIC
COSN30305071 518 COSMIC
COSN21727930 555 COSMIC
COSN31609318 668 COSMIC
COSN22220200 703 COSMIC
COSN25218912 712 COSMIC
COSN26557067 718 COSMIC
COSN24304383 725 COSMIC
COSN30159254 759 COSMIC
COSN26538287 824 COSMIC
COSN30658081 847 COSMIC
COSN31513563 853 COSMIC
COSN27521074 854 COSMIC
COSN28837818 854 COSMIC
COSN28867830 897 COSMIC
COSN30173792 902 COSMIC
COSN5833158 920 COSMIC
COSN30544398 1008 COSMIC
COSN30685973 1029 COSMIC
COSN24399365 1041 COSMIC
COSN31538226 1053 COSMIC
COSN5865324 1083 COSMIC
COSN26596576 1089 COSMIC
COSN31531662 1125 COSMIC
COSN30569732 1128 COSMIC
COSN7613141 1131 COSMIC
COSN30602833 1154 COSMIC
COSN27323980 1408 COSMIC
COSN32069340 1494 COSMIC
COSN23670092 1535 COSMIC
COSN20109341 1785 COSMIC
COSN9746873 1918 COSMIC
COSN7323214 2410 COSMIC
COSN22904538 2510 COSMIC
COSN19078957 2780 COSMIC
COSN19426506 2852 COSMIC
COSN28396200 2935 COSMIC
COSN14513587 2978 COSMIC
COSN5938963 3025 COSMIC
COSN5320081 3101 COSMIC
COSN7323213 3231 COSMIC
COSN21777230 3284 COSMIC
COSN27333649 3295 COSMIC
COSN7323212 3339 COSMIC
COSN22191405 3368 COSMIC
COSN7323211 3403 COSMIC
COSN221147 3622 COSMIC
COSN30373900 3690 COSMIC
COSN27354363 3723 COSMIC
COSN29046792 3723 COSMIC
COSN24495925 3858 COSMIC
COSN22412152 3977 COSMIC
COSN7323210 4312 COSMIC
COSN24642639 4336 COSMIC
COSN29601848 4343 COSMIC
COSN15088679 4357 COSMIC
COSN5320080 4411 COSMIC
COSN27153279 4419 COSMIC
COSN17564644 4466 COSMIC
COSN19372998 4545 COSMIC
COSN21247920 4587 COSMIC
COSN14990440 4619 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755447149 8 dbSNP
rs776181554 14 dbSNP
rs753914842 17 dbSNP
rs780271083 24 dbSNP
rs756330009 26 dbSNP
rs1251177082 27 dbSNP
rs763613057 35 dbSNP
rs750642702 36 dbSNP
rs1201872387 38 dbSNP
rs1305590755 41 dbSNP
rs760121498 41 dbSNP
rs1314604811 44 dbSNP
rs1241939112 46 dbSNP
rs1054672949 48 dbSNP
rs774858415 49 dbSNP
rs1434381516 56 dbSNP
rs1222165640 61 dbSNP
rs1290251227 62 dbSNP
rs1384181833 88 dbSNP
rs1191855006 89 dbSNP
rs1489722732 89 dbSNP
rs759600869 92 dbSNP
rs910658711 93 dbSNP
rs1180802013 96 dbSNP
rs1381120383 101 dbSNP
rs1467427723 101 dbSNP
rs1423790016 104 dbSNP
rs985975551 114 dbSNP
rs1351552098 115 dbSNP
rs1458403766 121 dbSNP
rs903217106 128 dbSNP
rs138736107 152 dbSNP
rs1045750283 166 dbSNP
rs1309576821 167 dbSNP
rs1381529464 171 dbSNP
rs1245723098 174 dbSNP
rs950064294 177 dbSNP
rs1175028847 178 dbSNP
rs1452218586 182 dbSNP
rs1249427155 196 dbSNP
rs1188650787 200 dbSNP
rs1251223905 202 dbSNP
rs1456535547 204 dbSNP
rs894567731 205 dbSNP
rs1239031140 208 dbSNP
rs1444166040 214 dbSNP
rs771615415 217 dbSNP
rs1415763076 220 dbSNP
rs1056245892 221 dbSNP
rs1169700673 222 dbSNP
rs1032850406 223 dbSNP
rs1260339573 226 dbSNP
rs776888281 235 dbSNP
rs553160637 243 dbSNP
rs1352650242 261 dbSNP
rs937868882 263 dbSNP
rs1331366444 282 dbSNP
rs1481653866 284 dbSNP
rs1202672588 290 dbSNP
rs61923823 293 dbSNP
rs76614643 295 dbSNP
rs76184106 296 dbSNP
rs1304210860 299 dbSNP
rs1381860701 300 dbSNP
rs536730777 305 dbSNP
rs966985006 309 dbSNP
rs1220546856 310 dbSNP
rs1295540135 310 dbSNP
rs1320728095 310 dbSNP
rs201455508 310 dbSNP
rs1255797768 311 dbSNP
rs1460914473 318 dbSNP
rs1208338532 324 dbSNP
rs1232505246 327 dbSNP
rs919751568 329 dbSNP
rs1344589533 334 dbSNP
rs1298535852 336 dbSNP
rs1023941710 339 dbSNP
rs1421408719 340 dbSNP
rs1478726219 344 dbSNP
rs1203864617 348 dbSNP
rs1428060320 353 dbSNP
rs1324759315 355 dbSNP
rs1014359837 372 dbSNP
rs577358893 375 dbSNP
rs1449229122 380 dbSNP
rs574213923 391 dbSNP
rs1288586302 399 dbSNP
rs1338895796 409 dbSNP
rs1402461657 426 dbSNP
rs1397735662 429 dbSNP
rs1322965544 431 dbSNP
rs1402774368 432 dbSNP
rs1214814025 433 dbSNP
rs1281021013 433 dbSNP
rs1312935343 433 dbSNP
rs1312053527 436 dbSNP
rs1489143436 445 dbSNP
rs1194364925 448 dbSNP
rs939899133 449 dbSNP
rs1476774718 450 dbSNP
rs1034547346 460 dbSNP
rs1391689565 462 dbSNP
rs1359082050 468 dbSNP
rs557870366 468 dbSNP
rs371919159 481 dbSNP
rs986494111 484 dbSNP
rs1002373443 485 dbSNP
rs887954843 488 dbSNP
rs774405020 489 dbSNP
rs534401251 490 dbSNP
rs1434422263 493 dbSNP
rs1223491269 499 dbSNP
rs1368392927 499 dbSNP
rs1370822612 499 dbSNP
rs1284126127 502 dbSNP
rs1028075130 504 dbSNP
rs1449727103 506 dbSNP
rs747184867 507 dbSNP
rs1246839797 511 dbSNP
rs1469158454 513 dbSNP
rs190885876 516 dbSNP
rs1381735146 526 dbSNP
rs1033127365 527 dbSNP
rs572748536 527 dbSNP
rs998956346 533 dbSNP
