miRTarBase - #MIRT054362 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CUX1   
Synonyms CASP, CDP, CDP/Cut, CDP1, COY1, CUTL1, CUX, Clox, Cux/CDP, GOLIM6, Nbla10317, p100, p110, p200, p75
Description cut like homeobox 1
Transcript NM_181552   
Other Transcripts NM_181500 , NM_001913   
Expression
Putative miRNA Targets on CUX1
3'UTR of CUX1
(miRNA target sites are highlighted)
>CUX1|NM_181552|3'UTR
   1 GGGGCCGCGGCCCTGGGGCGGGCAGCCAGGCTGGGCCGCAAGGGCCTGGACGGGGTCGGACGGGGCAGGCGCTGCGGACA
  81 CCGTGGCCTGGGCTTGGCCCGCGGCCTGCACCGACCCCGGGCCGGACCTGAGCCCGCAGCCCAGACCCCCTCCACGGTCC
 161 GCGGCCTGCACCGACCCGAGGCCCAGATCCAAGGCCGCGGCCCAGACCCACTCTGCGGCCCGGGCCGACCCTGCGGCCTC
 241 CACCAACCCCGCGGCCCAGACCCAGCCCGCGGCCTGGACCCCTGGACCGCTTTGCGCACTTACCGCCCTGCGGGCCACAG
 321 GGCAAAATCGCCATAGGCCAAGGTGCATATAGAAAACAAAGGAGCATTAAGCCCAATCTATGTCGTGTTTTCAAGGAAGA
 401 AAACGGAAATGTGTGGTCGAGCTTTTTTGTACCCTGAAGTGTTTTTTTTATTGCCCTAAGTGATTTCCACAGGTTCTGGA
 481 ATAACTCTTACAGCTTTGCCTTGTGTCCTCCTGTTCCGTGTGGGCTTTAAAAGAAAAAAAATCAAACCCACATATTAAAA
 561 GGGGGCTTTTTATCTGCCATCTAATGGCTTCAGAGCGATAATACACTATTATCTTCTTAAACCAGGAAAAAATAAAAGGG
 641 GGGGTGGGATTTTTCAGAAAAATTAAAAAAGAAAGTTTTTGTAGCTGTTCAGTTGCCACTAAGAGATTGCACAGTCAAAA
 721 CGACTCTAAACACACTAGTTTGGATTCCTAAATATTTTCAAGAAAAGAATCTTCTCGTTTGAAACTTTGAATTAAAATAA
 801 AACACATTTACTCCACATATTTTTTAACAAAAAGAAAACGTCACATCAGGAAACTCTGATTTTGTGGTAGCTGACATAGT
 881 GTTTTCTTGTACGTGAATAGAATCCTGACATGTAGTGCACATTGATGTATAGCTTTAACTGACCCTGGGTTTTGCAGACC
 961 AGGGTTTGTTTAATACACTCCATTCTAGGCCAAATCAGGACAAAAAAAAGAAAAAAAAAGAAAAAAAAAAAAGAAAAGAT
1041 CCGAATCTAGGTATTTTATAATCTGCTTTTTAACCTCTAACCGCAGAGCACGCTGATCAGACCTCATATCTTGGAGGTTT
1121 AGGAGACAAGTTAGAACTGTAGCATGTACCTGTTAATTTTGTTTAATTTATGGTGTCTCAATCTGTCTGTGCGTCTGCAC
1201 GTGTGCAAGCATTGAAAGAAAGGAGAGAGTAGTCCGGGCGAGCACAGCAGGCAGTTCCAGGGCCAGACGGGCCCATCCCC
1281 AAGTAGATAGCAGTCTACGGATCTCTCTCTGGCACAGAAGGCACCTCACCTCACACCACTCTCCTGGATACCTGATGAAC
1361 TGAGCCCTCCCAGGGGAAGACACTCCCCAGGCCTGGGCAGGGCTTACACGCGCACTCTCTCTCTTCTTTCCCTTTTTCTT
1441 CCCACCGCAAGCACTGATGACCCTGTTGAACTCGTGGGAAACTTCCTTTCTCTGCAGGAGAGAGAACGTGGCATTCTGGG
1521 CTCCCCACTCCCATCCCTGTAGAAATGGCCCAAACTCACACCAAAACGTGGATGCTCTTCAACTTCCAAACCTACCATTT
1601 GCCCTTCTTTCATTTCGCCTCTTAGTTCTTTTTATGCACAGTTTTAGGGCAGTCTAAGTACAAACTGAAAGTCTAACTTG
1681 TCTCTGATTCCTCCCTTGTCTATGTGTATATGCGTGAGAATAGAGGCGGGTGAGAGTGTGCGTGCGTGTGCGTGTGTGCA
1761 ATTTTATACGTCTGTGTATTTTCTTAAGTACCTGTGCACACGTAGAGTGCATTACTGCCACCTTTTTCAATAAGCTGTTT
1841 TATCAGTTACGGCTTCTACAAGTTTGCTAATTTAGACTTCTTTATTGCCATATCTTTAAACTAACAATAGATGATTTCGG
1921 TATATATATATATTTTTTTTTGCTTATTTATAGGTGCTGTATTTTATTATCTGATTGTTAGGAAGGGATGAAAGGGGCAA
2001 ATATTCTTTAGAGGGATAGACTGCCGGCAGTATTGGGTATAATTTACAAGATGTAGTTGTCATACTGTATATTACTGATT
2081 GAAAACTTTTTGACCGTATTGTGTATCATTGAAACCTTTGTCTTAGGTCAACATCTTTGGATGACATTTTAATGGTGCAT
2161 TCATTATTTCTTAAGTTTAATTAATATTACTTTTTTTTTTATTTGGGGGGTGGGAGGGAGTTATAATTTTAAAGGTATGC
2241 TCTGGCTGTTCCACCTCCGTGTGCTTGTTAATTAACTTGTAGGACTTTGACTGTAAGATGTGAAACCACGTTTCTTGCAT
2321 GATGTTTTAGAGATTATTTCATTTACAGTCTTTTAACCTGCAGCTGCAGCACTTAGTTCACGTTTTCACAAATTTCAAGA
2401 GTCACTACACTAAAGACAATGCCTTTTCATGAATAAGAAGTTTTCAGAAGGCTCTAGGGGGCTGGGAGGCAGGCTGTTCG
2481 TTTGTCTTTTGTTGGGGGTATCATTTCTGAACTTGAAATCCAGTTCAGGGAGAAGAGAATTCAAAATTAGAGGAGCTTAA
2561 GGGGACACGGGTCAACATCTAGCTCGATTCAGGTGCATTGAGAAGAGTGAGTTCACATCGGTGACCCTTAGGACAGTGAG
2641 TGGCAGAGCCCTGACGACTGTGGTGTCCTCTCCACAAAACCCTCAAGGGACTTTTGTCATCATGTGTGATGAATCTTTAA
2721 ATATCGTCTAATTTTCATAAGAATGAAAAGAAGTTAACAGGAAATAGTAGGCTAGGGTTTAGTTTTAAAGGCATGACTGT
2801 TATTTACAAAGGTGTTAAATCTGAGGAAATTGACAAATACAGATTTGTCCATTCTAGTGGCCAAACAGTAACAGTCTAAA
2881 ATGCAGTCATTTTGACCCTCCCAAGCAATTTAGTCATATGTGTTGTTTTCTCTTTTCTGTTTTTACTTCTTAGATTTTTA
2961 ACTAGGTTACTGTTGGTTCCCATTCTGTCTTTTTTGCCAGACTTACATCTGGTGCCAGATACAATCAGTTGGTTAAATTT
3041 TGCTTGCAGTTCTGTGTATTTTTTTTCCTCTATTATTTATTTTTTTAAAAAAAATAGAGATCCTAACCTTAGATCTTTGA
3121 TGTGAAGCTAGCACTGTCTGTAATACTTCTAAGAGCTGCCACTAAAATAATACAGCAATCCGTGGCCAGGGGAGCACCCC
3201 CTCCTGGTTGGGCCCCTCAGTTGGAGTCTAAGGGTTAATCTCTCATCTTGCTAAGCAGTATTCAAGTGCCTTGAACAGTG
3281 TCCCCTCGGCATGGCTCCCCTTCAGCAGGCTGGCATTCCAAGCAGTGGCCCCCGCAGGCAGCCGACCCCCTTCCTCTTCA
3361 CGCTCTATGAGTTTAAAAAGCTGATTTGTACCTCTCCCCTGGGGGAAACGGTTCCATATAAAACACTAACACTTAATTAC
3441 AAGCTCCATTATGCCATTTTAAATGGCTTCTTTTTGTTAATTGGAGGCATTGTTCATAACTTAAGGCTTTTGCCATTAAC
3521 TTAGCTGGCTAAGCAGAGGCTCGGGGTAAAATCAGTGTTTGCATTTAGCCTCTTGACCCGGAGTTCCGGCCCAAGCTCCC
3601 TTGTGATAGCCGAGATGGCAGGTGTGTGAGTTCTGTCCTAGACCTGTGCCCAACTCACTTCCACCCCAGAGGAGTCTTCT
3681 GTCCTCCTCCCCAACCCCCGAGCTCCCTGGTAACCTCCTCTTGAACTTCTGTATCAGTGAAGACATCTGTGGTTTCTGCT
3761 CACCAGACCTCTCTTTAGAAAGGGTTATCAGAGCCATGGAGCTTAGCTCAATTGGATTCTTCTAGACGATCTTAGGAGGC
3841 ATCTTGGCATGAGGCAGCTTCTAAGCGTCTCCTGGGACAGGATTGGGGTGACAGCCCAGGGATGCATGCATGGGAGAACT
3921 CTCTGAGAAATGCCAGGATCGTGGCTCACAGGGACCCACCATCAAAACCTGCTACTTTGTGCAAGTAATTGAGGCAAAAG
4001 ATACCAGTCGACAGCCTCCCTGGGGTAGATCCCTTGTACCTCCAAAGTACAAATACCTCCCTGCTCAGTTTCCTTCCTGT
4081 CGCCATCTTTGTTTTCTTCCCATTGAAAAACCATCCTGTCTGATGTGGACGTTCAGGTCTGCTGGTTGGCGGTCCGGGCC
4161 CAGAGTGCAGCAGAGCTCTGGGTTAAATATTCCTTTCTGGCCACCGCCCAAGCCCAGGTGGCCAGCTCTCATACCCCATC
4241 TCCCTCCTTGGCCAGGGCCAGCATCAGGCGTGCAGCTCATGACCAGTTTACACAGGCTGCAAAGAGATCGCTGTGGGCCT
4321 CGGCTGACTACTTTAAGATTATGCCACAGCCAGGCCCTAAAAAGAGAGGGGAACAGGAGTCCCCAGGTGAGCTCTCTGAC
4401 GGGCAGGTGCCTTCCCGACTAAGGTTGGACTGGATGACTTTGTTCCTCCTGCATGCATGTCCTTTGATGCAAGGGTGATC
4481 AATGAACTCTGTTGACATTCTATGCAATGTTTTTCATTCCTCTGATTTTAGCAAAGCAAATCTTACTGAAAAATAGCAGA
4561 GCCAGGGGAACAGACGCATGTCCTTCTGGGAGTCACACAAAAGCAGAGAGATTTTGAACTGAGGGGCGACAGCCTTTGCC
4641 TTAAATGCAGTATGACAGGCGCTTCTTGGCAGACCAGTAAAAACAAAAGCCCATAGACCTTACTCATCCCAAGGCCGACA
4721 AGCCAGCTGTACAGGGCGAGATGTAGCAACACGGGGCATGAGCGGTGGGCGTGCTGGGCTATTTGCTGTGGTACTTTAGG
4801 CTGGAGGTTTGGCTCCTGTGCTGCCGGTGGGGGGCCCTGTCCCTCCCCAGATGTCCTCCCTCTTCTTCACACTCCTCATT
4881 GTCCCTTCTACCTCACTAACCTGTCTTCTCCATCTGATGTCACCCAGAACCACACCCCACAGAACTGTGAGGCACGTGGG
4961 CTGGAGAGAGCAGAAAAGCTGCCAGCGCAGCAGACACGAACATCCCTCTGCCTGGTGGGCCGGCTTTGTGTGTCTCTCCT
5041 TTTGTGAGCGCAACACGGACAAACAGCTGTGCTCTGCAAGGCACACGGATGTTTCCCTTCCACCTGTTCCCAAAGCTCCA
