miRTarBase - #MIRT051343 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PTAR1   
Synonyms -
Description protein prenyltransferase alpha subunit repeat containing 1
Transcript NM_001099666   
Expression
Putative miRNA Targets on PTAR1
3'UTR of PTAR1
(miRNA target sites are highlighted)
>PTAR1|NM_001099666|3'UTR
   1 AAGAGGTGAATTAGTCCTACAAGGTTCCCCTTTTAGTGCAATATTGCTTTCTTTTATTATTTACATAGTTGCATGAACTG
  81 TTTACTATTATTGGCTAACCATATGTTCTTCGTCTTTAGGTTGAAAGTCCATAGTAAATCTTTCATTTTATTTATTTTGT
 161 TAATAACTGGCATTCCTGTGGGGATAAAATAATCGTATAGTTCCTTCCTGCTGAACAGCGAGTCTTAAATTTTCTGTTTA
 241 ACTTCTCACCCTTTGTATTTCTATATGTGGGGCTTCTCATTTGGTTTTCCTGATTGGTTCACACACACACACCTCTACCC
 321 CCCTCAGTCCAATTGCTGCATAGGCAAATTCTTTTAAAAATTAAAAATTTAAGGCCTAGGCAGGAGGATTGCCTGAGCCC
 401 AGGACTTTGAGACCAACCTGGGCCACATAGCAAGACCCGATTTCTACAAAAAGTAAAACAAAATAGCTAGGCATGGTGCT
 481 ATGCAACTGTGTTCCTAGCTATGCAGGAAGCTGAGGCAGAAGGATTGCTTGAGCCCCAGGTGTTTGTGGCTGTAGTGAGC
 561 CATGATTGCACCACTGTACTCAGCCTGGGCAATAGAGTTGAGACCCTGTCTCTAAAACAAATTGAAAATAAACATTTATG
 641 TTGCAGTTCAACTGAAGAATGTTGGTATGAATGCCGAATAACTTGATGTAATTGTTTTGAGAATCAAATGGCTAGATGGG
 721 CGAATGTTTAAAAATGTAAACTAGTTCTCTTTCTCTAGCATGTTCTACCCAATTACCAAAGTCAGAAGTATTGGAATTTA
 801 TATGAAAAAAATGCTTCCAATGTAATCCATTTTTTAAATGGTTATTTAAGAAAAAACTAACTTAAGAGTTTATGTAATTG
 881 CAGTAAAGGAAAATTATTTTTATTGCTAGTTTTGATAGATTATTTTTACCTCAAATTTGGTATATGCCAAAACACATCAG
 961 TCCTTATAAAATTGATTTTTTTTTCCTGAAAACCTGGAATGCCATTTTTAGCTATTACTACTTTTTAATTTCAAATTCAC
1041 TTATGACAAATGGGAGAAATATATAAAGAAATAGATCCATAAAAATATTCCTTTTTAAAAATCTAAATTATTGAGGATAC
1121 ACTATGGAAACTATAAAATTATCATGAAGTGACTGTTAAAGTTTACTGGCAAATGCCAAGGGAAGGAATAGTATGTGCAA
1201 AACAAAACACTTTGATACTGAACTTAATCAGGGATGAGGTACCAAAGTATCCACATTATAGCCGTATCTTATGTTTCCAA
1281 TAACAAGGGCTGAGTTTTTCAGGTAGGTGGGATGAGGGTGGGGAATGGGCCATGTAATGTCTGCTTTCTTATATTTGCCC
1361 TTTTGTAAGTGGTCTGTTTCTTCTTTTCATATACTTTGTTTTGCCAATCCATTACGTATTTTTTGTCACTTTTGTGTGTC
1441 ATTTTTGTATACCTTTCCTTTCTTACTTCAGGGGTGTGTCTTCAAGATTTCTACCCCCTATTTGCAATGAATTTCATACC
1521 TCATCTAAAATACATTCATATACCAGAAATATGAAGAGTGGCCCTTCTAAAAGTTTCCCTAATGATGGAAGCTGTCAGTT
1601 GTCCTATCTGTGCAGAATGTGAGTAATAGTGGCAGAAATAAGTGTGACAACAATGCTTTGCCTGTTGTTCTTTTTACTTG