rs929563019 542 dbSNP
rs371064999 546 dbSNP
rs1404165919 550 dbSNP
rs903459124 554 dbSNP
rs1024944542 555 dbSNP
rs537482657 557 dbSNP
rs1275704125 563 dbSNP
rs1307392003 567 dbSNP
rs778011895 573 dbSNP
rs1240620872 576 dbSNP
rs1314193444 577 dbSNP
rs1353973150 579 dbSNP
rs1211612536 583 dbSNP
rs568492765 583 dbSNP
rs898103876 589 dbSNP
rs565695136 596 dbSNP
rs186785434 603 dbSNP
rs772412876 608 dbSNP
rs1182593664 612 dbSNP
rs1245526314 612 dbSNP
rs944740718 623 dbSNP
rs1368314700 634 dbSNP
rs1055920251 638 dbSNP
rs1341005265 640 dbSNP
rs1415112435 642 dbSNP
rs1292579731 649 dbSNP
rs930703245 655 dbSNP
rs779846890 657 dbSNP
rs910636545 669 dbSNP
rs1447867474 676 dbSNP
rs1333725815 678 dbSNP
rs1038226218 681 dbSNP
rs1284731310 682 dbSNP
rs750029215 682 dbSNP
rs1372141593 684 dbSNP
rs1216258010 686 dbSNP
rs1259507960 691 dbSNP
rs1308313951 692 dbSNP
rs1202694992 695 dbSNP
rs1253607175 702 dbSNP
rs1441083534 703 dbSNP
rs1189997263 704 dbSNP
rs1409035700 707 dbSNP
rs1369566995 721 dbSNP
rs986624330 724 dbSNP
rs768668835 727 dbSNP
rs1169146686 735 dbSNP
rs1425929916 739 dbSNP
rs939804787 749 dbSNP
rs935813973 754 dbSNP
rs756739948 756 dbSNP
rs925800874 758 dbSNP
rs1472808187 766 dbSNP
rs1417847463 770 dbSNP
rs933709981 775 dbSNP
rs977283692 775 dbSNP
rs920920709 776 dbSNP
rs1398136857 779 dbSNP
rs1473800375 779 dbSNP
rs1318049888 782 dbSNP
rs552053278 783 dbSNP
rs975160536 784 dbSNP
rs1436295765 786 dbSNP
rs1292220963 788 dbSNP
rs759492749 792 dbSNP
rs1210567575 797 dbSNP
rs957137822 799 dbSNP
rs1488153779 805 dbSNP
rs1024205381 806 dbSNP
rs1265920148 813 dbSNP
rs1032695303 822 dbSNP
rs1198178772 830 dbSNP
rs554909075 832 dbSNP
rs779459107 837 dbSNP
rs967911705 841 dbSNP
rs1359720404 849 dbSNP
rs1299998037 854 dbSNP
rs535370754 854 dbSNP
rs1341002624 855 dbSNP
rs181607943 859 dbSNP
rs1005727792 863 dbSNP
rs1284826215 864 dbSNP
rs1332317538 864 dbSNP
rs1353472996 864 dbSNP
rs1441129802 869 dbSNP
rs1214835702 871 dbSNP
rs1288799928 876 dbSNP
rs1488865130 878 dbSNP
rs1191116215 879 dbSNP
rs1034747187 896 dbSNP
rs1491283394 897 dbSNP
rs1238074763 898 dbSNP
rs1491555255 898 dbSNP
rs1335306912 899 dbSNP
rs1379876583 900 dbSNP
rs1437622557 900 dbSNP
rs767902277 900 dbSNP
rs1160178400 902 dbSNP
rs1330138720 905 dbSNP
rs1393684073 906 dbSNP
rs1388994600 909 dbSNP
rs887922180 910 dbSNP
rs549199651 911 dbSNP
rs1392305230 912 dbSNP
rs148266789 916 dbSNP
rs372687588 916 dbSNP
rs569569613 916 dbSNP
rs749848097 916 dbSNP
rs772978959 916 dbSNP
rs899259500 916 dbSNP
rs1386716475 917 dbSNP
rs529716532 917 dbSNP
rs1156247668 918 dbSNP
rs748327868 924 dbSNP
rs1438529943 932 dbSNP
rs1178353378 933 dbSNP
rs1363946348 934 dbSNP
rs1436438892 935 dbSNP
rs993697391 936 dbSNP
rs1456562529 937 dbSNP
rs933887206 939 dbSNP
rs1252882224 941 dbSNP
rs1431418500 945 dbSNP
rs1196629557 952 dbSNP
rs920962126 957 dbSNP
rs1039358858 961 dbSNP
rs1266349562 962 dbSNP
rs572340640 965 dbSNP
rs1490558011 975 dbSNP
rs781292333 977 dbSNP
rs1294201741 981 dbSNP
rs567066045 983 dbSNP
rs1350004587 984 dbSNP
rs925707999 987 dbSNP
rs1241738754 994 dbSNP
rs1457978591 994 dbSNP
rs762786201 995 dbSNP
rs977138382 996 dbSNP
rs967608453 998 dbSNP
rs775471830 1000 dbSNP
rs1367918787 1001 dbSNP
rs781391946 1003 dbSNP
rs898074406 1004 dbSNP
rs1385027075 1007 dbSNP
rs1228067892 1008 dbSNP
rs1311237090 1011 dbSNP
rs1159818966 1013 dbSNP
rs550149752 1014 dbSNP
rs1428534177 1015 dbSNP
rs1200130790 1018 dbSNP
rs1481291855 1021 dbSNP
rs1260812798 1025 dbSNP
rs1191748140 1033 dbSNP
rs776214692 1036 dbSNP
rs1456492284 1037 dbSNP
rs1284993900 1040 dbSNP
rs1337332976 1041 dbSNP
rs1206975973 1044 dbSNP
rs1233624803 1048 dbSNP
rs530534708 1056 dbSNP
rs1263053466 1060 dbSNP
rs994846163 1065 dbSNP
rs1224735381 1067 dbSNP
rs1385846839 1069 dbSNP
rs1347745911 1071 dbSNP
rs1258187653 1072 dbSNP
rs1276757612 1075 dbSNP
rs569142602 1079 dbSNP
rs1363403118 1083 dbSNP
rs1326690651 1084 dbSNP
rs1319644058 1091 dbSNP
rs1393777931 1093 dbSNP
rs549663030 1103 dbSNP
rs770517716 1107 dbSNP
rs1466704502 1110 dbSNP
rs1470943505 1112 dbSNP
rs763234223 1117 dbSNP
rs1358167516 1118 dbSNP
rs1167137506 1120 dbSNP
rs551218845 1122 dbSNP
rs1242924014 1123 dbSNP
rs889122570 1125 dbSNP
rs1195678734 1126 dbSNP
rs1365893168 1135 dbSNP
rs1278103200 1137 dbSNP
rs748482541 1137 dbSNP
rs1242655606 1139 dbSNP
rs1183040290 1150 dbSNP
rs757417742 1155 dbSNP
rs1051352546 1158 dbSNP
rs1441139579 1158 dbSNP