5121 GCAGCTGTTTCTTTTGCAGGCAGGGCGTGGTCTCGGGGCTCCGAGGGTCTTGTCTTTGGTCCGCCTTCCTTTCTGTCCAG
5201 TCCTGCTCAGCTGTTAAGATCCATCATGGCCATTATCCTTGTCCCGGACTGCCCCAAAGTTCCCAGCTGGCTTTGGGGAA
5281 CACTGTAGCTCTTGGGTGTCTCTTGTCTCTGGCATGGTTTTAGCGTCACTGCGAACACTCCTTTGCAAACATCAAACATC
5361 TCAAAGACGGAAAAGGATAGATGGCTTCCTCCAGCCTACACGCCCCGTCCACAGTGGCATCACCCTCTTATCCCAAAAGA
5441 ATATGCCAGTTCCCATCCAGCACCGAAGAAAATCAGCTCCTGGGGCTGGTGGTTGGAGGTGGGTCTGTCCACTGTGGGGG
5521 CCAAAGTGTTCCCCTGCTGGAGACAGTTTGCAAGTAAGAACCTAAGGATGGGGACAGCATCCTGTGCTTGGGCATTGACC
5601 AGCCAAAGCTCACATTTAGAAAGCCCTCAGTGCTTCTGTGGTTTCACCTGGGCATCGACGACATTAGGGAAGCCTTTGTG
5681 ACCACAAGGGCAGGGCTTGTGCCCTGAGTGGCGAGGTGGTGACCTGAGGCCAGTGTGATGTGGTTGGATCTCAGCGTGTA
5761 CTGAATGCCAGTCTGGCCGGCACACTCGAACGCTAAGAGAATGGTCCAATTTGATGATCTTATTTCTATTTCGATCAGGT
5841 TTTGACTTTTTGTAGATGAAAACTACCAGGGAAAAGGGGAAGCAGGTACCCAATAAAGTTTAGAAAGATCCAGTCTGTGA
5921 AACCCTTAGAGATGGGCTGAAAGTTAAGTCCACCAACCCTTGGGCTTAATCAGGACGGAAGAGGAGGGGGTGTGGGGGGC
6001 AGAGCGTAAAACAAGCCCCAGCCCTACTCCCGGCCCCCCAGCCCAGTCTTCCCAATCCCAGAGGCCCCGGCGGCCTGTGC
6081 TCCTCACCACCCTGGTCAGGGGAATAGAAGGAAATGCAATTTCCGCCTGTCTGCCCGACTTCCAAAAACTGCCTCCTCCT
6161 GCCCAGGCCTCTCCCACCACCACCTTCCCTCCAAAGATAACCGTGTCCATGCCATCCGTGGCATCATCTCGAGTTTTCAT
6241 TTTTGGATGAAGTGACATTTAGCTTTAACAAGACATTTCCAAAGCGCCTAGTCTCCTCCAAAATGCTAACTTTAAAAGTT
6321 GGGCATTGTAGGCGAAAAATCCCAAAAAAAAAAAAAGACAAAAAAAAAAGGCTGGCGAGAGAAAGACATTTGGCTATGCA
6401 TAAATGTGCACTTCCCCCATGCCCCCGTTCTTAAACTCTTAAGATGCCTTTGAGTTGCTTTTCATGAATCCTTTTAGTTT
6481 ACCCGATAATGTTAAGAAAGCATTAGTCTACGTTACTGTAATTTCTGTAGTGTTTACGCTTTAATTTCTACCACAAAATA
6561 TGCTATATGCTATGTATCAAGCTTTCTGTAATCAGAAAGAAAAGGTGCCTTATATCCCAATGTCACGGCTACATCCCTAT
6641 GGAAATTAATCAGAAGCACAGTGTGTACGGAAGCATTGGGACTTCTGCTGGTGAAACAAGAGACCATTCAGCAAGACACA
6721 TTGAAGTGGCACGGAGCTGCTTTTGTTTTATAATTCTTTTTTCCCCCCTTTTCCTTCTTCTTTTTTATTATTTTATTATT
6801 TTTTTTGTACTTTGCTTTAAACGGAAAGCACTTAAATAGATGACTATGTGTAAAAGCTCTGTGCAATTGAAATCATTTTT
6881 CTTCATTTTAAAAAAATAACGTATTGCACACCAAATGAACTCAAAGTAAGCTTTAGACCAGGACGATTCAGGTTATGAAT
6961 GAGTTTGTTCACTGTAGTTCCGTTTGTTCATGAACCGAAGGGAAAACAGGCCTCCCCGACTCCCTCCAGTCTCCCAGCCT
7041 GCCTCTTGGTGACCACTGTGCTGGGCGTGCAGGGCCCGCGGGCTCTGGCCGGAGCCGCTGGCCTGACGAGGCAGGATAGG
7121 GAGTATCCGTGATTCAGAAGCTGAGACCCTTCCCCAGTGTCTGAGGCCACAGCCATCCCTTCCAGCACTTAATCTTGTCT
7201 TGTTGAAATGGACTGACTGCTACTGACCTGCCGGCGTGCGTGAGGGTGATTATAAAAGGATGTTTCCTTGAGAAAAAAAA
7281 AATTATTTCTATCCTCTTCTATTTATTATTAGGTTAATCATTTAAGTACTTATCAGGAGTGTATTGTTATTTTGTGTTTT
7361 GTTGTCATAAATGCTTTTTGCTGTCACTCTAGTGGTTACTATCCTCTGCCTTCCTCTCCTCCCCTACTCCCCCAGAGAAC
7441 CAAGGCGTCTGGGGGATTGACTGGGGGGCAGAGGGGGTTTCCCCAGCAAAATCAAACACCTGTCTCCAGAGTAGCCACTC
7521 AAAAACTGGTGGTCTCTATGTGTCTAACTTTTTAAATGAGAGTGTTTATGAACAAAAAAATTTACCAACGTGTGAGGGAG
7601 TTGCTGAGTTGAAGAATGCTCGCTTGAGGAGCTTCAGAGGAATCTTAGCAAAGCCAAGTTCAGTTCCCCAAAGCCTCCTA
7681 GAGCCTCTGGTAAGACTTCTGGGTTCATGAAGTTTCGGCGAGCCGTGGTCAGAGAGGGCGCGGTGGCCTGGCCAAGACTT
7761 TACCTCCAAGCGAGAGAGTGATTTCTTGCAAGGCCCGCATGGGTTGATACGTTTTGGTTGGTTTTTTGTTGTTGTTTTTC
7841 TTGCGTACAAAGTTGGTCAAAACCATCTTTCAAAGCAACAGTGTTTTGTAGTACCAGGCTGTGGCTTGAGGGCTCACCTA
7921 GGAGATCATAGGCAGAGGGCCCCTTTCCCCTATAGGTGGTTCAACGTGGAGGAAGGTTGGGTGTGGAGATTGCTTGCTGT
8001 GGCCCCAAGCTCAGCCAGCAGGACACCCAGTTGTTGCCAATCAGGTGTGAAGGTGAGGCGCCCTGCCTTGATCCCATGGG
8081 CCCAGCAGAAGGAAACTTACCCCAGGCCAAGGCAAGGGCCCTGCTCACCCCAAGGTAGGCTGGGAAGAGCATCTCTTTCC
8161 ATATCATCACCTCCCCTTCTCCAAGATTGCCGGGGGCCCTGATTTTGTTCTCTCTTTGAAAGAAACCCTCCACCGAAACA
8241 ATGGTCCCCATCTCCCCAGAAGCCTTTTTTTTTTTCATTTTTCTCTAATTAGTCTATGCATTTCTCTCTCTCAAACCATC
8321 TTCTGCCTCTTCCCTTGAGAAAACGGGCATCTCACGTACCCCCATCTGAGACCTCTTGGAAAAAAAAAATCCCGTGTATT
8401 CTGGAGATGTGAGAATTCACCCAAAATTCTTAAAACATTGGAGAATAGCTTGTTATAAAATAAAAGTGGGGGTAAAAAGA
8481 AGGTGGTTTTCCCCACATCCCTTTGCATTGAATAAGAGACCTAGTTCTTTGCGTTTGTGCAATAACTCTTTGCTGCTTGC
8561 CTTGAGAGCGGGTAGCACCACGCTCCTGTCCAGACTACTAACAGCACAAGACGCACTCACAGGGTGGCGGAATCTTCCGG
8641 AAAACTCTCTATAAGCTCAGCTCCCCCCACCCCACCCCCACTCTAGCGTTTTGTCACGTCTTACATTTTAGCAGTATTTT
8721 ATATTTTCTGTAACGCACCAAGTCTTAGATCTTTCTAGAGCTTGTTTGTTCATCCTCACAATCACAGATTTTTTTCTCCA
8801 ATCCTCACAGAGACCCAATTGACCAAAAAAGAAAAAAGGAAAAAAAAAAAGTCGTCTTTTTTTTTTTTTTTTGTACAAAT
8881 CGCTTTGAGATGCCTCTGGTGTGTTGCTGTGTGACATCTCTCTGGTAACATTTTATTTCTTGCTATTTGTTTTTCTACAT
8961 TAAGAGTCAAAGTTGACCTGGCTGGCGTGGGGGTGGGGGAGGCACCCGTCGGCCCCTTGGTGTTGTCCCTCTGTCTTTGG
9041 TTAGCCATACGATGTTTGTTCTCAGCACTGTACAACGGTCCCTATATAATACGGAGAAGCAATATCACTGTATGAGACTC
9121 ACACCATGTATTATTATTCACTAGCACCCTAGGTGTGATAATTGAAGTAAATATCTTTTATACAAACACAAAAAAAAAAA
9201 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG--UGUGAGGu 5'
            |:|::|| || |  ||||||| 
Target 5' ttAGCGTCACTG-CGAACACTCCt 3'
5320 - 5342 157.00 -17.50
2
miRNA  3' guuUGUGGU----AACA----GUGUGAGGu 5'
             | ||||    ||||    :||||||| 
Target 5' tgcAGACCAGGGTTTGTTTAATACACTCCa 3'
953 - 982 155.00 -18.90
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              | :| |  ||||||||| 
Target 5' cctcCCTCTTCTTCACACTCCt 3'
4855 - 4876 154.00 -14.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30100793 9 COSMIC
COSN30738240 40 COSMIC
COSN30528464 79 COSMIC
COSN9817513 104 COSMIC
COSN31540422 254 COSMIC
COSN31513357 272 COSMIC
COSN26565404 273 COSMIC
COSN29643451 290 COSMIC
COSN7649558 296 COSMIC
COSN26568428 336 COSMIC
COSN31523063 345 COSMIC
COSN26553160 397 COSMIC
COSN26585812 412 COSMIC
COSN31570682 426 COSMIC
COSN31595314 472 COSMIC
COSN23372027 534 COSMIC
COSN6341275 727 COSMIC
COSN16863339 775 COSMIC
COSN30175781 964 COSMIC
COSN28667020 1011 COSMIC
COSN29459359 1022 COSMIC
COSN19330243 1044 COSMIC
COSN22755687 1365 COSMIC
COSN17790331 1933 COSMIC
COSN32062849 2395 COSMIC
COSN4930072 2716 COSMIC
COSN16196953 3830 COSMIC
COSN5093310 4117 COSMIC
COSN14673534 4206 COSMIC
COSN4959689 4401 COSMIC
COSN27013369 4754 COSMIC
COSN17484645 5040 COSMIC
COSN7917712 5045 COSMIC
COSN28201659 5361 COSMIC
COSN4930073 5852 COSMIC
COSN25068173 6298 COSMIC
COSN20224290 6443 COSMIC
COSN6341276 6644 COSMIC
COSN21208558 6901 COSMIC
COSN16893301 7282 COSMIC
COSN29661372 7283 COSMIC