1681 CTAGGTAATTTGTAAAGTGGGGATAAAGATGTAGGGAAAGTAAACCTCTCTCTCACTGTTACGGAAAGCCTGGACTTGAG
1761 TTAGGTAGACTGCCTTAAAGAAGAAGAAATATGTCCTTTTCTTTGGCATCATGGTTTTGTTGAGTGGCAGACTGTTGAAG
1841 TGAGTTGAGACTTAAGAACGCCAGAAAAGTTGTCTAGCCTGGCCCCAGTAGACAGAATTTGTTCTTCTCTCAAGTAAAAA
1921 ATTACCTTTTTATAGCTTTTATATTATTTAGATGAAAAAATACCATTATGAACATAATTCCATGGCCCTTTGTGTACAAA
2001 GCATATTTTGAATTAAATACCTCAAGGTCCACCTAGACCTCTATGGATAAAATCATAAGTTTATGATTTTTAGCTCCTGT
2081 GAGTGTTTGGGGGCAAACTACACAGAGAAGACATGGGTGGTTCAGCCCATTCCACTAAAATATGTTGCCAGATTCTGGCC
2161 TAACTCAGTATTACCTTTTTTCCTAAAAATCATTTTTCACATTTTGAGTAATAGGGCTTATGCTTTGATGTGAAAAAATG
2241 TCAGGAAATGAGTGTAGACAATACCCTATAAAACACTAGCTAAGTTTTATAGTGCTCCATGCCTTTGTGTACCTTCCACT
2321 GATTATCTTGCCTATCTTTGGTGTGTAAACTATTTTCATATCTTCTAAGGCTCTTAACCCACTCTTTTCTGAAGCCGCAC
2401 AGTCCTTTAATATGTCTTGTTTCCTTCCTAAAAGTTTAAAGTAGAGAGCAAAAATGCAAATACCCAAAGGATACTGTTAG
2481 TATGTAACTTTTGTGTGCTGCTTTATTTCTAGAGTTTGCATTTTTTAATTGTTCATTCACAGAAAATCCTAATATTGCCC
2561 TATATGGTTGGTTTTTTTCCTAAGTGGTTAATATTTAAACCCGCTAGCTGTAGCATGATAATGTCTTTGACTGAGCTTAT
2641 GTAGTAGAAAGGATGTGTCTGTTTTCTGGGACTTTTAGTCTTCACTTATTTTTCTATAACAATCTAATTGTTAAAAGGAA
2721 AAGATGGCTTATTGACACATATTTCATTAAACTTTCACTGGAAGAACAGTGGGTCATCCTACTGTGGATTAAGAATACTA
2801 CTGACAAGCAAAAAGCATTAAGCTCTGTAACTGTCTCCAACACCACCTTCACCCCGCCTTTAGTGTACCTTAGTGTACTT
2881 TAGTGTACCTATTTTGGCAGTACGGTGTTTTCCAGATTCTACTTGTGCCCTGCACATTGTGAGGACTCATTAAATATTTA
2961 TTAAATTAATGAATGACTAACAGGAAGAGAAAGATTGTTTGTGAGTGTTAAGAATGAGTGATGATTGAGAAATTGATGGA
3041 TTAGTGCAATGGATTGGGAATGAATGATGCTTTCTAGTTTCGTAATACTTGGGAAGAGCTATTGCATATAGAGTAAGTTG
3121 ATTTAGACTTTTTTTTTCTTCATTTCATTACCTTGTTTAAACTTGTTAAATCCCAGCCAAGAAATGCAGCTCTGTAATTG
3201 TCAATTAACTGTATTATAATATATATTAAAAATTTGTAGAGCTAAAGAACCCACTTGCATTAAGAACACCACTTTCTGTT
3281 CATTTGTGATACTAGAGGACAGATCCTGCATACAGAGCCGAAACTGCTTTTAATCATCTGAAGAAATTCTTTGATTTCAG
3361 TGACTTACTGATCTGTACCTGTGCACATATCATTTTATGCTTCTCCTTTTTTCCCCGCAACTTGAACTGTGACTCTTTCA
3441 GATATTTCTTAAATCTGTATGAGTCATTTTTTAAGCTTAGGGATTTGATATGTATTAATGTCCCCTTTGTCTTCTGTAGA
3521 TTTTAGCATTTTATTACCTCTTAAGAAACTCTGGGCCCAGACTTTCAGTCATATTTCTTATTCCTATGGTACAGTTCTCA
