miRTarBase - #MIRT054283 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol YAP1   
Synonyms COB1, YAP, YAP2, YAP65, YKI
Description Yes associated protein 1
Transcript NM_001130145   
Other Transcripts NM_006106   
Expression
Putative miRNA Targets on YAP1
3'UTR of YAP1
(miRNA target sites are highlighted)
>YAP1|NM_001130145|3'UTR
   1 AGCCCTCAGGCAGACTGAATTCTAAATCTGTGAAGGATCTAAGGAGACACATGCACCGGAAATTTCCATAAGCCAGTTGC
  81 AGTTTTCAGGCTAATACAGAAAAAGATGAACAAACGTCCAGCAAGATACTTTAATCCTCTATTTTGCTCTTCCTTGTCCA
 161 TTGCTGCTGTTAATGTATTGCTGACCTCTTTCACAGTTGGCTCTAAAGAATCAAAAGAAAAAAACTTTTTATTTCTTTTG
 241 CTATTAAAACTACTGTTCATTTTGGGGGCTGGGGGAAGTGAGCCTGTTTGGATGATGGATGCCATTCCTTTTGCCCAGTT
 321 AAATGTTCACCAATCATTTTAACTAAATACTCAGACTTAGAAGTCAGATGCTTCATGTCACAGCATTTAGTTTGTTCAAC
 401 AGTTGTTTCTTCAGCTTCCTTTGTCCAGTGGAAAAACATGATTTACTGGTCTGACAAGCCAAAAATGTTATATCTGATAT
 481 TAAATACTTAATGCTGATTTGAAGAGATAGCTGAAACCAAGGCTGAAGACTGTTTTACTTTCAGTATTTTCTTTTCCTCC
 561 TAGTGCTATCATTAGTCACATAATGACCTTGATTTTATTTTAGGAGCTTATAAGGCATGAGACAATTTCCATATAAATAT
 641 ATTAATTATTGCCACATACTCTAATATAGATTTTGGTGGATAATTTTGTGGGTGTGCATTTTGTTCTGTTTTGTTGGGTT
 721 TTTTGTTTTTTTTGTTTTTGGCAGGGTCGGTGGGGGGGTTGGTTGGTTGGTTGGTTTTGTCGGAACCTAGGCAAATGACC
 801 ATATTAGTGAATCTGTTAATAGTTGTAGCTTGGGATGGTTATTGTAGTTGTTTTGGTAAAATCTTCATTTCCTGGTTTTT
 881 TTTACCACCTTATTTAAATCTCGATTATCTGCTCTCTCTTTTATATACATACACACACCCAAACATAACATTTATAATAG
 961 TGTGGTAGTGGAATGTATCCTTTTTTAGGTTTCCCTGCTTTCCAGTTAATTTTTAAAATGGTAGCGCTTTGTATGCATTT
1041 AGAATACATGACTAGTAGTTTATATTTCACTGGTAGTTTAAATCTGGTTGGGGCAGTCTGCAGATGTTTGAAGTAGTTTA
1121 GTGTTCTAGAAAGAGCTATTACTGTGGATAGTGCCTAGGGGAGTGCTCCACGCCCTCTGGGCATACGGTAGATATTATCT
1201 GATGAATTGGAAAGGAGCAAACCAGAAATGGCTTTATTTTCTCCCTTGGACTAATTTTTAAGTCTCGATTGGAATTCAGT
1281 GAGTAGGTTCATAATGTGCATGACAGAAATAAGCTTTATAGTGGTTTACCTTCATTTAGCTTTGGAAGTTTTCTTTGCCT
1361 TAGTTTTGGAAGTAAATTCTAGTTTGTAGTTCTCATTTGTAATGAACACATTAACGACTAGATTAAAATATTGCCTTCAA
1441 GATTGTTCTTACTTACAAGACTTGCTCCTACTTCTATGCTGAAAATTGACCCTGGATAGAATACTATAAGGTTTTGAGTT
1521 AGCTGGAAAAGTGATCAGATTAATAAATGTATATTGGTAGTTGAATTTAGCAAAGAAATAGAGATAATCATGATTATACC
1601 TTTATTTTTACAGGAAGAGATGATGTAACTAGAGTATGTGTCTACAGGAGTAATAATGGTTTCCAAAGAGTATTTTTTAA
1681 AGGAACAAAACGAGCATGAATTAACTCTTCAATATAAGCTATGAAGTAATAGTTGGTTGTGAATTAAAGTGGCACCAGCT
1761 AGCACCTCTGTGTTTTAAGGGTCTTTCAATGTTTCTAGAATAAGCCCTTATTTTCAAGGGTTCATAACAGGCATAAAATC
1841 TCTTCTCCTGGCAAAAGCTGCTATGAAAAGCCTCAGCTTGGGAAGATAGATTTTTTTCCCCCCAATTACAAAATCTAAGT
1921 ATTTTGGCCCTTCAATTTGGAGGAGGGCAAAAGTTGGAAGTAAGAAGTTTTATTTTAAGTACTTTCAGTGCTCAAAAAAA
2001 TGCAATCACTGTGTTGTATATAATAGTTCATAGGTTGATCACTCATAATAATTGACTCTAAGGCTTTTATTAAGAAAACA
2081 GCAGAAAGATTAAATCTTGAATTAAGTCTGGGGGGAAATGGCCACTGCAGATGGAGTTTTAGAGTAGTAATGAAATTCTA
2161 CCTAGAATGCAAAATTGGGTATATGAATTACATAGCATGTTGTTGGGATTTTTTTTAATGTGCAGAAGATCAAAGCTACT
2241 TGGAAGGAGTGCCTATAATTTGCCAGTAGCCACAGATTAAGATTATATCTTATATATCAGCAGATTAGCTTTAGCTTAGG
2321 GGGAGGGTGGGAAAGTTTGGGGGGGGGGTTGTGAAGATTTAGGGGGACCTTGATAGAGAACTTTATAAACTTCTTTCTCT
2401 TTAATAAAGACTTGTCTTACACCGTGCTGCCATTAAAGGCAGCTGTTCTAGAGTTTCAGTCACCTAAGTACACCCACAAA
2481 ACAATATGAATATGGAGATCTTCCTTTACCCCTCAACTTTAATTTGCCCAGTTATACCTCAGTGTTGTAGCAGTACTGTG
2561 ATACCTGGCACAGTGCTTTGATCTTACGATGCCCTCTGTACTGACCTGAAGGAGACCTAAGAGTCCTTTCCCTTTTTGAG
2641 TTTGAATCATAGCCTTGATGTGGTCTCTTGTTTTATGTCCTTGTTCCTAATGTAAAAGTGCTTAACTGCTTCTTGGTTGT
2721 ATTGGGTAGCATTGGGATAAGATTTTAACTGGGTATTCTTGAATTGCTTTTACAATAAACCAATTTTATAATCTTTAAAT
2801 TTATCAACTTTTTACATTTGTGTTATTTTCAGTCAGGGCTTCTTAGATCTACTTATGGTTGATGGAGCACATTGATTTGG