COSN15002140 7740 COSMIC
COSN27232089 7787 COSMIC
COSN24374654 8194 COSMIC
COSN22714490 8307 COSMIC
COSN26418000 8631 COSMIC
COSN23036955 8832 COSMIC
COSN28914041 8873 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782394004 5 dbSNP
rs368214 7 dbSNP
rs367876959 9 dbSNP
rs782799166 10 dbSNP
rs781944108 11 dbSNP
rs782052355 13 dbSNP
rs782767283 15 dbSNP
rs782495933 16 dbSNP
rs781828674 17 dbSNP
rs782526764 21 dbSNP
rs1395803559 22 dbSNP
rs1164836844 23 dbSNP
rs782802560 27 dbSNP
rs781911660 29 dbSNP
rs1366260687 30 dbSNP
rs782679315 33 dbSNP
rs1194868768 38 dbSNP
rs782440827 39 dbSNP
rs1186388621 43 dbSNP
rs1469677510 48 dbSNP
rs782580452 53 dbSNP
rs1213008263 57 dbSNP
rs1354320761 59 dbSNP
rs1253215467 62 dbSNP
rs1228398963 64 dbSNP
rs1326024767 71 dbSNP
rs1295715460 72 dbSNP
rs544951522 76 dbSNP
rs1372193745 77 dbSNP
rs1325806350 80 dbSNP
rs1404161027 82 dbSNP
rs1387907961 83 dbSNP
rs560164117 84 dbSNP
rs1462075019 86 dbSNP
rs1372105037 91 dbSNP
rs1166337889 92 dbSNP
rs1455376471 94 dbSNP
rs1253457705 97 dbSNP
rs1192930024 101 dbSNP
rs376518875 103 dbSNP
rs1196413128 104 dbSNP
rs1338828634 108 dbSNP
rs1272677351 111 dbSNP
rs1236839051 112 dbSNP
rs1303177060 114 dbSNP
rs1434922196 118 dbSNP
rs1338005996 123 dbSNP
rs1330187196 124 dbSNP
rs868961356 125 dbSNP
rs112726409 131 dbSNP
rs1166318990 133 dbSNP
rs1436272561 136 dbSNP
rs1395423385 137 dbSNP
rs1476936777 145 dbSNP
rs1365398258 155 dbSNP
rs1182453795 156 dbSNP
rs542950324 157 dbSNP
rs1213243274 161 dbSNP
rs1486147812 163 dbSNP
rs1279911444 164 dbSNP
rs1217797615 172 dbSNP
rs1353298079 174 dbSNP
rs1239034344 178 dbSNP
rs1349335298 180 dbSNP
rs1305684213 184 dbSNP
rs1416221525 197 dbSNP
rs868947318 198 dbSNP
rs868954303 199 dbSNP
rs1412484487 200 dbSNP
rs1386936532 201 dbSNP
rs1159068404 208 dbSNP
rs561513102 212 dbSNP
rs1409816989 213 dbSNP
rs1190100617 214 dbSNP
rs1475596991 215 dbSNP
rs1256999502 217 dbSNP
rs1208304335 219 dbSNP
rs1285477220 223 dbSNP
rs781812303 231 dbSNP
rs1295686579 233 dbSNP
rs142248299 234 dbSNP
rs550365897 237 dbSNP
rs1283223759 239 dbSNP
rs1445441188 248 dbSNP
rs1346710401 249 dbSNP
rs1003219194 251 dbSNP
rs1456524907 252 dbSNP
rs1386316571 254 dbSNP
rs1167017353 257 dbSNP
rs1054842370 262 dbSNP
rs1413243285 264 dbSNP
rs1180333376 269 dbSNP
rs894916595 270 dbSNP
rs1011128213 271 dbSNP
rs1243034479 274 dbSNP
rs1188273062 277 dbSNP
rs1463825518 280 dbSNP
rs1275533163 281 dbSNP
rs1214923566 283 dbSNP
rs1334910752 283 dbSNP
rs1288571199 286 dbSNP
rs1226234883 288 dbSNP
rs1363570019 289 dbSNP
rs372845751 296 dbSNP
rs1434006203 300 dbSNP
rs1362791817 303 dbSNP
rs1327828527 305 dbSNP
rs564788727 307 dbSNP
rs1441631668 308 dbSNP
rs966971259 312 dbSNP
rs1349342260 344 dbSNP
rs1162831164 351 dbSNP
rs1411753375 353 dbSNP
rs1420410681 354 dbSNP
rs1168211826 358 dbSNP
rs1448030189 361 dbSNP
rs999448915 366 dbSNP
rs1255357897 375 dbSNP
rs1194766674 376 dbSNP
rs377061966 383 dbSNP
rs1488465943 385 dbSNP
rs532237620 387 dbSNP
rs1245504381 388 dbSNP
rs955333355 393 dbSNP
rs1218685723 398 dbSNP
rs1308756522 404 dbSNP
rs1227292517 405 dbSNP
rs1339805149 405 dbSNP
rs748448045 405 dbSNP
rs1305405981 406 dbSNP
rs1441518170 408 dbSNP
rs1366762159 410 dbSNP
rs1291747632 412 dbSNP
rs1444393239 413 dbSNP
rs1355244756 417 dbSNP
rs1307651248 418 dbSNP
rs1428102783 419 dbSNP
rs1397241753 422 dbSNP
rs1174599642 423 dbSNP
rs1432996678 438 dbSNP
rs985442247 439 dbSNP
rs1179479561 442 dbSNP
rs1481323159 445 dbSNP
rs1251995733 446 dbSNP
rs1203962339 450 dbSNP
rs1481897404 450 dbSNP
rs1282051663 460 dbSNP
rs1233653936 461 dbSNP
rs1311402104 462 dbSNP
rs1299085298 481 dbSNP
rs782522480 485 dbSNP
rs1225460599 491 dbSNP
rs1374107914 492 dbSNP
rs1287860369 494 dbSNP
rs1408098858 501 dbSNP
rs911276404 502 dbSNP
rs367634 512 dbSNP
rs1313718196 534 dbSNP
rs1465807809 542 dbSNP
rs974585335 543 dbSNP
rs1357848715 548 dbSNP
rs1161915178 573 dbSNP
rs1420249639 575 dbSNP
rs1412036676 583 dbSNP
rs565712429 595 dbSNP
rs1471342925 596 dbSNP
rs1259100909 597 dbSNP
rs1200733385 599 dbSNP
rs930170582 601 dbSNP
rs1482802054 602 dbSNP
rs1254068634 606 dbSNP
rs1045980853 609 dbSNP
rs564258693 624 dbSNP
rs1329716680 630 dbSNP
rs1287679259 634 dbSNP
rs1226577293 638 dbSNP
rs1357463286 638 dbSNP
rs928875268 640 dbSNP
rs938976407 641 dbSNP
rs1395736680 642 dbSNP
rs1377396477 645 dbSNP
rs1291050470 646 dbSNP
rs190652534 659 dbSNP
rs1054809163 664 dbSNP
rs1157597036 665 dbSNP
rs112770956 666 dbSNP
rs1187774692 668 dbSNP
rs1422929525 670 dbSNP
rs1253664955 678 dbSNP
rs1010639009 688 dbSNP
rs1043908165 689 dbSNP
rs115098678 693 dbSNP
rs536802593 700 dbSNP
rs1206811555 702 dbSNP
rs1029508653 713 dbSNP
rs1266155505 718 dbSNP
rs782682326 735 dbSNP
rs1320092010 744 dbSNP
rs1298039918 745 dbSNP
rs1436191031 749 dbSNP
rs1364943447 751 dbSNP
rs955302667 761 dbSNP
rs34445497 762 dbSNP
rs1006789554 764 dbSNP
rs1319123893 768 dbSNP
rs1018211584 772 dbSNP
rs1396004240 777 dbSNP
rs558718467 778 dbSNP
rs963072393 785 dbSNP
rs782275416 789 dbSNP
rs1366278814 793 dbSNP
rs141855041 798 dbSNP
rs1247261766 799 dbSNP
rs1449835016 799 dbSNP
rs1186565853 804 dbSNP
rs1469809439 812 dbSNP
rs538791269 813 dbSNP
rs1267998572 814 dbSNP
rs981626469 818 dbSNP
rs1209274973 821 dbSNP
rs1354341627 832 dbSNP
rs928844280 849 dbSNP
rs571504547 854 dbSNP
rs778263260 858 dbSNP
rs1341856690 865 dbSNP
rs937564709 866 dbSNP
rs880001006 870 dbSNP
rs916248620 873 dbSNP
rs946410949 877 dbSNP
rs1332137042 879 dbSNP
rs550013040 881 dbSNP
rs1323477352 888 dbSNP
rs1043451629 893 dbSNP
rs902276653 894 dbSNP
rs1388019130 913 dbSNP
rs1309473544 919 dbSNP
rs1430049873 922 dbSNP
rs935147955 923 dbSNP
rs1050869664 924 dbSNP
rs890980432 930 dbSNP
rs1455446258 931 dbSNP
rs1006758449 936 dbSNP
rs1018180536 956 dbSNP
rs1198095154 961 dbSNP
rs898461409 962 dbSNP
rs1449926748 964 dbSNP
rs553737023 979 dbSNP
rs1252799658 987 dbSNP
rs572138438 990 dbSNP
rs1272792009 1001 dbSNP
rs562568348 1001 dbSNP
rs782312871 1001 dbSNP