3601 CTTAAAGGCTTAATTATTAGTAGGGTTAAATATATACAGGTTATCTCTAAAAGTACTTAAATTTTTAAATAAGGGCTTAT
3681 GTGATACAAGATACGGAAACAAAAGTTTTTGGATTTTTATGCAGTAGTTTGCAGGAAAGCAAATACATAGTAGATCGTAT
3761 GCCACTTAGGTATGTTCAGGTCATGCCAGTTTATTCTTGTTGGGCCACACACACATGTATGTGTGTGTAAAAGGAATTTT
3841 TAGTATTGAAGCAAACAAATTGTCAGTTTAATAATTTTCTCTTACATAGCACAAGATGGCAGATACCACCTACTGTACAA
3921 CAATCTAATAATCCCTACCTTAGTTCCCCTGAGTTATAGAAGATGCTAAAGATTTAGTTGTAAAGGGAAGTAACATGATT
4001 TTTTTTTTCTAAAAAGCTGTTTTAAGCTAACTATTATTTTGCTACTGGAAAATTATATTTTAAAACTTACAGATATTTAA
4081 AGTATGCTAGAAAATTTGAACCTGATAACAACTGAACCTTTTGTCTTGAATAAATTTCTCAAATAGAACTGTGCAAACCC
4161 TAGCACTTTATGTGTTGCTGCCTCCCCATACCTAGGTATGCTCTGTAATAAGCTCCCATTTAATGGAGAGATGTGTGGAG
4241 GCACTGAGAAGTTAATGAAGAAAAATCAACCCTAAGAATTCCTTATTGTCACATAGTGTCTTTTAAAAAATAACTGTAGA
4321 GACTGTGTTAATTCGAGTGCCTTTCTTACTTTTTTGGGAGCAAGATTATATTTAATGTTTAAGAAAACAGGATGGAAGTT
4401 TTATCAAACAGTTGATTGTGGCCCATTGTTTTATTTATTCCCATCGCTAGGCATGGCCCCGTAGGGTATTTTATCCTTCA
4481 GTGAGAGACTGATATAAGCAGGCAGGATGCTTTGATTATTCCATTAGTTATCATTTTAAGCACCCTACCAAGATTTAGTT
4561 CTTTCTTTCTGGCAACTAACGTTTTGGGGGTTGGAGGCATCCCATTTAGAGGATGGTGTGTGCACAAATAGATTAGCCTG
4641 AAACCTGCGTCCAAAGGGAAACAGTGGCACTCTGCCCTAAAATAAAGGCCAGAACGTTGTCCTAAATGAATCCTTTGCCT
4721 TACTTTAGGACCTTCCTTCCCTCTCAAATTCAGGCATAATGTAATATAGTTGAAAGGGGGAAAACAGTACTTGCTTTCTC
4801 TCAGGTATTGGAGGAAAAGAAGTAAATGCGTAGATGAAATTTTAAATGTATCATTTTATCTGTTTGTATATGGAGAAGGG
4881 AGGGATAGGAATTCCATATTTCAAGATAGCAAATATAATTTCATAGAAATATATAGCTAAAGATTCCAAAGTGCTTTTAC
4961 AGAGAACTGTTGAATAATATATTCCTAAAGGGCAGCAATATGCCATGTTCATGGTGAAGACAGAAAACCAATGAATCAGT
5041 TGTGGATCTCAGGTGGGAGAGGAAACCTCAGGCTCCCAACTTTGACTTCTCTACTCTCACCAGGCCATGTTAACACTGTA
5121 AAACCAAACTCTTTGCTAAGAACAATACAGGGCAGTAGTTTAGTCTGCTGATGAAACCTTGTGCTTCCAAGAATATTAGC
5201 TATATATAATTTGTGCTTTCTGGATGATTCTATTGTCCAGAAAGCTAACCCTGACGTTACTTTTATTAGTCTGTTGTTAT
5281 TCCTCAGGGTGTAGAAGATTTAGTAAATTCAGGACAAATTTTATATTCAGTGGCAAAAAGAAAAGGCAAAAATATGCTAA
5361 ATATATTATTAGCTCTTAAATTTTAGTATAGATCGTATTTTTTATAAACTATTACCAGTACAGTAGCTAGTAGATATTCT
5441 GTGACTGCCTCATTGTTTATCTTGCTGCTTTGGTCCCTATGGCTCTAGTATGAACATTCTCGTGTCTTCTGTGGAAATGA