2881 AGTTTCAGATCTTCCAAAGCACTATTTGTTGTAATAACTTTTCTAAATGTAGTGCCTTTAAAGGAAAAATGAACACAGGG
2961 AAGTGACTTTGCTACAAATAATGTTGCTGTGTTAAGTATTCATATTAAATACATGCCTTCTATATGGAACATGGCAGAAA
3041 GACTGAAAAATAACAGTAATTAATTGTGTAATTCAGAATTCATACCAATCAGTGTTGAAACTCAAACATTGCAAAAGTGG
3121 GTGGCAATATTCAGTGCTTAACACTTTTCTAGCGTTGGTACATCTGAGAAATGAGTGCTCAGGTGGATTTTATCCTCGCA
3201 AGCATGTTGTTATAAGAATTGTGGGTGTGCCTATCATAACAATTGTTTTCTGTATCTTGAAAAAGTATTCTCCACATTTT
3281 AAATGTTTTATATTAGAGAATTCTTTAATGCACACTTGTCAAATATATATATATAGTACCAATGTTACCTTTTTATTTTT
3361 TGTTTTAGATGTAAGAGCATGCTCATATGTTAGGTACTTACATAAATTGTTACATTATTTTTTCTTATGTAATACCTTTT
3441 TGTTTGTTTATGTGGTTCAAATATATTCTTTCCTTAAACTCTTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ||||    ||||||| 
Target 5' ccttgtCCAT----TGCTGCTg 3'
152 - 169 146.00 -13.20
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               || | ||  ||:|||| 
Target 5' ttgctACAAATA-ATGTTGCTg 3'
2969 - 2989 132.00 -10.60
3
miRNA  3' gugUUUG---GUAAU---ACACGACGau 5'
             |:||   : |||    |||||||  
Target 5' taaAGACTTGTCTTACACCGTGCTGCca 3'
2405 - 2432 127.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30448273 36 COSMIC
COSN31611381 50 COSMIC
COSN512181 52 COSMIC
COSN30507782 57 COSMIC
COSN27005379 67 COSMIC
COSN25031421 76 COSMIC
COSN30498853 150 COSMIC
COSN24490353 231 COSMIC
COSN30115024 236 COSMIC
COSN28118031 466 COSMIC
COSN28687014 473 COSMIC
COSN31519689 552 COSMIC
COSN4718191 609 COSMIC
COSN31518081 734 COSMIC
COSN1509574 904 COSMIC
COSN32055792 1485 COSMIC
COSN32058673 1516 COSMIC
COSN16397967 1693 COSMIC
COSN15801963 1694 COSMIC
COSN31544832 1814 COSMIC
COSN23252856 1898 COSMIC
COSN31541762 1898 COSMIC
COSN31553219 1899 COSMIC
COSN16968340 2000 COSMIC
COSN31584287 2004 COSMIC
COSN30170936 2163 COSMIC
COSN25025132 2430 COSMIC
COSN30177253 2581 COSMIC
COSN31545568 2649 COSMIC
COSN6981615 2762 COSMIC
COSN31607617 2801 COSMIC
COSN31609004 2803 COSMIC
COSN19657672 2842 COSMIC
COSN16756349 3299 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1231669477 2 dbSNP
rs1242397449 3 dbSNP
rs1485208515 5 dbSNP
rs746816956 6 dbSNP
rs956054285 8 dbSNP
rs754789933 12 dbSNP
rs369837465 13 dbSNP
rs769873665 14 dbSNP
rs1212089977 17 dbSNP
rs184644885 20 dbSNP
rs749415278 27 dbSNP
rs771176239 31 dbSNP
rs1346068788 33 dbSNP
rs943020361 37 dbSNP
rs1414522015 41 dbSNP
rs1238150999 42 dbSNP
rs1311399030 47 dbSNP
rs774491232 48 dbSNP
rs1415875377 50 dbSNP
rs759816021 51 dbSNP
rs1370520578 52 dbSNP
rs577368181 55 dbSNP
rs1186698405 59 dbSNP
rs1024318079 62 dbSNP
rs974373797 63 dbSNP
rs905418478 69 dbSNP
rs1417633965 81 dbSNP
rs556459420 83 dbSNP
rs1160461035 90 dbSNP
rs1474403378 102 dbSNP
rs920249124 104 dbSNP
rs1406485273 111 dbSNP
rs1167576429 112 dbSNP
rs1001443448 114 dbSNP
rs1252451475 115 dbSNP
rs543234114 116 dbSNP
rs556801069 117 dbSNP
rs753474451 120 dbSNP
rs189374442 121 dbSNP
rs1214871378 124 dbSNP
rs1314935359 128 dbSNP
rs1048424671 133 dbSNP
rs956849376 138 dbSNP
rs542184574 142 dbSNP
rs1346989323 153 dbSNP
rs376230391 160 dbSNP
rs1030403234 165 dbSNP
rs1372410075 168 dbSNP
rs1300705755 173 dbSNP
rs1410698550 181 dbSNP
rs1436643872 182 dbSNP
rs1312446119 195 dbSNP
rs1319442805 196 dbSNP
rs1428153045 197 dbSNP
rs1343830026 200 dbSNP
rs1178595126 202 dbSNP
rs1415560005 203 dbSNP
rs1353379073 204 dbSNP
rs939486304 224 dbSNP
rs1186179990 226 dbSNP
rs1056569882 240 dbSNP
rs911147912 242 dbSNP
rs1485344441 254 dbSNP
rs1416363529 259 dbSNP
rs778383575 260 dbSNP