rs1213379983 1002 dbSNP
rs1274760943 1002 dbSNP
rs782065044 1002 dbSNP
rs781788463 1003 dbSNP
rs1025704161 1004 dbSNP
rs1289737032 1006 dbSNP
rs1171896359 1011 dbSNP
rs1182939072 1011 dbSNP
rs1305803586 1011 dbSNP
rs1365486864 1011 dbSNP
rs1369514163 1011 dbSNP
rs1402722348 1011 dbSNP
rs1409932749 1011 dbSNP
rs1415903024 1011 dbSNP
rs1472305624 1011 dbSNP
rs1477027453 1011 dbSNP
rs1249814721 1012 dbSNP
rs1190402159 1016 dbSNP
rs1443346124 1018 dbSNP
rs1278413231 1019 dbSNP
rs374178441 1020 dbSNP
rs951559915 1020 dbSNP
rs1269360120 1021 dbSNP
rs1286058204 1021 dbSNP
rs1333204089 1021 dbSNP
rs1340819436 1021 dbSNP
rs1449865786 1021 dbSNP
rs201841256 1021 dbSNP
rs556237321 1021 dbSNP
rs868980366 1022 dbSNP
rs542635630 1026 dbSNP
rs1159826213 1028 dbSNP
rs1409933174 1029 dbSNP
rs1456759475 1029 dbSNP
rs1183787852 1030 dbSNP
rs1473278693 1031 dbSNP
rs1237144998 1032 dbSNP
rs1035843648 1039 dbSNP
rs1185822501 1044 dbSNP
rs1449102357 1046 dbSNP
rs1249127313 1052 dbSNP
rs1208715638 1057 dbSNP
rs1327862929 1062 dbSNP
rs1265746888 1063 dbSNP
rs375803091 1067 dbSNP
rs1229557852 1071 dbSNP
rs1356561762 1075 dbSNP
rs1283239220 1079 dbSNP
rs1445461997 1080 dbSNP
rs1367163938 1083 dbSNP
rs771577355 1084 dbSNP
rs991734286 1092 dbSNP
rs1434330903 1095 dbSNP
rs1386517698 1110 dbSNP
rs1166943479 1111 dbSNP
rs1406058548 1113 dbSNP
rs1413260142 1118 dbSNP
rs1161697294 1144 dbSNP
rs1451709200 1147 dbSNP
rs1391244826 1156 dbSNP
rs1188453145 1157 dbSNP
rs1463893781 1162 dbSNP
rs116434957 1171 dbSNP
rs782284754 1182 dbSNP
rs946366059 1182 dbSNP
rs1288684673 1184 dbSNP
rs782341671 1188 dbSNP
rs979519006 1193 dbSNP
rs1227423219 1194 dbSNP
rs923657407 1201 dbSNP
rs935061715 1202 dbSNP
rs1295224035 1210 dbSNP
rs781936614 1212 dbSNP
rs1050839587 1213 dbSNP
rs1349434353 1224 dbSNP
rs890949779 1230 dbSNP
rs1321828479 1231 dbSNP
rs942544600 1235 dbSNP
rs1168307143 1236 dbSNP
rs1039583326 1237 dbSNP
rs1427794748 1240 dbSNP
rs576684859 1241 dbSNP
rs995492375 1244 dbSNP
rs1026053112 1247 dbSNP
rs112162868 1260 dbSNP
rs543606728 1261 dbSNP
rs887139632 1264 dbSNP
rs1219770208 1267 dbSNP
rs1002957473 1272 dbSNP
rs1483805127 1276 dbSNP
rs1274950168 1279 dbSNP
rs1204097759 1280 dbSNP
rs1339820278 1283 dbSNP
rs1303307422 1289 dbSNP
rs1035812515 1298 dbSNP
rs1219812793 1300 dbSNP
rs1273208324 1311 dbSNP
rs181948323 1313 dbSNP
rs1371323551 1316 dbSNP
rs530018231 1316 dbSNP
rs1428200578 1318 dbSNP
rs782412431 1322 dbSNP
rs56104629 1325 dbSNP
rs547541310 1326 dbSNP
rs1423710748 1331 dbSNP
rs374579185 1339 dbSNP
rs1473290301 1344 dbSNP
rs760290868 1348 dbSNP
rs1181090490 1352 dbSNP
rs1479535287 1356 dbSNP
rs1257587490 1367 dbSNP
rs977723593 1368 dbSNP
rs782753628 1370 dbSNP
rs1261179636 1392 dbSNP
rs1311491196 1392 dbSNP
rs559511725 1394 dbSNP
rs986478889 1403 dbSNP
rs1351241770 1404 dbSNP
rs1287958694 1408 dbSNP
rs1408276007 1410 dbSNP
rs1381767329 1411 dbSNP
rs912314261 1412 dbSNP
rs1465883971 1413 dbSNP
rs1162020004 1415 dbSNP
rs1357867449 1415 dbSNP
rs1458346154 1415 dbSNP
rs1412157303 1419 dbSNP
rs1157921469 1420 dbSNP
rs1416991883 1422 dbSNP
rs1182160187 1424 dbSNP
rs942513519 1424 dbSNP
rs1482811294 1426 dbSNP
rs1210583429 1427 dbSNP
rs1329897503 1433 dbSNP
rs1039956643 1439 dbSNP
rs529678331 1447 dbSNP
rs868969732 1448 dbSNP
rs1323687854 1449 dbSNP
rs80122201 1450 dbSNP
rs1395750560 1452 dbSNP
rs1381115944 1469 dbSNP
rs931206633 1473 dbSNP
rs1436519846 1474 dbSNP
rs1047015134 1475 dbSNP
rs560769903 1483 dbSNP
rs566619586 1486 dbSNP
rs1002884177 1487 dbSNP
rs1057201602 1497 dbSNP
rs1319246253 1498 dbSNP
rs894584857 1501 dbSNP
rs1369777112 1507 dbSNP
rs1165110282 1508 dbSNP
rs1423020077 1509 dbSNP
rs781833798 1516 dbSNP
rs1383195531 1523 dbSNP
rs1190408449 1535 dbSNP
rs1465252633 1540 dbSNP
rs782073275 1546 dbSNP
rs782706528 1552 dbSNP
rs1203399033 1555 dbSNP
rs1489515087 1556 dbSNP
rs1266249372 1563 dbSNP
rs1244425295 1566 dbSNP
rs1357708375 1577 dbSNP
rs1300330556 1578 dbSNP
rs1229635422 1590 dbSNP
rs1365055516 1594 dbSNP
rs147121436 1597 dbSNP
rs1380011248 1602 dbSNP
rs1392335304 1603 dbSNP
rs1293719059 1604 dbSNP
rs1457136451 1607 dbSNP
rs1363353647 1617 dbSNP
rs527935026 1618 dbSNP
rs1389419108 1620 dbSNP
rs1191008025 1622 dbSNP
rs1022190886 1635 dbSNP
rs1268199747 1655 dbSNP
rs1434977664 1655 dbSNP
rs781904203 1656 dbSNP
rs1489907710 1662 dbSNP
rs999504095 1666 dbSNP
rs552079418 1669 dbSNP
rs1277080518 1678 dbSNP
rs1206239290 1683 dbSNP
rs1341966084 1703 dbSNP
rs1268926228 1705 dbSNP
rs768262692 1712 dbSNP
rs782550409 1714 dbSNP
rs531328610 1715 dbSNP
rs1343179385 1721 dbSNP
rs1309490291 1723 dbSNP
rs782642119 1728 dbSNP
rs1395591339 1729 dbSNP
rs1166057634 1731 dbSNP
rs1467570414 1732 dbSNP
rs956334025 1735 dbSNP
rs1198204421 1736 dbSNP
rs1254225794 1736 dbSNP
rs201404840 1736 dbSNP
rs1183246577 1738 dbSNP
rs1482913213 1738 dbSNP
rs986447850 1739 dbSNP
rs1202570644 1742 dbSNP
rs1346278067 1742 dbSNP
rs1255923942 1743 dbSNP
rs570663269 1746 dbSNP
rs1343164451 1748 dbSNP
rs1289832378 1752 dbSNP
rs1410097971 1752 dbSNP
rs146557006 1752 dbSNP
rs1326556932 1753 dbSNP
rs1397598692 1755 dbSNP
rs552500695 1759 dbSNP
rs1175686806 1762 dbSNP
rs1468292253 1771 dbSNP
rs1160148631 1773 dbSNP
rs1414328712 1773 dbSNP
rs1472358590 1779 dbSNP
rs781862318 1779 dbSNP
rs562733680 1781 dbSNP
rs1443365934 1801 dbSNP
rs1256053549 1802 dbSNP
rs1202404818 1803 dbSNP
rs1320760106 1804 dbSNP
rs963751448 1806 dbSNP
rs1269528046 1823 dbSNP
rs975213955 1831 dbSNP
rs1228499768 1845 dbSNP
rs1349460478 1849 dbSNP
rs1246646177 1851 dbSNP
rs919753363 1851 dbSNP
rs186246440 1852 dbSNP
rs1047390418 1856 dbSNP
rs1335963657 1858 dbSNP
rs1450415495 1877 dbSNP
rs1390770597 1885 dbSNP
rs1321255864 1886 dbSNP
rs1400197395 1890 dbSNP
rs1405989004 1893 dbSNP
rs1165278095 1896 dbSNP
rs1473328676 1897 dbSNP
rs1385050995 1898 dbSNP
rs1182262592 1902 dbSNP
rs1249228303 1907 dbSNP
rs908464602 1914 dbSNP
rs190768105 1916 dbSNP
rs1281688373 1919 dbSNP
rs182629870 1920 dbSNP