5521 TTTCTGTGTTATAGTTCCATCTTTGGTAGAGGTGGGGATGATTGTATTTTGTTTTAGTTGACATCATTCTCAACTTTTAG
5601 AAATACTGTTGAGGAAAATGATTACCGTTGGTTTTCAAATTGACAACTATTTTGCTTCCAAAGACTTCAGTTTCCCTTTG
5681 TTTTATGTGTAGACCTCATATATGTTCAACACATTGCATACTGCCTTGCACATTGTAGGAATTCAACAAGTCAAGAGTTG
5761 ATAAAAGCTAGAAAGATAAAACTAGCTTAGCTATCATATCATCATTGTCCATATTCTTAGCTTTGGGAAAAATATACCAT
5841 TTTGCATAAAATACATAATCAGTTTCAAATGCATAAGGCAAAGATATACAGTTGCACAACATTGCAAGTGAAATTTACAA
5921 AGGATTTTTATTTTTGTGTATGCTAAAAGTGCTCCTACTTAAAGCAGTTTTCTTTATTAGACCAACACCTTCCAGCAAAG
6001 TTAGAAACCAAACACAAGTGCTCATTTGCCCAAATTAACCAGATAGTTATGTAAACTGTTCATATTAAGTCTTTAGTGGT
6081 TTACAAACAATAACATTCTGGCTTTTCTTCCATACCTTTTAGGAATCAGCCTTAATTTTAAGTATAGCAGTCACTTTCCT
6161 CAAGGTACTATGCAGCATACTTTAGATTGCTTATTTATCATTATAAGGTGATAGGTAATAAATTTGAGGTTTACTTGTCA
6241 TATAATTTCATATGGCAGATATTGATTCAAGGAGCATTCTATTAGAAAAAGTTGATAAATTATCCTCCCTTACAAATATC
6321 ATCTTGCATTTGGAGCAGGTATTTTTTTCTTATTAGTTAAAGACTGGGTACAGTTATAGTAGATGCTCAATAAATGCTTA
6401 GTCAGTGATTGATCTAACATCAAACTAACAGCTTTCAGAAAGGAGACTGTTGACATCTTTTCACCAAGGAGTATATTTGT
6481 AGAGTAATATATGTGTGGAATTTTGAAATTATATCATTTGACATGATTTATGAGGCTTATTTAAGCTGGAGTTAGTAACG
6561 TAATAGAAGTATTATTTATACAGAACATAGTTGAAAGATAGGAGATGTGAAAGATTAAGTAGTATTTTCTTGTGCAAGGC
6641 ATATTAATAAATGTAATTAAATGTCTTAATAAGCAGCTGGCTGAACTCTAGAGAGAACTGCTGTAGTCTTCTGCAATCAG
6721 TCTCTGTATTGGTATATCCAGTACTATCGGGTTTAGGTTCTTTTTATTTTTCCTTAAATCTTACTTGTTTCTAGCGTCTT
6801 AAGAGTGGTAATGGTAAAATGTGAAGTTACAATAAACTTCTGCTTGTTTTCTCAGAACATCTTTGGCATGAGGAAGAACT
6881 TTTTGTGAATGATACAGTAGTCTCAGCATCTGTTAATTTGTGGTTTTCAAAGCATTTTTGACAGAGTTTACCTAATGTAA
6961 AAAGATTAAACAGTTTTATAAAACACAAATAAACATTCCTACCTGAACTGTGAGGAACAGAGTGTATAGTACAAATGTAA
7041 TTAGGCATTGCCTCCTGGCGAGGTTCTTGATGCATGACTTCGATGCTGGCTGCTGACTGAGGTGACCACTGTCAGTATTG
7121 TACTTTGGCATATGTTGTTTTTAGGAAAATAATGGAATGCATTCTTAGATTAACTTACTGTTTTTGAGTTGGAAAAAATA
7201 AAAGATGAGGTATTATAAGTATGCCAAATATTTATACACTACAAAAGATTAAAAAAGGAGAGGGAGAAAAAAAAAGGCCA
7281 GTTATGATTTTAATAGCGTCTAATTTTTTTTTGACTCGAATTTTGTGGACACTAGTCAATTGCATAATTTAACATGGAGG
7361 AGCTTTCATTTAAAAGAAGTTCTCAGCTACTATATTCTGCCATTAAAATTAACCATGCCTGTTAATTTTACATTGCTTGA