rs1326311778 1162 dbSNP
rs1257603643 1164 dbSNP
rs998001349 1164 dbSNP
rs1050503375 1168 dbSNP
rs936103946 1171 dbSNP
rs565007106 1174 dbSNP
rs925615706 1180 dbSNP
rs1186534689 1181 dbSNP
rs751573280 1182 dbSNP
rs926061009 1184 dbSNP
rs545305511 1191 dbSNP
rs1173470080 1194 dbSNP
rs1177779433 1195 dbSNP
rs1454024498 1200 dbSNP
rs115434154 1204 dbSNP
rs764705438 1205 dbSNP
rs1190614921 1210 dbSNP
rs542890533 1211 dbSNP
rs945917650 1216 dbSNP
rs191354348 1226 dbSNP
rs557501838 1241 dbSNP
rs945770281 1242 dbSNP
rs916984448 1243 dbSNP
rs144925992 1248 dbSNP
rs1445117604 1249 dbSNP
rs958371568 1252 dbSNP
rs1280507775 1258 dbSNP
rs993415747 1259 dbSNP
rs1283816733 1261 dbSNP
rs1489193044 1264 dbSNP
rs759865362 1272 dbSNP
rs926970877 1272 dbSNP
rs1300789669 1282 dbSNP
rs983827857 1286 dbSNP
rs1192611809 1287 dbSNP
rs958865871 1290 dbSNP
rs1454991049 1293 dbSNP
rs1158345250 1295 dbSNP
rs927530644 1298 dbSNP
rs1422124206 1310 dbSNP
rs75979655 1312 dbSNP
rs1365245865 1313 dbSNP
rs1288843890 1322 dbSNP
rs963407176 1327 dbSNP
rs1276853248 1333 dbSNP
rs558132398 1337 dbSNP
rs1306897477 1343 dbSNP
rs993666270 1346 dbSNP
rs1361368840 1349 dbSNP
rs1355570325 1357 dbSNP
rs1004990745 1365 dbSNP
rs1014920462 1365 dbSNP
rs1335283862 1369 dbSNP
rs1223048532 1375 dbSNP
rs1253241400 1379 dbSNP
rs755857115 1391 dbSNP
rs962208295 1395 dbSNP
rs867507514 1397 dbSNP
rs1176381023 1399 dbSNP
rs954976953 1404 dbSNP
rs750038161 1405 dbSNP
rs1413645164 1410 dbSNP
rs1009574206 1413 dbSNP
rs1393569867 1415 dbSNP
rs1170713040 1416 dbSNP
rs767224059 1417 dbSNP
rs1327933704 1425 dbSNP
rs1450213971 1428 dbSNP
rs1418867871 1430 dbSNP
rs1329538297 1435 dbSNP
rs1378893317 1441 dbSNP
rs1184808560 1444 dbSNP
rs889095839 1446 dbSNP
rs1050837685 1454 dbSNP
rs1442617953 1457 dbSNP
rs761666113 1463 dbSNP
rs535310936 1484 dbSNP
rs1000180402 1491 dbSNP
rs998430842 1492 dbSNP
rs899674337 1495 dbSNP
rs904607202 1496 dbSNP
rs74615658 1497 dbSNP
rs1211403266 1501 dbSNP
rs1485219701 1512 dbSNP
rs945843926 1519 dbSNP
rs1196413873 1541 dbSNP
rs1239576165 1554 dbSNP
rs917083654 1558 dbSNP
rs1182911441 1563 dbSNP
rs1206823413 1568 dbSNP
rs1307665769 1574 dbSNP
rs1057024685 1577 dbSNP
rs1294266080 1578 dbSNP
rs555535148 1578 dbSNP
rs1212230542 1582 dbSNP
rs140829436 1593 dbSNP
rs1465145193 1594 dbSNP
rs927262707 1600 dbSNP
rs566980085 1606 dbSNP
rs952397868 1608 dbSNP
rs1285291900 1609 dbSNP
rs1391761135 1617 dbSNP
rs1333339763 1622 dbSNP
rs1338469102 1624 dbSNP
rs1450184269 1624 dbSNP
rs918303612 1625 dbSNP
rs1373995971 1626 dbSNP
rs1056843212 1627 dbSNP
rs1259607447 1628 dbSNP
rs1339578466 1637 dbSNP
rs972487127 1640 dbSNP
rs1199523929 1645 dbSNP
rs937542685 1646 dbSNP
rs1441030654 1647 dbSNP
rs1430672392 1649 dbSNP
rs1258785646 1650 dbSNP
rs927435112 1677 dbSNP
rs1191509009 1681 dbSNP
rs1374857319 1682 dbSNP
rs1462737223 1683 dbSNP
rs962173757 1690 dbSNP
rs1399846353 1694 dbSNP
rs765707170 1698 dbSNP
rs759912578 1699 dbSNP
rs550262237 1711 dbSNP
rs942240926 1718 dbSNP
rs1168442201 1719 dbSNP
rs1425617610 1721 dbSNP
rs1019547066 1727 dbSNP
rs773064315 1730 dbSNP
rs983866681 1735 dbSNP
rs1009089073 1751 dbSNP
rs953743268 1755 dbSNP
rs1272687635 1760 dbSNP
rs1029280744 1761 dbSNP
rs1343355536 1761 dbSNP
rs530393064 1773 dbSNP
rs954695228 1776 dbSNP
rs1281667009 1779 dbSNP
rs186460121 1780 dbSNP
rs1255161771 1782 dbSNP
rs1184029929 1783 dbSNP
rs1264002189 1789 dbSNP
rs1480758575 1794 dbSNP
rs904535110 1794 dbSNP
rs151300319 1796 dbSNP
rs370517384 1811 dbSNP
rs1359659403 1812 dbSNP
rs1417850472 1816 dbSNP
rs148041562 1820 dbSNP
rs895925090 1821 dbSNP
rs1385696431 1822 dbSNP
rs1321206384 1826 dbSNP
rs1372654400 1827 dbSNP
rs1233188165 1834 dbSNP
rs1057355820 1836 dbSNP
rs551120711 1844 dbSNP
rs368743600 1845 dbSNP
rs1174311930 1855 dbSNP
rs879194677 1858 dbSNP
rs377274870 1859 dbSNP
rs963877547 1865 dbSNP
rs180958568 1866 dbSNP
rs1265540100 1867 dbSNP
rs904464538 1867 dbSNP
rs999963067 1867 dbSNP
rs1379510091 1878 dbSNP
rs1048346617 1879 dbSNP
rs1437559552 1887 dbSNP
rs559726195 1890 dbSNP
rs1020164882 1895 dbSNP
rs1010317911 1905 dbSNP
rs1057316908 1911 dbSNP
rs895478638 1911 dbSNP
rs1396013454 1917 dbSNP
rs937060600 1919 dbSNP
rs1330229688 1920 dbSNP
rs918272337 1922 dbSNP
rs972451199 1928 dbSNP
rs542804655 1937 dbSNP
rs906052856 1937 dbSNP
rs943764003 1939 dbSNP
rs1037891906 1946 dbSNP
rs1459545711 1946 dbSNP
rs942147350 1953 dbSNP
rs1244694762 1955 dbSNP
rs908127738 1970 dbSNP