rs1356755679 1921 dbSNP
rs894511165 1924 dbSNP
rs764730772 1932 dbSNP
rs116205699 1933 dbSNP
rs1243537026 1933 dbSNP
rs199857640 1933 dbSNP
rs538171088 1934 dbSNP
rs185400269 1935 dbSNP
rs1406223396 1943 dbSNP
rs1365212799 1946 dbSNP
rs1162017299 1955 dbSNP
rs1451727138 1957 dbSNP
rs1391267818 1958 dbSNP
rs1186508552 1975 dbSNP
rs904651812 1980 dbSNP
rs1239907349 1982 dbSNP
rs1223155002 1986 dbSNP
rs1490399095 1989 dbSNP
rs576661423 1990 dbSNP
rs1290582187 1999 dbSNP
rs999041877 2002 dbSNP
rs1219902464 2017 dbSNP
rs1031856536 2026 dbSNP
rs544128688 2027 dbSNP
rs1275256761 2034 dbSNP
rs1213956069 2036 dbSNP
rs782077361 2053 dbSNP
rs782600704 2056 dbSNP
rs1437322058 2070 dbSNP
rs1345051007 2080 dbSNP
rs1301543123 2087 dbSNP
rs1432006470 2090 dbSNP
rs1371598669 2096 dbSNP
rs1170327324 2097 dbSNP
rs1408660488 2102 dbSNP
rs1427902000 2117 dbSNP
rs1192361140 2127 dbSNP
rs568096892 2128 dbSNP
rs782197271 2132 dbSNP
rs1267716601 2144 dbSNP
rs1196922213 2149 dbSNP
rs1483896644 2153 dbSNP
rs565314695 2158 dbSNP
rs1305654679 2165 dbSNP
rs1280659725 2167 dbSNP
rs1219830793 2173 dbSNP
rs1323000154 2176 dbSNP
rs1281612825 2179 dbSNP
rs1411955821 2185 dbSNP
rs1351357451 2187 dbSNP
rs1177496179 2191 dbSNP
rs1297920491 2191 dbSNP
rs1428036539 2191 dbSNP
rs1440470880 2191 dbSNP
rs1469864797 2191 dbSNP
rs535433695 2191 dbSNP
rs1173788415 2192 dbSNP
rs1473340556 2193 dbSNP
rs577483304 2200 dbSNP
rs1250838801 2201 dbSNP
rs1176345346 2202 dbSNP
rs1479545696 2202 dbSNP
rs1204304184 2205 dbSNP
rs1239121069 2205 dbSNP
rs1460907582 2206 dbSNP
rs1261278286 2210 dbSNP
rs1230337667 2225 dbSNP
rs1317670334 2227 dbSNP
rs1306575310 2239 dbSNP
rs1222408585 2240 dbSNP
rs1381879708 2245 dbSNP
rs1303903363 2249 dbSNP
rs1009127319 2259 dbSNP
rs138464368 2260 dbSNP
rs1458364986 2272 dbSNP
rs1363963660 2281 dbSNP
rs1157998055 2282 dbSNP
rs782678070 2284 dbSNP
rs376555461 2288 dbSNP
rs797029875 2288 dbSNP
rs963714099 2297 dbSNP
rs1443883001 2300 dbSNP
rs975564118 2302 dbSNP
rs1210603142 2303 dbSNP
rs1026736397 2311 dbSNP
rs1213965799 2313 dbSNP
rs1323855238 2324 dbSNP
rs1316109560 2333 dbSNP
rs952617567 2361 dbSNP
rs1245740289 2368 dbSNP
rs1381141670 2382 dbSNP
rs982647402 2382 dbSNP
rs782269521 2383 dbSNP
rs938568941 2385 dbSNP
rs1385136348 2391 dbSNP
rs1287897610 2395 dbSNP
rs142500850 2396 dbSNP
rs1351283237 2404 dbSNP
rs1163908205 2418 dbSNP
rs1443791382 2436 dbSNP
rs1383288608 2439 dbSNP
rs1190506809 2448 dbSNP
rs1429167581 2464 dbSNP
rs529815466 2481 dbSNP
rs1184880565 2487 dbSNP
rs1489566460 2490 dbSNP
rs1292789525 2496 dbSNP
rs948752215 2498 dbSNP
rs1222143250 2499 dbSNP
rs1357817494 2516 dbSNP
rs1277396396 2521 dbSNP
rs1228849803 2526 dbSNP
rs782388318 2538 dbSNP
rs1294179101 2544 dbSNP
rs146816181 2548 dbSNP
rs553954672 2551 dbSNP
rs904620408 2558 dbSNP
rs10280063 2562 dbSNP
rs563333232 2570 dbSNP
rs530702485 2574 dbSNP
rs552475431 2579 dbSNP
rs1372463757 2582 dbSNP
rs934802093 2587 dbSNP
rs1434996393 2593 dbSNP
rs1269856344 2601 dbSNP
rs1199058149 2605 dbSNP
rs1489953860 2620 dbSNP
rs560387975 2635 dbSNP
rs1339220393 2643 dbSNP
rs1250140132 2647 dbSNP
rs1224591837 2649 dbSNP
rs1325146565 2649 dbSNP
rs1283489370 2650 dbSNP
rs1053198357 2656 dbSNP
rs550531469 2664 dbSNP
rs1343279981 2670 dbSNP
rs1330593231 2672 dbSNP
rs1391766661 2679 dbSNP
rs137957530 2681 dbSNP
rs1166149888 2682 dbSNP
rs528239458 2687 dbSNP
rs1430125586 2696 dbSNP
rs1017849844 2699 dbSNP
rs1175953328 2700 dbSNP
rs1479553620 2702 dbSNP
rs1414466347 2717 dbSNP
rs868968172 2724 dbSNP
rs1437671603 2726 dbSNP
rs546400316 2727 dbSNP
rs899456333 2729 dbSNP
rs766337285 2731 dbSNP
rs1249025796 2741 dbSNP
rs189966217 2744 dbSNP
rs1462251481 2748 dbSNP
rs1263162547 2762 dbSNP
rs952510019 2765 dbSNP
rs982560328 2767 dbSNP
rs1320893130 2772 dbSNP
rs35457812 2772 dbSNP
rs1280942154 2778 dbSNP
rs1239489122 2779 dbSNP
rs1015430856 2789 dbSNP
rs10250569 2790 dbSNP
rs1335021144 2792 dbSNP
rs1454563112 2798 dbSNP
rs959902818 2802 dbSNP
rs1406767695 2804 dbSNP
rs751540940 2805 dbSNP
rs915840149 2810 dbSNP
rs1387394871 2813 dbSNP
rs1159430178 2822 dbSNP
rs1469917797 2824 dbSNP
rs948701591 2829 dbSNP
rs1190074358 2835 dbSNP
rs1445724942 2837 dbSNP
rs1243076517 2844 dbSNP
rs1202423063 2854 dbSNP
rs978803797 2867 dbSNP
rs1459637073 2871 dbSNP
rs925970028 2872 dbSNP
rs1205399784 2874 dbSNP
rs934749129 2912 dbSNP
rs1277510724 2918 dbSNP
rs1247946002 2920 dbSNP
rs182952259 2921 dbSNP
rs554650915 2924 dbSNP
rs1314363716 2933 dbSNP
rs1450534111 2952 dbSNP
rs1328315907 2953 dbSNP
rs1319201921 2964 dbSNP
rs1400290235 2971 dbSNP
rs1383114710 2973 dbSNP
rs1165788321 2984 dbSNP
rs1425703153 2986 dbSNP
rs1385145153 3001 dbSNP
rs369903244 3005 dbSNP
rs570060297 3010 dbSNP
rs890619689 3011 dbSNP
rs1471506859 3014 dbSNP
rs944878189 3015 dbSNP
rs1446029472 3019 dbSNP
rs1281736788 3021 dbSNP
rs1224418214 3023 dbSNP
rs1039225955 3024 dbSNP
rs782331289 3029 dbSNP
rs1290946026 3033 dbSNP
rs900764863 3037 dbSNP
rs537070808 3041 dbSNP
rs149485654 3044 dbSNP
rs1270779640 3046 dbSNP
rs996891258 3053 dbSNP
rs1324860103 3059 dbSNP
rs1430145510 3059 dbSNP
rs1305240034 3060 dbSNP
rs1405898599 3067 dbSNP
rs1365417129 3068 dbSNP
rs1162206479 3069 dbSNP
rs1026630164 3074 dbSNP
rs1412074409 3080 dbSNP
rs1420850425 3080 dbSNP
rs200017488 3087 dbSNP
rs577619585 3087 dbSNP
rs541589981 3088 dbSNP
rs1490449303 3089 dbSNP
rs1267846340 3094 dbSNP
rs1219117186 3095 dbSNP
rs1015357108 3099 dbSNP
rs143866673 3100 dbSNP
rs959828884 3101 dbSNP
rs1014110357 3102 dbSNP
rs1023281201 3109 dbSNP
rs574572440 3111 dbSNP
rs1214037953 3115 dbSNP
rs1337577744 3118 dbSNP
rs1285424018 3122 dbSNP
rs1224413355 3127 dbSNP
rs1345128326 3130 dbSNP
rs781927633 3135 dbSNP
rs1444848575 3137 dbSNP
rs1355570528 3141 dbSNP
rs1328829139 3144 dbSNP
rs1408862847 3154 dbSNP
rs1420917739 3182 dbSNP
rs1177987639 3187 dbSNP
rs925967636 3190 dbSNP
rs781387470 3200 dbSNP
rs187203541 3201 dbSNP
rs1203812100 3204 dbSNP
rs1456487524 3205 dbSNP