7441 AGATATAAGTAAGCTGCCGTCAATATTGTTTTAAGATTTTCTTATAGTTTATGTTTAAATGGAAAAGTTACATATATAAT
7521 CTATGGTGCAGGGTCAGGCATTGGCCATTAAAGATAAGTTTGGCTAACTATTTTACTGAAGAGACTAATGGTCTTCCCTC
7601 TGTTGTACTGCTATGTTTCTTGATCTGTTTTTCCCCAATGTAACAGTCTACATTGAAGTCCTTTAGCTCTCTCCATATAC
7681 TAATTGACATTTGTTAAGGATTCAATATTTTGTGAATTCTTTTTACCCTTAAAATGCATATCTTTCAGAGAGATAAGAAT
7761 GAATTTTGCAATAATTTATATGCAGAGTGTGCTTATGGGTTTCTGGGAGTTCAAGTTAGTACCCCAGAGTGCTTAAAAGT
7841 ATGATGCTAAATTCTAAGGCTAATGTAATGACTGTAGATTATCTATGTCCACATTGTTCAACAGAAATATAATGTGAACC
7921 ACAACATAATTTTTAATTTTCTAGTAGCCATATTAAAAAAGAAACAAGCAAAATTAATTTTAATAACAGTTTATGTAACC
8001 CAGTATATTAAAAATATCATTTCAACATGTAATCAATATAAAAGATTATTAATGAAACACCTTATCTTCTTTTTCTTCCA
8081 TACTAAGTCTTAGATTTGAGTGTATTTTGCACTCACAGCACATCTCAATTCTGACTGGCCACATTTTAAGTGCTCAGTAG
8161 TCACATATGGCTAAGGGCTACTATACTGGACAGTACAGATTCATAGAGTATAAAATATGACTTTAACTTTGGAGATGGTG
8241 AGGTAGGCCTGTAATTATGGTACTTTAAAAATTCAGAATATTTAGAAAAGCATCTAATAGAATTATCCACTTGTTTTCCT
8321 TCATCTTCATTTTAATATGTTCTAGAAGTAGGATCAGCCTGTTCCAATTTGCCAAGCATTATTAAGGAGGAATAATTCCA
8401 TACCATGTAAAATACCATGATATGCTGATTATACTACATTAACAAATTTTTAAGTTGCGTTCACTAAATTCTGTCCTGTT
8481 TCTTCAAAATAATATAGCTTAAATTGCATGTTAATTGTATATCTTACCTATTTTGTTTTTATATTATTCTTACAATATAA
8561 TCATGTATATTAACAAACAGCCCTGGGATTCTAATCTTCCTCTGCAACTGTCTTCCAGGACTTACTGGCACTTATTACAC
8641 TGTGATAAGTGGCAGAAAAGTAGAATGAAATATTCTTTTTCCATTAGATTTGTTCTTATGTGACCATGTACCAAGCCAGC
8721 TATAAAGTATTGTATTTCTGTAGAATATGGAAAATAGTATTTGTCTTACCTTTGCTAAATGTTTGCAATTTCTAAGTAAA
8801 CCTTTTATCTCCTAAAATGAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |||: ||:||||||||| 
Target 5' atgtAACTTTTGTGTGCTGCTt 3'
2482 - 2503 174.00 -19.40
2
miRNA  3' guGUUUG-----GU--AAUACACGACGAu 5'
            |||||     ||  |||||||:|||| 
Target 5' tgCAAACCCTAGCACTTTATGTGTTGCTg 3'
4152 - 4180 158.00 -21.00
3
miRNA  3' guguuugguAAUA-CACGACGAu 5'
                   ||||  ||||||| 
Target 5' cctcattgtTTATCTTGCTGCTt 3'
5448 - 5470 149.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30459714 29 COSMIC
COSN31557884 51 COSMIC
COSN31581460 63 COSMIC
COSN31486419 111 COSMIC
COSN31524501 112 COSMIC
COSN5704355 113 COSMIC
COSN5122778 197 COSMIC