rs1337013910 1971 dbSNP
rs527755969 1990 dbSNP
rs912342247 1991 dbSNP
rs1456296203 1993 dbSNP
rs988035419 1994 dbSNP
rs1251166287 2004 dbSNP
rs529105233 2005 dbSNP
rs1423228211 2007 dbSNP
rs983718369 2009 dbSNP
rs1164237081 2012 dbSNP
rs933352620 2012 dbSNP
rs923285444 2013 dbSNP
rs975258755 2015 dbSNP
rs1397603504 2020 dbSNP
rs564535117 2024 dbSNP
rs1415492352 2026 dbSNP
rs1374494337 2028 dbSNP
rs964785559 2028 dbSNP
rs1184098911 2034 dbSNP
rs1357484465 2035 dbSNP
rs1233926134 2038 dbSNP
rs925344909 2039 dbSNP
rs1305919765 2045 dbSNP
rs1206869266 2047 dbSNP
rs1419442486 2052 dbSNP
rs1482785916 2060 dbSNP
rs1185749653 2075 dbSNP
rs978575513 2084 dbSNP
rs968481548 2085 dbSNP
rs1020657195 2086 dbSNP
rs1010145237 2090 dbSNP
rs1035343554 2090 dbSNP
rs960002346 2090 dbSNP
rs1001176031 2094 dbSNP
rs1158407739 2101 dbSNP
rs1355522259 2102 dbSNP
rs905624198 2107 dbSNP
rs1006434116 2108 dbSNP
rs1037420430 2108 dbSNP
rs1377739777 2108 dbSNP
rs886602907 2111 dbSNP
rs1216584794 2114 dbSNP
rs1048479303 2116 dbSNP
rs1212480094 2120 dbSNP
rs1311410979 2120 dbSNP
rs1208383592 2123 dbSNP
rs1239911915 2125 dbSNP
rs1282388958 2125 dbSNP
rs1333351975 2125 dbSNP
rs1270559217 2126 dbSNP
rs1186775954 2133 dbSNP
rs953609842 2135 dbSNP
rs188240866 2140 dbSNP
rs1454119407 2145 dbSNP
rs543911821 2149 dbSNP
rs968667195 2154 dbSNP
rs578062276 2167 dbSNP
rs1468918194 2172 dbSNP
rs552750771 2182 dbSNP
rs143490264 2184 dbSNP
rs1039050900 2186 dbSNP
rs943341455 2193 dbSNP
rs562127348 2194 dbSNP
rs1020224235 2201 dbSNP
rs1232364688 2208 dbSNP
rs979481455 2212 dbSNP
rs1235139901 2222 dbSNP
rs1348298224 2225 dbSNP
rs1325303671 2227 dbSNP
rs968555335 2234 dbSNP
rs1392275988 2244 dbSNP
rs1160224910 2245 dbSNP
rs1010222796 2246 dbSNP
rs1282016920 2250 dbSNP
rs913049699 2254 dbSNP
rs183509146 2264 dbSNP
rs1035819714 2269 dbSNP
rs1466914729 2275 dbSNP
rs1001737902 2277 dbSNP
rs960001806 2277 dbSNP
rs1035987399 2279 dbSNP
rs1454945496 2279 dbSNP
rs905706427 2279 dbSNP
rs181905590 2286 dbSNP
rs149076397 2288 dbSNP
rs760785341 2288 dbSNP
rs768816624 2288 dbSNP
rs931234914 2288 dbSNP
rs1328145065 2290 dbSNP
rs897096019 2290 dbSNP
rs1036684261 2296 dbSNP
rs1371487971 2298 dbSNP
rs1395242753 2298 dbSNP
rs969710015 2298 dbSNP
rs760811365 2299 dbSNP
rs1466744959 2301 dbSNP
rs199634292 2301 dbSNP
rs1288605137 2302 dbSNP
rs199579118 2304 dbSNP
rs535603774 2306 dbSNP
rs1273385654 2308 dbSNP
rs1469195537 2308 dbSNP
rs569932787 2308 dbSNP
rs1231519760 2309 dbSNP
rs932107953 2310 dbSNP
rs1417307839 2312 dbSNP
rs773766406 2314 dbSNP
rs922116315 2320 dbSNP
rs1485797175 2323 dbSNP
rs1047912751 2324 dbSNP
rs1278877827 2324 dbSNP
rs1395407130 2324 dbSNP
rs886631363 2324 dbSNP
rs1283481413 2327 dbSNP
rs1353058509 2332 dbSNP
rs148841690 2343 dbSNP
rs902104186 2350 dbSNP
rs78220832 2351 dbSNP
rs1271375959 2357 dbSNP
rs1205859208 2369 dbSNP
rs1439897724 2369 dbSNP
rs925276423 2386 dbSNP
rs1043817248 2388 dbSNP
rs1190084716 2390 dbSNP
rs1418645034 2396 dbSNP
rs945461479 2403 dbSNP
rs749238661 2410 dbSNP
rs1166335313 2415 dbSNP
rs867077381 2417 dbSNP
rs988673060 2427 dbSNP
rs1320265448 2429 dbSNP
rs1382734592 2432 dbSNP
rs938479606 2433 dbSNP
rs190452369 2435 dbSNP
rs372211726 2436 dbSNP
rs980008317 2454 dbSNP
rs558984616 2456 dbSNP
rs960073382 2457 dbSNP
rs1036151630 2461 dbSNP
rs1001642348 2462 dbSNP
rs551348137 2463 dbSNP
rs1395372463 2466 dbSNP
rs879897963 2476 dbSNP
rs185348679 2478 dbSNP
rs1215453439 2483 dbSNP
rs112513000 2484 dbSNP
rs1026799331 2487 dbSNP
rs1213635160 2489 dbSNP
rs1258362134 2495 dbSNP
rs772376587 2509 dbSNP
rs1446474207 2511 dbSNP
rs1475628385 2519 dbSNP
rs574395131 2519 dbSNP
rs984433781 2519 dbSNP
rs950511140 2520 dbSNP
rs1026452081 2523 dbSNP
rs554320623 2523 dbSNP
rs565935491 2524 dbSNP
rs1452079824 2525 dbSNP
rs1383647975 2526 dbSNP
rs775340951 2528 dbSNP
rs1319883918 2529 dbSNP
rs1193224363 2533 dbSNP
rs995365785 2542 dbSNP
rs372749068 2545 dbSNP
rs897065182 2546 dbSNP
rs1428444659 2550 dbSNP
rs1346126848 2557 dbSNP
rs1237203666 2563 dbSNP
rs1350057011 2563 dbSNP
rs549321684 2563 dbSNP
rs1203410387 2565 dbSNP
rs1260183448 2567 dbSNP
rs1202613655 2577 dbSNP
rs1263931313 2578 dbSNP
rs1008268656 2579 dbSNP
rs1250961296 2582 dbSNP
rs1455382364 2594 dbSNP
rs1486201767 2596 dbSNP
rs1363089440 2597 dbSNP
rs890803723 2597 dbSNP
rs1451009838 2600 dbSNP
rs1049914971 2604 dbSNP
rs932436560 2608 dbSNP
rs529064282 2614 dbSNP