rs911983988 3208 dbSNP
rs1224206031 3219 dbSNP
rs1323041575 3220 dbSNP
rs1281633470 3229 dbSNP
rs1225803630 3231 dbSNP
rs1374596428 3237 dbSNP
rs1279478225 3239 dbSNP
rs563118924 3246 dbSNP
rs782169655 3252 dbSNP
rs944845689 3254 dbSNP
rs576013391 3256 dbSNP
rs1338084205 3261 dbSNP
rs1469889952 3282 dbSNP
rs1404873740 3283 dbSNP
rs1408512811 3288 dbSNP
rs374139827 3288 dbSNP
rs530500178 3289 dbSNP
rs1039193759 3290 dbSNP
rs35908443 3292 dbSNP
rs922115100 3306 dbSNP
rs930903866 3316 dbSNP
rs1460963771 3319 dbSNP
rs1254484671 3329 dbSNP
rs1049818915 3330 dbSNP
rs1317762153 3335 dbSNP
rs1283923108 3340 dbSNP
rs545499956 3343 dbSNP
rs1238471383 3345 dbSNP
rs1385553696 3350 dbSNP
rs564000208 3362 dbSNP
rs1381488831 3363 dbSNP
rs1036755538 3364 dbSNP
rs1454968951 3365 dbSNP
rs1158049187 3366 dbSNP
rs1345421172 3366 dbSNP
rs895587361 3368 dbSNP
rs1386985568 3373 dbSNP
rs1014036757 3375 dbSNP
rs752710405 3379 dbSNP
rs1184210535 3381 dbSNP
rs1022784352 3387 dbSNP
rs528375254 3392 dbSNP
rs1254105950 3394 dbSNP
rs782800315 3395 dbSNP
rs546386291 3397 dbSNP
rs1000114005 3398 dbSNP
rs567955763 3404 dbSNP
rs1214877134 3406 dbSNP
rs1362091215 3409 dbSNP
rs1293133156 3410 dbSNP
rs1033344033 3411 dbSNP
rs193259884 3431 dbSNP
rs1383444542 3434 dbSNP
rs1362157747 3442 dbSNP
rs782002574 3443 dbSNP
rs1287971443 3446 dbSNP
rs1397872828 3449 dbSNP
rs1367283630 3458 dbSNP
rs1163999102 3467 dbSNP
rs956004853 3468 dbSNP
rs1366681244 3469 dbSNP
rs1172562246 3470 dbSNP
rs1429247002 3480 dbSNP
rs988784414 3481 dbSNP
rs1191857117 3493 dbSNP
rs567151939 3507 dbSNP
rs1222219274 3508 dbSNP
rs911951565 3513 dbSNP
rs571950763 3514 dbSNP
rs966080345 3522 dbSNP
rs1487767258 3530 dbSNP
rs2734605 3543 dbSNP
rs922123591 3544 dbSNP
rs1307607770 3546 dbSNP
rs1277170165 3547 dbSNP
rs1216353243 3560 dbSNP
rs782230698 3567 dbSNP
rs930812020 3571 dbSNP
rs1303493275 3573 dbSNP
rs1386031081 3573 dbSNP
rs1388462869 3580 dbSNP
rs1049283867 3581 dbSNP
rs1462559084 3586 dbSNP
rs908135049 3588 dbSNP
rs939645559 3589 dbSNP
rs1430280826 3590 dbSNP
rs1199084130 3600 dbSNP
rs1450290518 3611 dbSNP
rs1036682375 3612 dbSNP
rs183875745 3619 dbSNP
rs112204119 3620 dbSNP
rs537411439 3631 dbSNP
rs1480601902 3648 dbSNP
rs1256801209 3660 dbSNP
rs1196245146 3661 dbSNP
rs1325188802 3663 dbSNP
rs1283584167 3667 dbSNP
rs1014005431 3669 dbSNP
rs539313144 3672 dbSNP
rs558992717 3674 dbSNP
rs1044577365 3680 dbSNP
rs905655732 3681 dbSNP
rs1399460825 3682 dbSNP
rs1329349934 3692 dbSNP
rs1000443202 3695 dbSNP
rs1471008351 3699 dbSNP
rs879983108 3700 dbSNP
rs372237205 3701 dbSNP
rs1365855277 3709 dbSNP
rs1182996915 3715 dbSNP
rs1418968049 3717 dbSNP
rs891730217 3732 dbSNP
rs1010130030 3734 dbSNP
rs571156063 3742 dbSNP
rs1462300966 3744 dbSNP
rs1263368957 3752 dbSNP
rs1018885483 3755 dbSNP
rs966058148 3762 dbSNP
rs1262203129 3766 dbSNP
rs1239540603 3767 dbSNP
rs1375996480 3782 dbSNP
rs1307050368 3784 dbSNP
rs557680522 3788 dbSNP
rs1454615917 3792 dbSNP
rs535379031 3797 dbSNP
rs1383700525 3803 dbSNP
rs1333734867 3813 dbSNP
rs974818387 3819 dbSNP
rs1029501599 3828 dbSNP
rs782759081 3829 dbSNP
rs1419536166 3831 dbSNP
rs187989836 3832 dbSNP
rs1186039220 3841 dbSNP
rs908066093 3844 dbSNP
rs1445909041 3865 dbSNP
rs192263957 3867 dbSNP
rs992445181 3868 dbSNP
rs916915930 3873 dbSNP
rs537519512 3874 dbSNP
rs1263435518 3877 dbSNP
rs542083329 3879 dbSNP
rs1205477430 3882 dbSNP
rs556985865 3893 dbSNP
rs1283787742 3895 dbSNP
rs1248152367 3898 dbSNP
rs781820804 3899 dbSNP
rs1044116822 3906 dbSNP
rs905622056 3907 dbSNP
rs2529113 3911 dbSNP
rs367771654 3917 dbSNP
rs1319277031 3919 dbSNP
rs891656562 3924 dbSNP
rs148206908 3926 dbSNP
rs1399778453 3933 dbSNP
rs1010098866 3934 dbSNP
rs1165879158 3942 dbSNP
rs73412052 3950 dbSNP
rs901820406 3952 dbSNP
rs782697108 3954 dbSNP
rs781898402 3958 dbSNP
rs1029056734 3968 dbSNP
rs952209870 3974 dbSNP
rs1194012807 3979 dbSNP
rs1487830746 3983 dbSNP
rs1260691829 3990 dbSNP
rs1224489436 4003 dbSNP
rs1490479716 4005 dbSNP
rs1289125418 4008 dbSNP
rs572791758 4010 dbSNP
rs540171727 4011 dbSNP
rs1270975953 4016 dbSNP
rs1218186071 4018 dbSNP
rs962244376 4020 dbSNP
rs992371606 4023 dbSNP
rs1338721000 4031 dbSNP
rs1405957291 4032 dbSNP
rs1349787625 4037 dbSNP
rs1322186795 4040 dbSNP
rs782634332 4048 dbSNP
rs782236599 4049 dbSNP
rs980191988 4066 dbSNP
rs146283942 4068 dbSNP
rs1170784964 4073 dbSNP
rs935734033 4083 dbSNP
rs1421052580 4084 dbSNP
rs1201295318 4092 dbSNP
rs1478258790 4097 dbSNP
rs1054164494 4104 dbSNP
rs529049435 4107 dbSNP
rs1439508149 4112 dbSNP
rs1273722014 4119 dbSNP
rs1198122974 4121 dbSNP
rs891594261 4123 dbSNP
rs1285484364 4131 dbSNP
rs1224471787 4132 dbSNP
rs1367420419 4139 dbSNP
rs1273564014 4141 dbSNP
rs1444918203 4146 dbSNP
rs945894571 4152 dbSNP
rs1040241203 4155 dbSNP
rs1464695441 4156 dbSNP
rs901787875 4157 dbSNP
rs1178233703 4161 dbSNP
rs996132374 4161 dbSNP
rs1414813720 4172 dbSNP
rs1424135785 4185 dbSNP
rs550510447 4191 dbSNP
rs1189256275 4193 dbSNP
rs1050845833 4194 dbSNP
rs1238734898 4195 dbSNP
rs1178075866 4197 dbSNP
rs887818454 4198 dbSNP
rs1456533849 4206 dbSNP
rs1006716550 4207 dbSNP
rs1265223872 4208 dbSNP
rs1211153870 4225 dbSNP
rs1015018566 4229 dbSNP
rs563753063 4233 dbSNP
rs962170426 4236 dbSNP
rs782601210 4241 dbSNP
rs1374665422 4245 dbSNP
rs1309228267 4248 dbSNP
rs530952925 4252 dbSNP
rs1445403730 4253 dbSNP
rs1374093340 4264 dbSNP
rs1338149034 4269 dbSNP
rs552592017 4271 dbSNP
rs1173634776 4275 dbSNP
rs970025169 4280 dbSNP
rs1402279050 4286 dbSNP
rs746436333 4302 dbSNP
rs1380806965 4310 dbSNP
rs183671355 4311 dbSNP
rs1244978766 4318 dbSNP
rs926941444 4322 dbSNP
rs957097998 4323 dbSNP
rs535317188 4325 dbSNP
rs1235998416 4328 dbSNP
rs1218352846 4329 dbSNP
rs547289545 4335 dbSNP
rs1238537059 4338 dbSNP
rs1362229044 4340 dbSNP
rs868942889 4343 dbSNP
rs1396131156 4346 dbSNP
rs565924349 4363 dbSNP
rs912999606 4368 dbSNP
rs1432630918 4372 dbSNP
rs945861862 4374 dbSNP
rs772454666 4385 dbSNP
rs568676700 4393 dbSNP
rs1040167104 4399 dbSNP