COSN28198293 269 COSMIC
COSN5704354 292 COSMIC
COSN2325562 362 COSMIC
COSN2325561 545 COSMIC
COSN17038104 561 COSMIC
COSN16192000 565 COSMIC
COSN21313387 702 COSMIC
COSN29156294 754 COSMIC
COSN15841879 1230 COSMIC
COSN22770923 1403 COSMIC
COSN9284550 1591 COSMIC
COSN9284549 1592 COSMIC
COSN16476859 2074 COSMIC
COSN29815929 2090 COSMIC
COSN22072504 2112 COSMIC
COSN5122777 2139 COSMIC
COSN20864144 2233 COSMIC
COSN21104320 2280 COSMIC
COSN2468485 2628 COSMIC
COSN1380580 2900 COSMIC
COSN29538846 2923 COSMIC
COSN2325560 2965 COSMIC
COSN16979558 3161 COSMIC
COSN1380579 3278 COSMIC
COSN20106231 3998 COSMIC
COSN19564773 4213 COSMIC
COSN6392593 4290 COSMIC
COSN26302612 4324 COSMIC
COSN20889349 4487 COSMIC
COSN1380578 4878 COSMIC
COSN28315230 5334 COSMIC
COSN6604268 5394 COSMIC
COSN7570332 5836 COSMIC
COSN16298610 6455 COSMIC
COSN32056110 6796 COSMIC
COSN24838509 6950 COSMIC
COSN5814668 7078 COSMIC
COSN29511812 7271 COSMIC
COSN6392592 8235 COSMIC
COSN21095826 8240 COSMIC
COSN30411626 8685 COSMIC
COSN20460827 8695 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1225376992 6 dbSNP
rs1437177498 8 dbSNP
rs528027809 10 dbSNP
rs1270946071 12 dbSNP
rs369183242 16 dbSNP
rs1398400655 19 dbSNP
rs1409721050 21 dbSNP
rs755388721 22 dbSNP
rs377370044 23 dbSNP
rs780613226 24 dbSNP
rs758892052 28 dbSNP
rs1489946093 33 dbSNP
rs551569816 34 dbSNP
rs750542817 35 dbSNP
rs765449636 36 dbSNP
rs1267689556 38 dbSNP
rs1480488882 41 dbSNP
rs1315136588 42 dbSNP
rs1270088424 48 dbSNP
rs373218381 49 dbSNP
rs1416731348 62 dbSNP
rs1003932779 71 dbSNP
rs886563025 73 dbSNP
rs1412040728 75 dbSNP
rs1356074647 83 dbSNP
rs370501653 85 dbSNP
rs879610394 87 dbSNP
rs926853811 88 dbSNP
rs1406961104 89 dbSNP
rs1268561773 91 dbSNP
rs982330570 92 dbSNP
rs1435893633 99 dbSNP
rs781695268 104 dbSNP
rs879045909 111 dbSNP
rs930819713 112 dbSNP
rs1275647156 113 dbSNP
rs779805325 131 dbSNP
rs758391524 132 dbSNP
rs943603721 134 dbSNP
rs1408217664 160 dbSNP
rs1490422183 170 dbSNP
rs1200540731 175 dbSNP
rs189191748 178 dbSNP
rs1187042237 180 dbSNP
rs1391905187 184 dbSNP
rs1162740582 194 dbSNP