rs1323447619 2623 dbSNP
rs1043200185 2626 dbSNP
rs1443484439 2630 dbSNP
rs1302607960 2634 dbSNP
rs1344530201 2634 dbSNP
rs1270880863 2635 dbSNP
rs1237521540 2638 dbSNP
rs1007751371 2639 dbSNP
rs1226699402 2639 dbSNP
rs1213327490 2641 dbSNP
rs947596871 2647 dbSNP
rs748519737 2652 dbSNP
rs989085739 2653 dbSNP
rs779599699 2659 dbSNP
rs1249539659 2660 dbSNP
rs1417314250 2664 dbSNP
rs1183859307 2665 dbSNP
rs563456548 2665 dbSNP
rs1162383905 2677 dbSNP
rs1396151673 2690 dbSNP
rs369560255 2692 dbSNP
rs375309106 2693 dbSNP
rs113371762 2697 dbSNP
rs76461815 2697 dbSNP
rs1294556134 2717 dbSNP
rs928673653 2720 dbSNP
rs1056912079 2721 dbSNP
rs938562656 2738 dbSNP
rs542635227 2739 dbSNP
rs1351219977 2746 dbSNP
rs1291681971 2758 dbSNP
rs1168005032 2765 dbSNP
rs1222579218 2766 dbSNP
rs970114641 2773 dbSNP
rs549737899 2777 dbSNP
rs1027104168 2781 dbSNP
rs995334725 2788 dbSNP
rs948638124 2797 dbSNP
rs961200922 2798 dbSNP
rs1474604541 2799 dbSNP
rs1185243053 2804 dbSNP
rs1475355660 2807 dbSNP
rs1190659433 2815 dbSNP
rs909101692 2815 dbSNP
rs1475767530 2816 dbSNP
rs984465730 2817 dbSNP
rs1460751186 2821 dbSNP
rs1300423188 2822 dbSNP
rs1257286486 2823 dbSNP
rs950397845 2831 dbSNP
rs1026105076 2832 dbSNP
rs1484164102 2839 dbSNP
rs1273911237 2841 dbSNP
rs976227737 2842 dbSNP
rs749767924 2843 dbSNP
rs745652630 2845 dbSNP
rs1229246713 2852 dbSNP
rs1195365765 2856 dbSNP
rs1275076222 2860 dbSNP
rs1017708489 2861 dbSNP
rs1208605355 2864 dbSNP
rs1259069371 2867 dbSNP
rs1249592985 2876 dbSNP
rs1483263663 2880 dbSNP
rs779728614 2883 dbSNP
rs1427122012 2885 dbSNP
rs1173060624 2891 dbSNP
rs1391163131 2897 dbSNP
rs1008158575 2900 dbSNP
rs749049949 2901 dbSNP
rs1377374626 2907 dbSNP
rs890762492 2908 dbSNP
rs1007656622 2909 dbSNP
rs1355968500 2914 dbSNP
rs1288511819 2915 dbSNP
rs1360212351 2918 dbSNP
rs1049392715 2933 dbSNP
rs1412635449 2939 dbSNP
rs996951662 2942 dbSNP
rs1346856169 2947 dbSNP
rs533463788 2956 dbSNP
rs1232020760 2957 dbSNP
rs1022467867 2960 dbSNP
rs1312270187 2963 dbSNP
rs903611174 2966 dbSNP
rs1214385538 2971 dbSNP
rs147804020 2972 dbSNP
rs1390357401 2973 dbSNP
rs892459061 2978 dbSNP
rs530841183 2979 dbSNP
rs913417329 2983 dbSNP
rs1393665349 2984 dbSNP
rs144157383 2989 dbSNP
rs1454069534 2989 dbSNP
rs1172347390 2994 dbSNP
rs1397353133 2995 dbSNP
rs1415119584 2997 dbSNP
rs1056582682 3001 dbSNP
rs938931336 3002 dbSNP
rs1321413678 3011 dbSNP
rs142000113 3017 dbSNP
rs905255947 3018 dbSNP
rs1305552417 3020 dbSNP
rs980116958 3027 dbSNP
rs12819959 3030 dbSNP
rs970083586 3034 dbSNP
rs1281571465 3037 dbSNP
rs1233704271 3038 dbSNP
rs1181332382 3040 dbSNP
rs1436240119 3043 dbSNP
rs1269592467 3044 dbSNP
rs1208986628 3045 dbSNP
rs1272100166 3046 dbSNP
rs562014611 3052 dbSNP
rs974161163 3061 dbSNP
rs1192077025 3063 dbSNP
rs1248818382 3069 dbSNP
rs909134257 3077 dbSNP
rs193088518 3087 dbSNP
rs576358038 3095 dbSNP
rs1405917854 3100 dbSNP
rs1015444830 3102 dbSNP
rs918902431 3114 dbSNP
rs975878597 3122 dbSNP
rs987061771 3127 dbSNP
rs965784399 3161 dbSNP
rs12815156 3162 dbSNP
rs910272741 3163 dbSNP
rs955309912 3171 dbSNP
rs1028698860 3176 dbSNP
rs1374915316 3185 dbSNP
rs986269593 3188 dbSNP
rs996430097 3201 dbSNP
rs1292306248 3221 dbSNP
rs556717483 3223 dbSNP
rs903539021 3224 dbSNP
rs968147953 3227 dbSNP
rs1215146812 3235 dbSNP
rs1022541557 3236 dbSNP
rs1010221323 3237 dbSNP
rs1333583532 3246 dbSNP
rs1327341594 3253 dbSNP
rs1204483100 3254 dbSNP
rs1231605432 3255 dbSNP
rs539688500 3259 dbSNP
rs1183063438 3265 dbSNP
rs1417242741 3274 dbSNP
rs1394471938 3277 dbSNP
rs1165198680 3279 dbSNP
rs1324429147 3281 dbSNP
rs1402854586 3283 dbSNP
rs956755013 3283 dbSNP
rs1009292221 3285 dbSNP
rs1409111039 3286 dbSNP
rs1360010610 3292 dbSNP
rs1409196458 3296 dbSNP
rs1326770166 3298 dbSNP
rs1372265704 3300 dbSNP
rs577627263 3301 dbSNP
rs757394368 3304 dbSNP
rs1410343480 3305 dbSNP
rs1311792741 3309 dbSNP
rs1035451298 3310 dbSNP
rs544557167 3310 dbSNP
rs1284386273 3311 dbSNP
rs892242193 3314 dbSNP
rs905287281 3318 dbSNP
rs1357503247 3332 dbSNP
rs1053275249 3333 dbSNP
rs1214291625 3341 dbSNP
rs1271310348 3349 dbSNP
rs1045136459 3352 dbSNP
rs542544271 3352 dbSNP
rs577397658 3355 dbSNP
rs1158308312 3358 dbSNP
rs1256959465 3358 dbSNP
rs1484703772 3361 dbSNP
rs1468801947 3364 dbSNP
rs938881471 3365 dbSNP
rs1397057451 3366 dbSNP
rs370452482 3366 dbSNP
rs1391777558 3368 dbSNP
rs1430388815 3368 dbSNP
rs1045043884 3370 dbSNP
rs1194408431 3370 dbSNP
rs1172884973 3372 dbSNP