rs776210021 4401 dbSNP
rs113401307 4402 dbSNP
rs2529114 4404 dbSNP
rs1165547825 4406 dbSNP
rs1423365150 4414 dbSNP
rs1411897333 4417 dbSNP
rs1188570177 4418 dbSNP
rs111437027 4433 dbSNP
rs575296428 4438 dbSNP
rs1262837135 4439 dbSNP
rs1214949576 4443 dbSNP
rs1490970321 4447 dbSNP
rs1266594732 4449 dbSNP
rs1244841121 4455 dbSNP
rs1320661781 4456 dbSNP
rs1310118503 4457 dbSNP
rs1050405268 4472 dbSNP
rs1340744516 4473 dbSNP
rs1277285614 4478 dbSNP
rs782425419 4483 dbSNP
rs887736845 4485 dbSNP
rs1367339970 4493 dbSNP
rs539187878 4503 dbSNP
rs1457462757 4506 dbSNP
rs533772994 4508 dbSNP
rs1006234035 4517 dbSNP
rs1348145979 4549 dbSNP
rs1172629429 4550 dbSNP
rs1478248442 4555 dbSNP
rs1423209748 4563 dbSNP
rs1191930538 4564 dbSNP
rs1481645413 4574 dbSNP
rs557315992 4576 dbSNP
rs1209827837 4577 dbSNP
rs1487797092 4588 dbSNP
rs1263092570 4596 dbSNP
rs1200014617 4599 dbSNP
rs1277226967 4605 dbSNP
rs1318109923 4605 dbSNP
rs191627764 4611 dbSNP
rs184570395 4612 dbSNP
rs1301740220 4617 dbSNP
rs1386081652 4620 dbSNP
rs1365446230 4621 dbSNP
rs111264249 4623 dbSNP
rs369708588 4623 dbSNP
rs1466254856 4625 dbSNP
rs1013698137 4628 dbSNP
rs868956436 4629 dbSNP
rs561607305 4633 dbSNP
rs1198597454 4639 dbSNP
rs1431900639 4640 dbSNP
rs1253308507 4659 dbSNP
rs1179944740 4661 dbSNP
rs35652575 4662 dbSNP
rs1257018700 4671 dbSNP
rs1002864119 4675 dbSNP
rs544390080 4679 dbSNP
rs1256329933 4685 dbSNP
rs1232288415 4694 dbSNP
rs1310346791 4695 dbSNP
rs562580014 4707 dbSNP
rs1447602099 4708 dbSNP
rs782267749 4709 dbSNP
rs1329410847 4711 dbSNP
rs1397937428 4712 dbSNP
rs531015466 4717 dbSNP
rs912924583 4718 dbSNP
rs967088747 4720 dbSNP
rs1366057711 4727 dbSNP
rs1439641276 4734 dbSNP
rs1236966101 4738 dbSNP
rs975839686 4743 dbSNP
rs923094814 4744 dbSNP
rs1256481843 4745 dbSNP
rs1199636876 4751 dbSNP
rs1342691235 4753 dbSNP
rs1288058237 4754 dbSNP
rs931837314 4757 dbSNP
rs552729910 4764 dbSNP
rs1050736005 4770 dbSNP
rs370081364 4772 dbSNP
rs1247109487 4773 dbSNP
rs548028529 4784 dbSNP
rs1333800611 4796 dbSNP
rs1394642609 4798 dbSNP
rs1362785552 4808 dbSNP
rs1299198476 4810 dbSNP
rs1419589385 4814 dbSNP
rs1379027030 4815 dbSNP
rs374607800 4816 dbSNP
rs897856695 4826 dbSNP
rs1368683584 4829 dbSNP
rs1186471139 4834 dbSNP
rs1440349026 4844 dbSNP
rs949439145 4847 dbSNP
rs751338808 4849 dbSNP
rs1217106662 4861 dbSNP
rs1264977958 4861 dbSNP
rs1487891445 4863 dbSNP
rs1283854680 4865 dbSNP
rs1211680660 4866 dbSNP
rs1357215015 4873 dbSNP
rs547028626 4876 dbSNP
rs1342650353 4878 dbSNP
rs1279184517 4879 dbSNP
rs1399835918 4883 dbSNP
rs905317864 4884 dbSNP
rs1406585553 4891 dbSNP
rs759581626 4891 dbSNP
rs1390750798 4892 dbSNP
rs1002391582 4894 dbSNP
rs1473996144 4895 dbSNP
rs1425355085 4897 dbSNP
rs1194086984 4902 dbSNP
rs1240278850 4903 dbSNP
rs2734606 4906 dbSNP
rs113969687 4913 dbSNP
rs781968636 4918 dbSNP
rs1289191607 4920 dbSNP
rs1208157532 4923 dbSNP
rs201811548 4926 dbSNP
rs117109026 4936 dbSNP
rs562636414 4950 dbSNP
rs551144733 4951 dbSNP
rs1218408961 4956 dbSNP
rs967057618 4957 dbSNP
rs1276983841 4969 dbSNP
rs1331062413 4980 dbSNP
rs1437721311 4980 dbSNP
rs975765593 4985 dbSNP
rs1322246629 4987 dbSNP
rs1459458117 4988 dbSNP
rs1030089959 4994 dbSNP
rs1171029555 4998 dbSNP
rs569386341 4999 dbSNP
rs1417046402 5008 dbSNP
rs1192738016 5011 dbSNP
rs112759201 5015 dbSNP
rs1459200622 5020 dbSNP
rs1239009827 5022 dbSNP
rs139428669 5023 dbSNP
rs1316297766 5028 dbSNP
rs752835432 5033 dbSNP
rs1220193868 5035 dbSNP
rs1344897236 5036 dbSNP
rs941912172 5050 dbSNP
rs972008036 5051 dbSNP
rs1331446846 5056 dbSNP
rs189948673 5057 dbSNP
rs1177940110 5058 dbSNP
rs1414869257 5062 dbSNP
rs1424374493 5063 dbSNP
rs949365600 5076 dbSNP
rs1171755014 5079 dbSNP
rs1441483678 5085 dbSNP
rs1380922841 5086 dbSNP
rs1046890805 5087 dbSNP
rs572613663 5088 dbSNP
rs533498191 5089 dbSNP
rs938119813 5102 dbSNP
rs1442273179 5106 dbSNP
rs1278795022 5108 dbSNP
rs782706049 5109 dbSNP
rs1355086418 5118 dbSNP
rs894012524 5132 dbSNP
rs1009773014 5138 dbSNP
rs1370691141 5142 dbSNP
rs1304299784 5146 dbSNP
rs781915087 5147 dbSNP
rs782164470 5148 dbSNP
rs527792119 5150 dbSNP
rs756098059 5155 dbSNP
rs953138415 5156 dbSNP
rs1417446311 5160 dbSNP
rs1416223025 5163 dbSNP
rs1182718381 5164 dbSNP
rs986312897 5168 dbSNP
rs1255801836 5172 dbSNP
rs1219278184 5173 dbSNP
rs1488891442 5177 dbSNP
rs1285979712 5181 dbSNP
rs1214458924 5183 dbSNP
rs1016088285 5184 dbSNP
rs1314270150 5188 dbSNP
rs1228474250 5190 dbSNP
rs10259347 5200 dbSNP
rs1291154839 5209 dbSNP
rs1401664073 5211 dbSNP
rs782789337 5214 dbSNP
rs544679601 5216 dbSNP
rs544213310 5218 dbSNP
rs556300440 5224 dbSNP
rs1351631219 5226 dbSNP
rs566215483 5236 dbSNP
rs970695391 5244 dbSNP
rs982117927 5245 dbSNP
rs1404937505 5246 dbSNP
rs926648342 5247 dbSNP
rs1196259767 5249 dbSNP
rs1478393996 5255 dbSNP
rs1263090140 5265 dbSNP
rs1185232106 5272 dbSNP
rs1489758163 5284 dbSNP
rs938103298 5287 dbSNP
rs1054318779 5289 dbSNP
rs375019222 5295 dbSNP
rs1221687801 5299 dbSNP
rs1333670126 5314 dbSNP
rs1270924698 5316 dbSNP
rs915371105 5317 dbSNP
rs1340957949 5318 dbSNP
rs577736795 5325 dbSNP
rs536389580 5326 dbSNP
rs182590466 5333 dbSNP
rs901450780 5334 dbSNP
rs1392550439 5338 dbSNP
rs1173171303 5340 dbSNP
rs998866116 5351 dbSNP
rs1466353073 5356 dbSNP
rs781863664 5357 dbSNP
rs888811503 5358 dbSNP
rs1435371382 5359 dbSNP
rs782500400 5368 dbSNP
rs1268722450 5369 dbSNP
rs1191233478 5370 dbSNP
rs1467690412 5372 dbSNP
rs528602816 5383 dbSNP
rs1250738976 5387 dbSNP
rs1200075732 5394 dbSNP
rs1318163327 5395 dbSNP
rs1007305274 5399 dbSNP
rs782533476 5402 dbSNP
rs540629216 5403 dbSNP
rs1301978141 5407 dbSNP
rs963172404 5408 dbSNP
rs561980939 5418 dbSNP
rs144082854 5425 dbSNP
rs1396065430 5433 dbSNP
rs1026177357 5442 dbSNP
rs1378712144 5444 dbSNP
rs970660459 5457 dbSNP
rs1453130501 5462 dbSNP
rs982473441 5465 dbSNP
rs552606441 5466 dbSNP
rs1457917519 5469 dbSNP
rs1249434567 5470 dbSNP
rs376594341 5481 dbSNP
rs1484145937 5486 dbSNP
rs369542263 5488 dbSNP