rs963958132 278 dbSNP
rs895194086 281 dbSNP
rs1212442509 286 dbSNP
rs1313439630 287 dbSNP
rs1305020520 301 dbSNP
rs771420860 301 dbSNP
rs1225081644 308 dbSNP
rs1311619362 309 dbSNP
rs749988570 311 dbSNP
rs1371250694 319 dbSNP
rs1169757612 331 dbSNP
rs1022293023 334 dbSNP
rs1416230494 341 dbSNP
rs1182278850 349 dbSNP
rs1474746906 353 dbSNP
rs919795282 354 dbSNP
rs929810519 355 dbSNP
rs1207245436 356 dbSNP
rs1483301643 368 dbSNP
rs1252560963 369 dbSNP
rs1342203841 372 dbSNP
rs561987435 373 dbSNP
rs1323210182 374 dbSNP
rs1000146544 377 dbSNP
rs1031980040 380 dbSNP
rs1312947801 385 dbSNP
rs1234334794 386 dbSNP
rs1355262497 392 dbSNP
rs1291749837 394 dbSNP
rs1412238570 395 dbSNP
rs1209739120 397 dbSNP
rs1254934527 402 dbSNP
rs1484933390 403 dbSNP
rs917634971 413 dbSNP
rs1460504933 416 dbSNP
rs1188968130 419 dbSNP
rs1351889375 421 dbSNP
rs1165780951 426 dbSNP
rs1461079049 429 dbSNP
rs955919703 437 dbSNP
rs1183950111 439 dbSNP
rs15067 447 dbSNP
rs1257230121 453 dbSNP
rs572491869 460 dbSNP
rs1428444672 465 dbSNP
rs541497824 471 dbSNP
rs1249725536 475 dbSNP
rs1175012983 495 dbSNP
rs987673600 505 dbSNP
rs1018715801 507 dbSNP
rs181432714 509 dbSNP
rs1001157640 515 dbSNP
rs1230621795 531 dbSNP
rs1336915102 532 dbSNP
rs867982923 537 dbSNP
rs558729616 538 dbSNP
rs1168899939 539 dbSNP
rs1326581366 545 dbSNP
rs1440458545 548 dbSNP
rs1054038016 555 dbSNP
rs892663678 560 dbSNP
rs1009727603 564 dbSNP
rs1254443256 572 dbSNP
rs1156862505 574 dbSNP
rs1434771089 581 dbSNP
rs920280117 590 dbSNP
rs1030434164 592 dbSNP
rs954754364 605 dbSNP
rs1249475320 606 dbSNP
rs1211028229 609 dbSNP
rs1351882676 612 dbSNP
rs533539005 614 dbSNP
rs930279711 622 dbSNP
rs530052726 624 dbSNP
rs1440256004 626 dbSNP
rs1369102007 634 dbSNP
rs1467447046 640 dbSNP
rs1382941183 641 dbSNP
rs1383980000 654 dbSNP
rs1286843864 660 dbSNP
rs1007977710 662 dbSNP
rs908095482 667 dbSNP
rs1172524364 668 dbSNP
rs939537188 675 dbSNP
rs1452013729 677 dbSNP
rs1391429889 687 dbSNP
rs764420950 689 dbSNP
rs963702302 690 dbSNP
rs1380491791 691 dbSNP
rs1297574862 692 dbSNP
rs974058623 697 dbSNP
rs1056999578 700 dbSNP
rs1365358079 701 dbSNP
rs1484562221 707 dbSNP
rs1281629304 710 dbSNP
rs1232922965 714 dbSNP
rs1277819823 719 dbSNP
rs1345843364 719 dbSNP
rs572097624 719 dbSNP
rs919829062 720 dbSNP
rs746935050 723 dbSNP
rs1228447123 725 dbSNP
rs1326062560 726 dbSNP
rs1397528491 726 dbSNP
rs982553113 726 dbSNP
rs1376050136 730 dbSNP
rs1312226540 731 dbSNP
rs1432743960 739 dbSNP
rs948164287 744 dbSNP
rs145014556 745 dbSNP
rs1210299829 746 dbSNP
rs879805948 749 dbSNP
rs1043777359 750 dbSNP
rs1485717103 751 dbSNP
rs1191536088 752 dbSNP
rs199847793 752 dbSNP
rs949130374 752 dbSNP
rs529590110 753 dbSNP
rs999913010 754 dbSNP
rs1193076289 755 dbSNP
rs1276934753 757 dbSNP
rs926347150 757 dbSNP
rs936315275 757 dbSNP
rs1054069946 758 dbSNP
rs892694898 759 dbSNP
rs1009757257 760 dbSNP
rs185872675 761 dbSNP
rs1408826279 766 dbSNP
rs781014049 768 dbSNP
rs1164659957 783 dbSNP
rs188379246 786 dbSNP
rs1018104894 796 dbSNP
rs1419036336 796 dbSNP
rs1474552279 797 dbSNP
rs1235072545 802 dbSNP
rs899190486 815 dbSNP
rs1437343948 823 dbSNP
rs1270926741 832 dbSNP
rs60149158 832 dbSNP
rs369361628 837 dbSNP
rs994765874 847 dbSNP
rs1026876580 851 dbSNP
rs951259557 851 dbSNP
rs982585939 862 dbSNP
rs1280043891 876 dbSNP
rs1378830618 876 dbSNP
rs1024797915 882 dbSNP
rs1324869782 884 dbSNP
rs1441255572 884 dbSNP
rs534318083 884 dbSNP
rs980569437 890 dbSNP
rs747847672 891 dbSNP