rs1373129083 3373 dbSNP
rs887604220 3374 dbSNP
rs1468085549 3375 dbSNP
rs1252345250 3377 dbSNP
rs1048998345 3379 dbSNP
rs1268826816 3379 dbSNP
rs149982948 3379 dbSNP
rs1219256118 3380 dbSNP
rs188112735 3384 dbSNP
rs929193424 3384 dbSNP
rs1448613030 3385 dbSNP
rs1191279230 3386 dbSNP
rs919937114 3386 dbSNP
rs1284731179 3387 dbSNP
rs1449808528 3387 dbSNP
rs1337897712 3388 dbSNP
rs1467510579 3388 dbSNP
rs373768459 3388 dbSNP
rs747211707 3389 dbSNP
rs777734209 3390 dbSNP
rs867915703 3391 dbSNP
rs1367835197 3392 dbSNP
rs565693891 3392 dbSNP
rs986649493 3393 dbSNP
rs1329913315 3394 dbSNP
rs955388270 3394 dbSNP
rs200427167 3395 dbSNP
rs1203645772 3396 dbSNP
rs975316150 3396 dbSNP
rs117410550 3397 dbSNP
rs1250904575 3397 dbSNP
rs1362729574 3398 dbSNP
rs1433533821 3398 dbSNP
rs1333121025 3399 dbSNP
rs7137936 3399 dbSNP
rs56787062 3400 dbSNP
rs1325727578 3401 dbSNP
rs1388983087 3401 dbSNP
rs1460578276 3401 dbSNP
rs1491509438 3401 dbSNP
rs370102131 3401 dbSNP
rs373271410 3401 dbSNP
rs1174126299 3403 dbSNP
rs1298048648 3403 dbSNP
rs1360931309 3403 dbSNP
rs1436940851 3403 dbSNP
rs1318089684 3404 dbSNP
rs1040455338 3405 dbSNP
rs1214673955 3405 dbSNP
rs1217376578 3405 dbSNP
rs1302834184 3405 dbSNP
rs1399309054 3407 dbSNP
rs1463833871 3407 dbSNP
rs1377571556 3408 dbSNP
rs1249031404 3411 dbSNP
rs1174462987 3413 dbSNP
rs1478008982 3414 dbSNP
rs1214611818 3418 dbSNP
rs1427378764 3418 dbSNP
rs1433802579 3420 dbSNP
rs67988903 3420 dbSNP
rs1021900676 3421 dbSNP
rs1158676337 3421 dbSNP
rs1386804377 3421 dbSNP
rs140893725 3421 dbSNP
rs1491078477 3421 dbSNP
rs1453920019 3422 dbSNP
rs1393375436 3423 dbSNP
rs1441381997 3424 dbSNP
rs1009218728 3428 dbSNP
rs892204996 3431 dbSNP
rs1035218898 3432 dbSNP
rs1292247529 3433 dbSNP
rs1410077027 3433 dbSNP
rs549936537 3450 dbSNP
rs907371672 3463 dbSNP
rs16926321 3466 dbSNP
rs757051909 3480 dbSNP
rs1322895720 3481 dbSNP
rs898772521 3481 dbSNP
rs1211181709 3488 dbSNP
rs1249749575 3489 dbSNP
rs1346651170 3493 dbSNP
rs1298559660 3494 dbSNP
rs184080428 3496 dbSNP
rs940042551 3497 dbSNP
rs758444487 3504 dbSNP
rs968220983 3511 dbSNP
rs915376903 3520 dbSNP
rs988303344 3524 dbSNP
rs957191697 3526 dbSNP
rs1166587164 3530 dbSNP
rs1035246781 3531 dbSNP
rs1270122472 3534 dbSNP
rs1429110774 3539 dbSNP
rs1332919427 3545 dbSNP
rs1003550131 3547 dbSNP
rs1338406354 3547 dbSNP
rs969377183 3549 dbSNP
rs1380293888 3555 dbSNP
rs1005623869 3571 dbSNP
rs1023761588 3571 dbSNP
rs908586107 3571 dbSNP
rs887631795 3574 dbSNP
rs12317750 3575 dbSNP
rs1379970160 3577 dbSNP
rs74864215 3577 dbSNP
rs1277994035 3586 dbSNP
rs1440946646 3587 dbSNP
rs1357737467 3588 dbSNP
rs536538327 3589 dbSNP
rs897743550 3592 dbSNP
rs921117052 3593 dbSNP
rs975242244 3594 dbSNP
rs967927303 3596 dbSNP
rs915190598 3600 dbSNP
rs527817753 3615 dbSNP
rs1410596852 3637 dbSNP
rs1420224658 3640 dbSNP
rs561726980 3647 dbSNP
rs1407310200 3660 dbSNP
rs944415224 3662 dbSNP
rs1020001630 3667 dbSNP
rs541871351 3667 dbSNP
rs946488168 3676 dbSNP
rs1476770414 3679 dbSNP
rs1229745605 3690 dbSNP
rs1259390255 3694 dbSNP
rs914969712 3701 dbSNP
rs1034739831 3711 dbSNP
rs1003716528 3716 dbSNP
rs68032156 3723 dbSNP
rs78943068 3723 dbSNP
rs10649079 3724 dbSNP
rs202242919 3724 dbSNP
rs151328670 3726 dbSNP
rs1302440257 3727 dbSNP
rs1375463074 3728 dbSNP
rs1013119681 3731 dbSNP
rs1478688782 3734 dbSNP
rs1172816460 3737 dbSNP
rs1206089432 3743 dbSNP
rs1410845926 3749 dbSNP
rs767238165 3755 dbSNP
rs1424397785 3757 dbSNP
rs1307531373 3760 dbSNP
rs73273828 3761 dbSNP
rs1217362220 3764 dbSNP
rs563050215 3765 dbSNP
rs1329421717 3767 dbSNP
rs1337536879 3776 dbSNP
rs982355799 3779 dbSNP
rs1004183689 3783 dbSNP
rs1226774441 3788 dbSNP
rs1023620538 3790 dbSNP
rs1465149067 3797 dbSNP
rs887122584 3801 dbSNP
rs984096203 3802 dbSNP
rs1453244622 3809 dbSNP
rs1414488257 3810 dbSNP
rs1199040368 3818 dbSNP
rs1051165398 3826 dbSNP
rs1167519731 3827 dbSNP
rs1353867333 3828 dbSNP
rs1160857471 3831 dbSNP
rs1414688002 3842 dbSNP
rs934052687 3851 dbSNP
rs1163203933 3853 dbSNP
rs1389279673 3854 dbSNP
rs1389002327 3863 dbSNP
rs921389235 3865 dbSNP
rs1039506733 3878 dbSNP
rs554086716 3895 dbSNP
rs1353992861 3903 dbSNP
rs1290378848 3906 dbSNP
rs1168363699 3908 dbSNP
rs546332337 3912 dbSNP
rs1243871350 3915 dbSNP
rs897654726 3916 dbSNP
rs1419865017 3917 dbSNP
rs762890086 3934 dbSNP
rs1250449732 3937 dbSNP
rs1474755246 3941 dbSNP
rs139348870 3943 dbSNP
rs956369183 3957 dbSNP
rs927636704 3960 dbSNP