rs200253961 5492 dbSNP
rs1345685330 5497 dbSNP
rs1311496198 5500 dbSNP
rs915340186 5514 dbSNP
rs551561682 5515 dbSNP
rs1042515500 5520 dbSNP
rs1327177519 5528 dbSNP
rs1398140071 5532 dbSNP
rs1403284129 5533 dbSNP
rs1312657711 5534 dbSNP
rs754152528 5541 dbSNP
rs1433356473 5546 dbSNP
rs1363027144 5547 dbSNP
rs922802862 5549 dbSNP
rs1439847501 5552 dbSNP
rs187104575 5563 dbSNP
rs1179159375 5564 dbSNP
rs1425194940 5571 dbSNP
rs1256550797 5573 dbSNP
rs1209920749 5574 dbSNP
rs934252802 5583 dbSNP
rs1050467242 5584 dbSNP
rs1217423323 5588 dbSNP
rs1350115747 5593 dbSNP
rs1277867579 5596 dbSNP
rs73712443 5603 dbSNP
rs1247178147 5605 dbSNP
rs1341328697 5607 dbSNP
rs782754871 5611 dbSNP
rs1007644002 5616 dbSNP
rs1342935931 5620 dbSNP
rs2529115 5624 dbSNP
rs1400652421 5636 dbSNP
rs1383534876 5637 dbSNP
rs898898764 5639 dbSNP
rs1459080042 5640 dbSNP
rs1418188178 5641 dbSNP
rs1186918086 5646 dbSNP
rs1474140155 5648 dbSNP
rs1265224630 5653 dbSNP
rs993276941 5658 dbSNP
rs1446361961 5660 dbSNP
rs11771091 5661 dbSNP
rs1211734653 5668 dbSNP
rs971008946 5670 dbSNP
rs782681789 5674 dbSNP
rs1272861635 5681 dbSNP
rs1231829907 5689 dbSNP
rs1342707956 5697 dbSNP
rs1279243041 5703 dbSNP
rs550535381 5704 dbSNP
rs1325225395 5706 dbSNP
rs1315590706 5709 dbSNP
rs1388046917 5710 dbSNP
rs781893055 5713 dbSNP
rs1163831071 5714 dbSNP
rs11771127 5716 dbSNP
rs1034022003 5717 dbSNP
rs1475014879 5725 dbSNP
rs536107022 5729 dbSNP
rs1201087711 5743 dbSNP
rs782233391 5747 dbSNP
rs959373873 5749 dbSNP
rs780380043 5751 dbSNP
rs1252467781 5756 dbSNP
rs782339731 5757 dbSNP
rs1320315540 5759 dbSNP
rs1259057926 5760 dbSNP
rs797039699 5764 dbSNP
rs782591297 5767 dbSNP
rs372408761 5769 dbSNP
rs553809685 5779 dbSNP
rs782432191 5780 dbSNP
rs556151925 5788 dbSNP
rs782008455 5789 dbSNP
rs922768703 5792 dbSNP
rs934153869 5793 dbSNP
rs769337136 5795 dbSNP
rs189588459 5804 dbSNP
rs1329272517 5810 dbSNP
rs1409196713 5817 dbSNP
rs1417281181 5819 dbSNP
rs748996086 5833 dbSNP
rs1454660950 5834 dbSNP
rs1394517495 5838 dbSNP
rs1191856698 5847 dbSNP
rs1459244360 5850 dbSNP
rs545179827 5851 dbSNP
rs1233709659 5856 dbSNP
rs1037359487 5859 dbSNP
rs898869001 5863 dbSNP
rs2734607 5868 dbSNP
rs1281181111 5886 dbSNP
rs1201457339 5887 dbSNP
rs554058318 5895 dbSNP
rs1302000586 5898 dbSNP
rs1231503454 5904 dbSNP
rs1378614651 5913 dbSNP
rs1279831446 5916 dbSNP
rs1441044585 5918 dbSNP
rs1352480170 5934 dbSNP
rs782074227 5940 dbSNP
rs1435210153 5950 dbSNP
rs1374829273 5952 dbSNP
rs1171816097 5954 dbSNP
rs1441700610 5957 dbSNP
rs1408962644 5960 dbSNP
rs1176770384 5962 dbSNP
rs1468799807 5973 dbSNP
rs1047515025 5974 dbSNP
rs139735211 5977 dbSNP
rs1485617142 5977 dbSNP
rs1003801653 5978 dbSNP
rs1208095338 5981 dbSNP
rs1033578973 5983 dbSNP
rs781824811 5986 dbSNP
rs895036442 5990 dbSNP
rs1370757695 5994 dbSNP
rs1010806596 5996 dbSNP
rs1415216955 5997 dbSNP
rs540406486 6001 dbSNP
rs562092970 6004 dbSNP
rs376440961 6006 dbSNP
rs1421452381 6007 dbSNP
rs1345791708 6020 dbSNP
rs1158511188 6021 dbSNP
rs966720936 6022 dbSNP
rs1399125036 6023 dbSNP
rs2734608 6025 dbSNP
rs1416288944 6026 dbSNP
rs1189056076 6031 dbSNP
rs529244771 6032 dbSNP
rs1030166302 6033 dbSNP
rs1196388931 6034 dbSNP
rs1242142356 6034 dbSNP
rs1486498683 6034 dbSNP
rs1214519762 6035 dbSNP
rs1314734229 6038 dbSNP
rs371152466 6039 dbSNP
rs1233666503 6040 dbSNP
rs544603170 6056 dbSNP
rs1291211863 6058 dbSNP
rs1362595792 6064 dbSNP
rs986049417 6066 dbSNP
rs1351830311 6069 dbSNP
rs1165999059 6070 dbSNP
rs1461125686 6071 dbSNP
rs562991867 6072 dbSNP
rs111346984 6073 dbSNP
rs1185429655 6078 dbSNP
rs1484642877 6088 dbSNP
rs1254342842 6089 dbSNP
rs1213851639 6090 dbSNP
rs1467775147 6092 dbSNP
rs539177672 6093 dbSNP
rs1270983269 6094 dbSNP
rs1229400574 6098 dbSNP
rs1307972773 6102 dbSNP
rs1294852885 6106 dbSNP
rs1212867262 6112 dbSNP
rs1373201660 6116 dbSNP
rs1326702538 6120 dbSNP
rs1440385730 6121 dbSNP
rs1392619773 6125 dbSNP
rs180891234 6126 dbSNP
rs1462880223 6131 dbSNP
rs1372999262 6135 dbSNP
rs1168886913 6137 dbSNP
rs566755965 6138 dbSNP
rs1396316990 6145 dbSNP
rs1193735798 6146 dbSNP
rs2734609 6150 dbSNP
rs1453397995 6152 dbSNP
rs2734610 6157 dbSNP
rs920221807 6159 dbSNP
rs1197329013 6163 dbSNP
rs1480868926 6164 dbSNP
rs1250563468 6184 dbSNP
rs1202307005 6185 dbSNP
rs1349991161 6188 dbSNP
rs759194254 6190 dbSNP
rs1047484756 6198 dbSNP
rs906293910 6203 dbSNP
rs145697418 6204 dbSNP
rs1392199245 6205 dbSNP
rs1396137218 6206 dbSNP
rs1296837368 6210 dbSNP
rs1437069415 6212 dbSNP
rs1376644093 6218 dbSNP
rs1173680428 6222 dbSNP
rs939139669 6227 dbSNP
rs1453339282 6231 dbSNP
rs1055352869 6232 dbSNP
rs184960775 6249 dbSNP
rs895012610 6252 dbSNP
rs1010775647 6258 dbSNP
rs767511800 6270 dbSNP
rs1022170456 6286 dbSNP
rs548773618 6287 dbSNP
rs1486594894 6288 dbSNP
rs1281037245 6311 dbSNP
rs1210241460 6321 dbSNP
rs1345748257 6324 dbSNP
rs1262576701 6332 dbSNP
rs1335418233 6335 dbSNP
rs567372930 6335 dbSNP
rs1305276724 6341 dbSNP
rs1356654058 6341 dbSNP
rs1312865731 6342 dbSNP
rs111309124 6344 dbSNP
rs202177089 6344 dbSNP
rs66996260 6344 dbSNP
rs1362904184 6350 dbSNP
rs1156665707 6354 dbSNP
rs58082112 6357 dbSNP
rs1187059501 6358 dbSNP
rs1484670906 6359 dbSNP
rs1235509016 6360 dbSNP
rs1259252341 6360 dbSNP
rs1263879635 6360 dbSNP
rs1350185195 6360 dbSNP
rs369833653 6360 dbSNP
rs1335836488 6367 dbSNP
rs1293066145 6374 dbSNP
rs902486696 6377 dbSNP
rs576193943 6378 dbSNP
rs1319682863 6384 dbSNP
rs1029722085 6385 dbSNP
rs1383777937 6397 dbSNP
rs1156432520 6412 dbSNP
rs552474615 6413 dbSNP
rs1418260421 6414 dbSNP
rs1163969095 6416 dbSNP
rs1471754756 6417 dbSNP
rs556130417 6418 dbSNP
rs190109478 6425 dbSNP
rs1193984210 6427 dbSNP
rs182386630 6428 dbSNP
rs555035521 6430 dbSNP
rs1259758344 6437 dbSNP
rs1215714283 6438 dbSNP
rs1469098485 6441 dbSNP
rs1272921467 6445 dbSNP
rs1231887829 6455 dbSNP
rs573603351 6465 dbSNP
rs187125633 6469 dbSNP
rs373745381 6483 dbSNP
rs536469712 6485 dbSNP
rs145360372 6486 dbSNP
rs540887371 6486 dbSNP