rs1460181795 892 dbSNP
rs1389269121 897 dbSNP
rs1159689462 898 dbSNP
rs1470016431 902 dbSNP
rs936364997 903 dbSNP
rs770877253 904 dbSNP
rs1300628645 908 dbSNP
rs914160426 912 dbSNP
rs147570253 913 dbSNP
rs1284647478 914 dbSNP
rs1223148919 917 dbSNP
rs1052011177 919 dbSNP
rs1219467363 921 dbSNP
rs745958573 922 dbSNP
rs1234346662 924 dbSNP
rs745975049 925 dbSNP
rs1316735337 939 dbSNP
rs1214089706 940 dbSNP
rs1270642501 962 dbSNP
rs1319328642 965 dbSNP
rs1465760221 966 dbSNP
rs1400699858 971 dbSNP
rs1406415630 972 dbSNP
rs1175644096 974 dbSNP
rs1454743983 979 dbSNP
rs772127608 982 dbSNP
rs34045031 993 dbSNP
rs1394502142 1006 dbSNP
rs890670071 1025 dbSNP
rs1486932529 1027 dbSNP
rs943517124 1034 dbSNP
rs560412087 1039 dbSNP
rs529146895 1043 dbSNP
rs542847271 1045 dbSNP
rs899220776 1050 dbSNP
rs1282356913 1060 dbSNP
rs994797557 1063 dbSNP
rs1026236925 1065 dbSNP
rs886433933 1069 dbSNP
rs1230183905 1077 dbSNP
rs1407494781 1085 dbSNP
rs1271203292 1088 dbSNP
rs536832835 1092 dbSNP
rs761140139 1095 dbSNP
rs1343997834 1112 dbSNP
rs1004125227 1115 dbSNP
rs537792241 1122 dbSNP
rs114225590 1127 dbSNP
rs117925915 1129 dbSNP
rs1430577765 1139 dbSNP
rs1420456563 1143 dbSNP
rs1185765298 1147 dbSNP
rs1323749303 1158 dbSNP
rs1033454715 1159 dbSNP
rs1259307649 1160 dbSNP
rs536192943 1161 dbSNP
rs1436531726 1164 dbSNP
rs1277651454 1168 dbSNP
rs1297316022 1169 dbSNP
rs553241467 1172 dbSNP
rs73585834 1173 dbSNP
rs1328042474 1182 dbSNP
rs1290607620 1187 dbSNP
rs1355369450 1188 dbSNP
rs1311184747 1193 dbSNP
rs1463571041 1195 dbSNP
rs1355141299 1196 dbSNP
rs1170050589 1202 dbSNP
rs1408361438 1205 dbSNP
rs1330197275 1207 dbSNP
rs1233235878 1208 dbSNP
rs1188380164 1212 dbSNP
rs1474880394 1213 dbSNP
rs945023734 1216 dbSNP
rs987748027 1226 dbSNP
rs912119801 1232 dbSNP
rs1271800749 1243 dbSNP
rs943567346 1250 dbSNP
rs1480685123 1262 dbSNP
rs1231775618 1263 dbSNP
rs1202008031 1267 dbSNP
rs1336417218 1268 dbSNP
rs1039572091 1270 dbSNP
rs141985469 1271 dbSNP
rs11225174 1276 dbSNP
rs1311236977 1280 dbSNP
rs1222397690 1283 dbSNP
rs377410087 1287 dbSNP
rs1479782121 1288 dbSNP
rs1297627155 1291 dbSNP
rs1184565247 1292 dbSNP
rs1412465738 1294 dbSNP
rs1444921292 1299 dbSNP
rs1047799321 1301 dbSNP
rs886465121 1315 dbSNP
rs1460704517 1318 dbSNP
rs1415326450 1319 dbSNP
rs1014195745 1320 dbSNP
rs1419529768 1322 dbSNP
rs1415863890 1323 dbSNP
rs146091428 1333 dbSNP
rs1469586754 1335 dbSNP
rs1253216244 1340 dbSNP
rs563778254 1360 dbSNP
rs1468345024 1361 dbSNP
rs1263979073 1364 dbSNP
rs1352199123 1369 dbSNP
rs1411315215 1388 dbSNP
rs1308209316 1393 dbSNP
rs1351539702 1395 dbSNP
rs1318036316 1403 dbSNP
rs1306473167 1407 dbSNP
rs1238019707 1411 dbSNP
rs1373524561 1413 dbSNP
rs1326848431 1424 dbSNP
rs1440391235 1452 dbSNP
rs1414520534 1462 dbSNP
rs1283014374 1466 dbSNP
rs906419648 1468 dbSNP
rs1446292950 1471 dbSNP
rs1002047947 1487 dbSNP
rs1033896967 1488 dbSNP
rs957851517 1489 dbSNP
rs1359091576 1502 dbSNP
rs1192625608 1504 dbSNP
rs1452123194 1505 dbSNP
rs1010701580 1508 dbSNP
rs1307414281 1512 dbSNP
rs1272418336 1517 dbSNP
rs1340077926 1532 dbSNP
rs1207615072 1535 dbSNP
rs529584641 1541 dbSNP
rs1215020697 1545 dbSNP
rs1020700791 1546 dbSNP
rs1485259329 1547 dbSNP
rs765953849 1548 dbSNP
rs181306787 1558 dbSNP
rs186532483 1571 dbSNP
rs1329549130 1575 dbSNP
rs987517060 1578 dbSNP
rs1382543789 1584 dbSNP
rs1383909191 1600 dbSNP
rs1296302495 1603 dbSNP
rs1185824491 1617 dbSNP
rs771992436 1628 dbSNP
rs528042140 1638 dbSNP