rs889008353 3962 dbSNP
rs557800942 3968 dbSNP
rs969531157 3971 dbSNP
rs753143686 3973 dbSNP
rs1337601318 3975 dbSNP
rs1274344186 3988 dbSNP
rs1459919224 4005 dbSNP
rs1233134324 4007 dbSNP
rs1164730485 4009 dbSNP
rs751167243 4018 dbSNP
rs1320262035 4019 dbSNP
rs1309488327 4022 dbSNP
rs1224570716 4030 dbSNP
rs765670711 4035 dbSNP
rs575623788 4041 dbSNP
rs893550845 4046 dbSNP
rs754132450 4048 dbSNP
rs1396686279 4049 dbSNP
rs1326461957 4052 dbSNP
rs1339464761 4053 dbSNP
rs1206752421 4068 dbSNP
rs752563921 4070 dbSNP
rs1013050893 4073 dbSNP
rs962880066 4077 dbSNP
rs369838672 4078 dbSNP
rs928143689 4079 dbSNP
rs982382097 4082 dbSNP
rs1184769926 4090 dbSNP
rs1017169751 4091 dbSNP
rs948301196 4097 dbSNP
rs1448202978 4105 dbSNP
rs1004891105 4110 dbSNP
rs1419309983 4115 dbSNP
rs1406715403 4117 dbSNP
rs150868156 4120 dbSNP
rs916804429 4124 dbSNP
rs1176305608 4128 dbSNP
rs887392584 4134 dbSNP
rs1476651187 4136 dbSNP
rs1469418567 4137 dbSNP
rs142414687 4139 dbSNP
rs1213594406 4140 dbSNP
rs766666072 4141 dbSNP
rs1230480127 4146 dbSNP
rs1295703220 4159 dbSNP
rs1311065548 4165 dbSNP
rs1051524570 4166 dbSNP
rs1207591751 4169 dbSNP
rs1026187634 4170 dbSNP
rs763519286 4173 dbSNP
rs998233675 4176 dbSNP
rs773365539 4177 dbSNP
rs1247765752 4180 dbSNP
rs1316609397 4180 dbSNP
rs972834337 4190 dbSNP
rs1420352368 4195 dbSNP
rs1432592860 4197 dbSNP
rs762446926 4198 dbSNP
rs1470423063 4199 dbSNP
rs1319686836 4202 dbSNP
rs899922982 4203 dbSNP
rs1236641343 4208 dbSNP
rs1371787845 4209 dbSNP
rs1289309679 4215 dbSNP
rs1302701508 4216 dbSNP
rs1366307521 4218 dbSNP
rs1039763871 4220 dbSNP
rs868756216 4221 dbSNP
rs556070890 4224 dbSNP
rs147300843 4230 dbSNP
rs377561532 4230 dbSNP
rs539330499 4230 dbSNP
rs1227376292 4238 dbSNP
rs1052337751 4250 dbSNP
rs555398438 4251 dbSNP
rs1290425683 4254 dbSNP
rs1243138505 4258 dbSNP
rs1454109782 4262 dbSNP
rs1011029971 4266 dbSNP
rs927931400 4272 dbSNP
rs1156430250 4273 dbSNP
rs1480914097 4274 dbSNP
rs1158656165 4282 dbSNP
rs1455233747 4293 dbSNP
rs1395185688 4300 dbSNP
rs1192385683 4302 dbSNP
rs1409495472 4309 dbSNP
rs1458565431 4313 dbSNP
rs879145337 4321 dbSNP
rs1431957264 4330 dbSNP
rs1349299463 4332 dbSNP
rs535483060 4335 dbSNP
rs1294828520 4336 dbSNP
rs867333935 4341 dbSNP
rs376818483 4347 dbSNP
rs556184685 4351 dbSNP
rs999267288 4351 dbSNP
rs916299941 4353 dbSNP
rs1225888510 4355 dbSNP
rs1213318111 4361 dbSNP
rs1285387931 4362 dbSNP
rs1322184492 4363 dbSNP
rs1348819899 4369 dbSNP
rs1219976804 4370 dbSNP
rs1294069113 4381 dbSNP
rs539590320 4385 dbSNP
rs1046612901 4386 dbSNP
rs373470681 4390 dbSNP
rs773353451 4392 dbSNP
rs1231087788 4393 dbSNP
rs962849306 4397 dbSNP
rs767744983 4406 dbSNP
rs1412776463 4409 dbSNP
rs1297634246 4412 dbSNP
rs982997369 4424 dbSNP
rs866380874 4430 dbSNP
rs1365660163 4431 dbSNP
rs1382614160 4432 dbSNP
rs1428474828 4433 dbSNP
rs1352019321 4435 dbSNP
rs759370296 4435 dbSNP
rs1296068514 4436 dbSNP
rs1442442141 4441 dbSNP
rs951707245 4453 dbSNP
rs1436236707 4457 dbSNP
rs1378838192 4460 dbSNP
rs1227112344 4463 dbSNP
rs1375610587 4476 dbSNP
rs916835693 4485 dbSNP
rs1048673669 4488 dbSNP
rs1171541950 4491 dbSNP
rs1439829626 4504 dbSNP
rs931338963 4510 dbSNP
rs918582776 4528 dbSNP
rs1185356288 4529 dbSNP
rs973252309 4530 dbSNP
rs1385848327 4531 dbSNP
rs761897546 4541 dbSNP
rs1166217062 4543 dbSNP
rs1410205970 4544 dbSNP
rs1333049484 4545 dbSNP
rs1194486750 4547 dbSNP
rs1358962991 4549 dbSNP
rs912613523 4554 dbSNP
rs987269519 4556 dbSNP
rs1261519869 4560 dbSNP
rs1228286105 4561 dbSNP
rs1295530885 4564 dbSNP
rs1279040170 4570 dbSNP
rs1029951178 4571 dbSNP
rs1190431747 4577 dbSNP
rs1486129716 4580 dbSNP
rs1341516328 4582 dbSNP
rs953213306 4585 dbSNP
rs547601102 4586 dbSNP
rs1010809150 4588 dbSNP
rs1028899263 4588 dbSNP
rs1205398983 4590 dbSNP
rs998556848 4591 dbSNP
rs899854756 4592 dbSNP
rs201198711 4594 dbSNP
rs1018287061 4600 dbSNP
rs1257062930 4608 dbSNP
rs752260311 4615 dbSNP
rs774873990 4615 dbSNP
rs191672841 4616 dbSNP
rs1030687129 4623 dbSNP
rs1253060633 4630 dbSNP
rs1470734742 4631 dbSNP
rs906291290 4633 dbSNP
rs999571110 4633 dbSNP
rs1435057337 4634 dbSNP
rs1317187492 4642 dbSNP
rs1046142642 4644 dbSNP
rs1328287161 4644 dbSNP
rs186835214 4645 dbSNP
rs1343184751 4648 dbSNP
rs772032033 4648 dbSNP
rs1276081757 4653 dbSNP
rs1052685255 4658 dbSNP
rs1263550671 4661 dbSNP
rs1328177458 4668 dbSNP
rs935213044 4679 dbSNP
rs906440802 4681 dbSNP
rs1416374601 4684 dbSNP
rs1046317517 4685 dbSNP
rs947672631 4688 dbSNP
rs368730294 4704 dbSNP
rs1244455637 4711 dbSNP
rs1481227843 4713 dbSNP
rs916267162 4716 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions SH-SY5Y
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Sox5 is a direct target of miR-132 and miR-15a/16 ...

- Huang S; Wang C; Yi Y; Sun X; Luo M; Zhou et al., 2015, Cancer letters.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAU--ACACGACGAu 5'
             | :||| ||  |  |||||| 
Target 5' --aAUGCCAGUAAUUCAGCUGCUa 3'
1 - 22
Article - Huang S; Wang C; Yi Y; Sun X; Luo M; Zhou et al.
- Cancer letters, 2015
Kruppel-like factors (KLFs) are zinc finger-containing transcription factors that play key roles in the regulation of differentiation and development as well as biological processes central to the development of malignancies. Increasing evidence indicates that Kruppel-like factor 9 (KLF9) plays a critical role in regulating tumorigenesis. However, the biological role and molecular mechanism of KLF9 in glioma progression remain unclear. Herein, we found that KLF9 expression was strongly reduced in gliomas. Reduced KLF9 expression promoted glioma cell proliferation. Importantly, re-constitution of KLF9 expression inhibited glioma cell proliferation and tumor growth in vivo. Furthermore, we determined that KLF9 interacted with the miR-21 promoter, leading to suppression of miR-21 expression and cell cycle arrest. Taken together, our findings indicate a novel mechanism for KLF function in tumorigenesis and may also suggest new targets for clinical intervention in human cancer.
LinkOut: [PMID: 25305446]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors 0.232 3.3e-2 0.262 1.8e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.39 3.3e-2 0.366 4.3e-2 23 Click to see details
GSE28544 Breast cancer -0.359 4.2e-2 -0.260 1.1e-1 24 Click to see details
GSE17498 Multiple myeloma 0.272 4.5e-2 0.213 9.3e-2 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.362 5.8e-2 0.177 2.3e-1 20 Click to see details
GSE17306 Multiple myeloma -0.217 6.7e-2 -0.341 8.2e-3 49 Click to see details
GSE21032 Prostate cancer 0.152 8.5e-2 0.161 7.3e-2 83 Click to see details
GSE38226 Liver fibrosis -0.259 1.3e-1 0.002 5.0e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.187 1.5e-1 0.372 1.8e-2 32 Click to see details
GSE27834 Pluripotent stem cells 0.26 1.7e-1 0.191 2.4e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.193 1.8e-1 -0.227 1.4e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.19 2.1e-1 0.143 2.7e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.084 2.3e-1 -0.038 3.7e-1 79 Click to see details
GSE19350 CNS germ cell tumors 0.232 2.3e-1 0.161 3.1e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.075 2.4e-1 0.077 2.4e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.137 2.6e-1 0.261 1.0e-1 25 Click to see details
GSE19536 Breast cancer 0.066 2.6e-1 -0.001 5.0e-1 100 Click to see details
GSE28260 Renal cortex and medulla -0.186 2.7e-1 -0.093 3.8e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.062 3.8e-1 -0.284 8.4e-2 25 Click to see details
GSE21849 B cell lymphoma 0.013 4.7e-1 0.337 3.7e-2 29 Click to see details
GSE21849 B cell lymphoma 0.013 4.7e-1 0.337 3.7e-2 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.71 0 -0.780 0 32 Click to see details
THCA -0.386 0 -0.431 0 59 Click to see details
PRAD -0.375 0 -0.394 0 50 Click to see details
HNSC -0.321 0.02 -0.382 0.01 42 Click to see details
KIRC -0.248 0.02 -0.275 0.01 68 Click to see details
BRCA 0.22 0.02 0.238 0.01 84 Click to see details
LIHC 0.273 0.03 0.127 0.19 49 Click to see details
CHOL -0.482 0.09 -0.417 0.13 9 Click to see details
BLCA -0.265 0.14 -0.290 0.12 18 Click to see details
KIRP 0.16 0.19 -0.004 0.49 32 Click to see details
UCEC 0.152 0.27 0.096 0.35 19 Click to see details
PCPG 0.488 0.34 0.500 0.33 3 Click to see details
PAAD 0.256 0.37 0.600 0.2 4 Click to see details
COAD -0.127 0.38 -0.286 0.25 8 Click to see details
LUSC 0.048 0.39 0.039 0.41 38 Click to see details
ESCA -0.085 0.4 0.027 0.47 11 Click to see details
KICH -0.039 0.43 -0.074 0.36 25 Click to see details
CESC -0.122 0.46 -0.500 0.33 3 Click to see details
LUAD 0.004 0.5 0.133 0.34 12 Click to see details
LUAD 0.004 0.5 0.133 0.34 12 Click to see details
LUAD 0.004 0.5 0.133 0.34 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2</