rs772955971 1641 dbSNP
rs996174958 1644 dbSNP
rs920799279 1647 dbSNP
rs1168881256 1648 dbSNP
rs1374472940 1657 dbSNP
rs930793586 1658 dbSNP
rs1047831044 1681 dbSNP
rs1261417265 1684 dbSNP
rs1192128325 1685 dbSNP
rs907936562 1692 dbSNP
rs950073615 1696 dbSNP
rs780950232 1697 dbSNP
rs1343186618 1705 dbSNP
rs1253269731 1713 dbSNP
rs1046106100 1718 dbSNP
rs1325647002 1719 dbSNP
rs906458755 1721 dbSNP
rs1002565775 1723 dbSNP
rs1055050177 1724 dbSNP
rs1275688563 1730 dbSNP
rs1412244936 1732 dbSNP
rs1397956228 1740 dbSNP
rs1347448945 1750 dbSNP
rs1198881037 1753 dbSNP
rs1168165095 1761 dbSNP
rs1280514347 1764 dbSNP
rs893669444 1766 dbSNP
rs1168961684 1773 dbSNP
rs1476510197 1774 dbSNP
rs1258790585 1776 dbSNP
rs571181092 1787 dbSNP
rs1442741802 1789 dbSNP
rs570986335 1790 dbSNP
rs536797144 1798 dbSNP
rs116257152 1799 dbSNP
rs1450868090 1807 dbSNP
rs747979722 1808 dbSNP
rs1008569075 1812 dbSNP
rs1019059176 1813 dbSNP
rs1234874775 1815 dbSNP
rs1335448589 1828 dbSNP
rs1393883478 1832 dbSNP
rs964404245 1834 dbSNP
rs138650394 1839 dbSNP
rs1390516164 1841 dbSNP
rs975423554 1845 dbSNP
rs1404863553 1846 dbSNP
rs1463323578 1851 dbSNP
rs1415368423 1853 dbSNP
rs2226650 1854 dbSNP
rs1472063768 1858 dbSNP
rs148864294 1864 dbSNP
rs1182616082 1868 dbSNP
rs779162279 1883 dbSNP
rs952225869 1890 dbSNP
rs563176357 1891 dbSNP
rs983560501 1891 dbSNP
rs1437826030 1892 dbSNP
rs1468778681 1892 dbSNP
rs1272235231 1897 dbSNP
rs1226546901 1898 dbSNP
rs1352732344 1898 dbSNP
rs950145791 1902 dbSNP
rs1298431917 1905 dbSNP
rs1312141421 1906 dbSNP
rs1045808978 1910 dbSNP
rs1327526116 1912 dbSNP
rs927327638 1918 dbSNP
rs552964413 1936 dbSNP
rs1055483356 1944 dbSNP
rs1345503202 1946 dbSNP
rs573109750 1950 dbSNP
rs893700774 1958 dbSNP
rs1466210652 1962 dbSNP
rs1439192307 1964 dbSNP
rs1378513993 1968 dbSNP
rs946533213 1971 dbSNP
rs1251858159 1972 dbSNP
rs1454827531 1983 dbSNP
rs1245967084 1986 dbSNP
rs1448702307 1988 dbSNP
rs1042208646 1991 dbSNP
rs1215745310 1994 dbSNP
rs902338979 1994 dbSNP
rs535002184 1999 dbSNP
rs1018677802 2002 dbSNP
rs900194335 2004 dbSNP
rs1274676608 2006 dbSNP
rs1434739289 2014 dbSNP
rs1328519561 2019 dbSNP
rs1319596564 2020 dbSNP
rs1419564551 2021 dbSNP
rs1358713382 2024 dbSNP
rs995827660 2027 dbSNP
rs751634639 2034 dbSNP
rs111260502 2058 dbSNP
rs1424685575 2059 dbSNP
rs952259881 2062 dbSNP
rs1476282963 2068 dbSNP
rs1242446574 2077 dbSNP
rs578144462 2078 dbSNP
rs543977312 2082 dbSNP
rs983591663 2086 dbSNP
rs866522351 2096 dbSNP
rs1478592235 2106 dbSNP
rs1015081350 2110 dbSNP
rs1158363646 2112 dbSNP
rs1276090757 2115 dbSNP
rs1215918154 2116 dbSNP
rs1410127608 2117 dbSNP
rs1341911377 2119 dbSNP
rs749916934 2132 dbSNP
rs1271082456 2140 dbSNP
rs971587095 2151 dbSNP
rs1339089466 2163 dbSNP
rs1314889072 2171 dbSNP
rs1415454137 2179 dbSNP
rs746087145 2180 dbSNP
rs557440270 2189 dbSNP
rs981959433 2192 dbSNP
rs927388900 2198 dbSNP
rs1169688090 2200 dbSNP
rs1476822627 2209 dbSNP
rs1259497568 2220 dbSNP
rs779616274 2242 dbSNP
rs1482659672 2244 dbSNP
rs758023841 2247 dbSNP
rs1235170960 2252 dbSNP
rs1385122757 2255 dbSNP
rs1307707076 2256 dbSNP
rs937354533 2265 dbSNP
rs753362584 2266 dbSNP
rs1295681172 2267 dbSNP
rs1229354451 2268 dbSNP
rs1378538169 2281 dbSNP
rs1331888056 2283 dbSNP
rs1444719155 2288 dbSNP
rs1355302820 2293 dbSNP
rs574122023 2294 dbSNP
rs1238531015 2295 dbSNP
rs1286259215 2301 dbSNP
rs915168048 2304 dbSNP
rs1165564027 2315 dbSNP
rs1330886171 2316 dbSNP
rs1228982144 2318 dbSNP
rs1411075151 2318 dbSNP
rs543219543 2319 dbSNP
rs946647730 2321 dbSNP
rs1178430061 2322 dbSNP
rs1049175536 2325 dbSNP
rs1480779631 2326 dbSNP
rs1353723785 2327 dbSNP
rs887855711 2329 dbSNP
rs1211091246 2332 dbSNP
rs1196314664 2336 dbSNP
rs1456741967 2336 dbSNP
rs1275368954 2339 dbSNP
rs1377676247 2339 dbSNP
rs139531277 2339 dbSNP
rs797001551 2339 dbSNP
rs1042324916 2340 dbSNP
rs902370061 2341 dbSNP
rs1179523063 2342 dbSNP
rs1457409042 2342 dbSNP
rs867175230 2343 dbSNP
rs1473766112 2344 dbSNP
rs1176403305 2346 dbSNP
rs1040540875 2347 dbSNP
rs996248593 2348 dbSNP
rs1285320532 2349 dbSNP
rs559778092 2349 dbSNP
rs567954259 2350 dbSNP
rs1165088988 2351 dbSNP
rs1027243227 2352 dbSNP
rs1391457711 2358 dbSNP
rs528786712 2361 dbSNP
rs1385992122 2365 dbSNP
rs887437586 2366 dbSNP
rs1290595159 2369 dbSNP
rs1391059095 2372 dbSNP
rs1306380839 2373 dbSNP
rs1156291168 2382 dbSNP
rs1436243440 2382 dbSNP
rs772181000 2383 dbSNP
rs1197659352 2385 dbSNP
rs1352140203 2394 dbSNP
rs1410204063 2413 dbSNP
rs1188812193 2421 dbSNP
rs1488893925 2421 dbSNP
rs1292654942 2424 dbSNP
rs181023631 2425 dbSNP
rs1246813074 2432 dbSNP
rs1256837898 2439 dbSNP
rs1232759919 2440 dbSNP
rs1310225708 2442 dbSNP
rs1297384501 2449 dbSNP
rs1400599658 2456 dbSNP
rs1339754099 2459 dbSNP
rs1015113737 2464 dbSNP
rs1416112386 2472 dbSNP
rs1402240423 2476 dbSNP
rs1464177086 2483 dbSNP
rs972002859 2483 dbSNP
rs747012105 2495 dbSNP
rs1376338242 2499 dbSNP
rs1173262233 2504 dbSNP
rs1478460123 2509 dbSNP
rs1338124610 2511 dbSNP
rs1192072116 2513 dbSNP
rs1202652932 2515 dbSNP
rs769241321 2518 dbSNP
rs981607441 2536 dbSNP
rs1200108270 2545 dbSNP
rs1482391881 2551 dbSNP
rs1252924807 2567 dbSNP
rs1276301565 2569 dbSNP
rs143576263 2570 dbSNP
rs1276260903 2571 dbSNP
rs1183336483 2573 dbSNP
rs368664317 2577 dbSNP
rs776939937 2584 dbSNP
rs958782357 2588 dbSNP
rs530427843 2589 dbSNP
rs1422588719 2591 dbSNP
rs186325396 2595 dbSNP
rs1398142426 2597 dbSNP
rs914614673 2603 dbSNP
rs572137020 2607 dbSNP
rs191119702 2608 dbSNP
rs1369174594 2612 dbSNP
rs1466494483 2630 dbSNP
rs1423310250 2631 dbSNP
rs1169173348 2637 dbSNP
rs1429149936 2637 dbSNP
rs1474027442 2641 dbSNP
rs1369188286 2647 dbSNP
rs946010219 2649 dbSNP
rs1167020770 2653 dbSNP
rs567370723 2659 dbSNP
rs529821965 2663 dbSNP
rs1199463437 2665 dbSNP
rs1457156485 2666 dbSNP
rs1302045677 2689 dbSNP
rs923851538 2691 dbSNP
rs140664204 2692 dbSNP
rs1356954894 2705 dbSNP
rs1040167687 2715 dbSNP
rs1241961088 2719 dbSNP
rs921685922 2725 dbSNP
rs931766389 2726 dbSNP
rs1048795854 2731 dbSNP
rs1445499869 2732 dbSNP
rs887468795 2733 dbSNP
rs1313322644 2742 dbSNP
rs1004494228 2752 dbSNP
rs1329713350 2756 dbSNP
rs1407640765 2760 dbSNP
rs1325391795 2768 dbSNP
rs182867294 2776 dbSNP
rs765686624 2782 dbSNP
rs1471869084 2783 dbSNP
rs1342450328 2784 dbSNP
rs1382175754 2784 dbSNP
rs1179510570 2788 dbSNP
rs1439300691 2789 dbSNP
rs1236206195 2792 dbSNP
rs907430846 2794 dbSNP
rs1452155141 2797 dbSNP
rs1209627631 2800 dbSNP
rs1255804987 2803 dbSNP
rs566756459 2809 dbSNP
rs1034555501 2814 dbSNP
rs777641910 2819 dbSNP
rs374647311 2820 dbSNP
rs866213201 2822 dbSNP
rs1011689506 2838 dbSNP
rs1239057817 2842 dbSNP
rs1374197959 2846 dbSNP
rs1202744745 2847 dbSNP
rs1439026750 2853 dbSNP
rs1021703015 2857 dbSNP
rs1257475229 2868 dbSNP
rs1404035195 2872 dbSNP
rs1362598843 2874 dbSNP
rs1159321350 2875 dbSNP
rs1449001019 2877 dbSNP
rs967383880 2879 dbSNP
rs148111318 2881 dbSNP
rs1174489402 2884 dbSNP
rs977394819 2889 dbSNP
rs1245849229 2893 dbSNP
rs923857151 2895 dbSNP
rs1489223443 2898 dbSNP
rs1263358948 2902 dbSNP
rs1351118643 2903 dbSNP
rs1280332831 2905 dbSNP
rs773035874 2912 dbSNP
rs976397906 2915 dbSNP
rs1450355795 2916 dbSNP
rs1435028814 2919 dbSNP
rs8504 2930 dbSNP
rs1298929170 2932 dbSNP
rs1358663433 2937 dbSNP
rs931799066 2955 dbSNP
rs1415201156 2967 dbSNP
rs1048827121 2988 dbSNP
rs1478785650 2988 dbSNP
rs766077201 3005 dbSNP
rs866306418 3008 dbSNP
rs1192791145 3011 dbSNP
rs1467364119 3014 dbSNP
rs908939410 3017 dbSNP
rs1303428472 3018 dbSNP
rs538777059 3020 dbSNP
rs1210457009 3025 dbSNP
rs1441480706 3033 dbSNP
rs1278403988 3051 dbSNP
rs571618855 3054 dbSNP
rs1387802641 3055 dbSNP
rs1320387347 3057 dbSNP
rs142880971 3077 dbSNP
rs751142037 3088 dbSNP
rs557149529 3089 dbSNP
rs1167796752 3095 dbSNP
rs776609286 3109 dbSNP
rs1299184117 3128 dbSNP
rs1338543387 3129 dbSNP
rs187545529 3131 dbSNP
rs1449116939 3145 dbSNP
rs754379112 3149 dbSNP
rs542838961 3154 dbSNP
rs796867691 3155 dbSNP
rs1003163533 3161 dbSNP
rs11544096 3169 dbSNP
rs1400672027 3177 dbSNP
rs778143611 3181 dbSNP
rs751968732 3183 dbSNP
rs1169888137 3187 dbSNP
rs1476792477 3189 dbSNP
rs1235867871 3196 dbSNP
rs1056430236 3198 dbSNP
rs767501620 3199 dbSNP
rs752562900 3200 dbSNP
rs1459375551 3205 dbSNP
rs1259045566 3212 dbSNP
rs1021735728 3213 dbSNP
rs575012686 3214 dbSNP
rs1314991205 3218 dbSNP
rs1228940504 3220 dbSNP
rs1378469601 3222 dbSNP
rs1313230445 3225 dbSNP
rs1465387380 3227 dbSNP
rs1449199634 3231 dbSNP
rs998863973 3233 dbSNP
rs1019646103 3234 dbSNP
rs1464035501 3236 dbSNP
rs1351521443 3238 dbSNP
rs1165330130 3243 dbSNP
rs756005245 3243 dbSNP
rs1410897313 3248 dbSNP
rs1180140831 3252 dbSNP
rs1434753016 3253 dbSNP
rs1176541663 3257 dbSNP
rs1439911972 3266 dbSNP
rs1239245631 3267 dbSNP
rs1178379541 3268 dbSNP
rs976050244 3273 dbSNP
rs1267780243 3276 dbSNP
rs1455605863 3297 dbSNP
rs757468541 3304 dbSNP
rs1377886552 3307 dbSNP
rs1308320343 3308 dbSNP
rs953227495 3310 dbSNP
rs1388781228 3311 dbSNP
rs1369410456 3314 dbSNP
rs984566714 3317 dbSNP
rs1419976907 3323 dbSNP
rs1491469160 3323 dbSNP
rs3831479 3323 dbSNP
rs558995076 3323 dbSNP
rs774369361 3323 dbSNP
rs908970698 3323 dbSNP
rs777515083 3327 dbSNP
rs1156406072 3331 dbSNP
rs1417739356 3332 dbSNP
rs1269832977 3334 dbSNP
rs1192342559 3343 dbSNP
rs1488437216 3349 dbSNP
rs1266914585 3353 dbSNP
rs1218857660 3355 dbSNP
rs1369297004 3369 dbSNP
rs940413301 3371 dbSNP
rs759799704 3386 dbSNP
rs1313750422 3387 dbSNP
rs972218900 3387 dbSNP
rs928341822 3388 dbSNP
rs1284361010 3395 dbSNP
rs1218645031 3402 dbSNP
rs1343534798 3407 dbSNP
rs1299553559 3411 dbSNP
rs202174125 3418 dbSNP
rs550063451 3418 dbSNP
rs1227141972 3425 dbSNP
rs1467247931 3426 dbSNP
rs1270544024 3429 dbSNP
rs1379799671 3432 dbSNP
rs1056061938 3433 dbSNP
rs1433164018 3436 dbSNP
rs572413682 3437 dbSNP
rs1427839147 3438 dbSNP
rs1330003594 3439 dbSNP
rs894705872 3442 dbSNP
rs1488659142 3448 dbSNP
rs191769165 3455 dbSNP
rs1245001199 3456 dbSNP
rs1484358757 3464 dbSNP
rs750694073 3479 dbSNP
rs1232236314 3483 dbSNP
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target xx
Validation Method
     
Conditions MKN1 , MKN7 , MKN28 , MKN45 , SNU1 , SNU16 , AGS , NCI-N87 , MGC803 , SGC7901 , GES1 , HFE145
Disease gastric cancer
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Targeting YAP1 by tumor suppressor miRNA miR-15a and miR-16-1 plays inhibitory effect and this might have a therapeutic potential in gastric adenocarcinoma ...

- Kang W; Tong JH; Lung RW; Dong Y; Zhao J; et al., 2015, Molecular cancer.

Article - Kang W; Tong JH; Lung RW; Dong Y; Zhao J; et al.
- Molecular cancer, 2015
BACKGROUND: MicroRNAs (miRNAs) have been reported to play an important role in tumorigenesis. In this study, the role of miR-15a and miR-16-1 in gastric adenocarcinoma (GAC) was investigated. METHODS: The expression of miR-15a and miR-16-1 in cell lines and primary tumors was examined by miRNA qRT-PCR. Proliferative assays, colony formation, cell invasion and migration, flow cytometry analysis and in vivo study were performed by ectopic expression of miR-15a and miR-16-1. The putative target genes of miR-15a and miR-16-1 were explored by TargetScan and further validated. RESULTS: We found that miR-15a and miR-16-1 were down-regulated in GAC cell lines and primary tumor samples compared with normal gastric epithelium. Functional study demonstrated that ectopic expression of miR-15a and miR-16-1 suppressed cell proliferation, monolayer colony formation, invasion and migration, and xenograft formation in vivo. In addition, miR-15a and miR-16-1 induced G0/G1 cell cycle arrest which was further confirmed by Western blot and qRT-PCR of related cell cycle regulators. YAP1 was confirmed to be a functional target of miR-15a and miR-16-1 in GAC. YAP1 re-expression partly abrogated the inhibitory effect of miR-15a and miR-16-1 in GAC cells. In clinical samples, YAP1 protein expression shows negative correlation with miR-15a and miR-16-1 expression. CONCLUSION: In conclusion, targeting YAP1 by tumor suppressor miRNA miR-15a and miR-16-1 plays inhibitory effect and this might have a therapeutic potential in GAC.
LinkOut: [PMID: 25743273]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.725 4.5e-5 -0.569 2.3e-3 23 Click to see details
GSE19783 ER+ ER+ breast cancer -0.452 2.3e-2 -0.451 2.3e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.329 5.8e-2 0.318 6.5e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.288 8.1e-2 0.418 1.9e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.164 9.8e-2 0.198 5.8e-2 64 Click to see details
GSE32688 Pancreatic cancer 0.228 1.0e-1 0.139 2.2e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.361 1.2e-1 0.336 1.4e-1 12 Click to see details
GSE28544 Breast cancer 0.22 1.5e-1 0.554 2.5e-3 24 Click to see details
GSE19783 ER- ER- breast cancer 0.101 1.9e-1 0.064 2.9e-1 79 Click to see details
GSE19536 Breast cancer 0.089 1.9e-1 0.059 2.8e-1 100 Click to see details
GSE17498 Multiple myeloma -0.131 2.1e-1 -0.010 4.8e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.241 2.1e-1 -0.214 2.4e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.133 2.6e-1 0.152 2.3e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.14 3.0e-1 0.206 2.2e-1 16 Click to see details
GSE17306 Multiple myeloma -0.068 3.2e-1 0.012 4.7e-1 49 Click to see details
GSE21032 Prostate cancer -0.037 3.7e-1 -0.040 3.6e-1 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.044 4.3e-1 0.096 3.4e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.012 4.6e-1 -0.017 4.4e-1 90 Click to see details
GSE38226 Liver fibrosis -0.001 5.0e-1 0.037 4.4e-1 21 Click to see details
GSE38226 Liver fibrosis -0.001 5.0e-1 0.037 4.4e-1 21 Click to see details
GSE38226 Liver fibrosis -0.001 5.0e-1 0.037 4.4e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.658 0 -0.698 0 32 Click to see details
PRAD -0.387 0 -0.261 0.03 50 Click to see details
PAAD -0.99 0.01 -1.000 0.5 4 Click to see details
BLCA -0.436 0.04 -0.465 0.03 18 Click to see details
CHOL -0.503 0.08 -0.667 0.02 9 Click to see details
COAD -0.522 0.09 -0.619 0.05 8 Click to see details
HNSC 0.202 0.1 0.160 0.16 42 Click to see details
THCA -0.154 0.12 -0.186 0.08 59 Click to see details
BRCA -0.105 0.17 0.003 0.49 84 Click to see details
LUAD 0.281 0.19 0.308 0.17 12 Click to see details
KIRC -0.103 0.2 -0.059 0.32 68 Click to see details
KIRP -0.118 0.26 -0.082 0.33 32 Click to see details
UCEC 0.128 0.3 -0.009 0.49 19 Click to see details
ESCA 0.148 0.33 0.127 0.35 11 Click to see details
CESC -0.449 0.35 -0.500 0.33 3 Click to see details
PCPG 0.319 0.4 0.500 0.33 3 Click to see details
KICH -0.039 0.43 -0.013 0.48 25 Click to see details
LIHC 0.015 0.46 -0.020 0.45 49 Click to see details
LUSC 0.007 0.48 -0.022 0.45 38 Click to see details
LUSC 0.007 0.48 -0.022 0.45 38 Click to see details
LUSC 0.007 0.48 -0.022 0.45 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*