rs958037293 195 dbSNP
rs1032263767 199 dbSNP
rs996796227 202 dbSNP
rs1325939702 207 dbSNP
rs1431526537 209 dbSNP
rs184622934 213 dbSNP
rs750118293 215 dbSNP
rs543182055 219 dbSNP
rs986507209 220 dbSNP
rs1211277388 227 dbSNP
rs1019933112 228 dbSNP
rs766062207 228 dbSNP
rs1211424479 239 dbSNP
rs1486618600 247 dbSNP
rs576078345 254 dbSNP
rs778778459 257 dbSNP
rs1182899589 269 dbSNP
rs1385651157 284 dbSNP
rs1473620010 298 dbSNP
rs558538738 300 dbSNP
rs1311729502 302 dbSNP
rs977803415 305 dbSNP
rs1025401352 307 dbSNP
rs967877655 311 dbSNP
rs145607931 312 dbSNP
rs1055502149 313 dbSNP
rs1348948140 313 dbSNP
rs1452627073 313 dbSNP
rs991159937 317 dbSNP
rs905467469 319 dbSNP
rs1223987682 320 dbSNP
rs112575324 321 dbSNP
rs41282405 322 dbSNP
rs1179452250 327 dbSNP
rs988244325 330 dbSNP
rs1470675425 335 dbSNP
rs554072661 338 dbSNP
rs538856189 339 dbSNP
rs925359649 348 dbSNP
rs151150845 350 dbSNP
rs1337997917 351 dbSNP
rs73461071 356 dbSNP
rs1019540907 361 dbSNP
rs537997825 370 dbSNP
rs1336711427 371 dbSNP
rs1442501383 377 dbSNP
rs1289758200 382 dbSNP
rs1320838477 383 dbSNP
rs1026357477 392 dbSNP
rs987088121 395 dbSNP
rs1345326176 398 dbSNP
rs951249453 402 dbSNP
rs994857363 408 dbSNP
rs1471407344 410 dbSNP
rs142073515 417 dbSNP
rs1184621611 418 dbSNP
rs780410487 425 dbSNP
rs899341984 427 dbSNP
rs1480164176 437 dbSNP
rs1039232007 438 dbSNP
rs1429514255 439 dbSNP
rs73461069 449 dbSNP
rs1460968201 466 dbSNP
rs1181269886 469 dbSNP
rs1034081395 480 dbSNP
rs1001220050 482 dbSNP
rs890753405 484 dbSNP
rs1052440023 486 dbSNP
rs1343303217 493 dbSNP
rs1403914915 495 dbSNP
rs533893808 501 dbSNP
rs923564427 502 dbSNP
rs1332310006 505 dbSNP
rs1225173238 512 dbSNP
rs1046650304 515 dbSNP
rs1339870856 519 dbSNP
rs1210764261 528 dbSNP
rs949627437 535 dbSNP
rs1327375114 536 dbSNP
rs1490259419 538 dbSNP
rs566840177 547 dbSNP
rs1269575095 549 dbSNP
rs1426740527 568 dbSNP
rs977855820 574 dbSNP
rs1234245740 580 dbSNP
rs1374086065 581 dbSNP
rs1342682254 590 dbSNP
rs191420536 592 dbSNP
rs1396026141 593 dbSNP
rs892715250 595 dbSNP
rs1423674464 604 dbSNP
rs1361957423 605 dbSNP
rs946422128 619 dbSNP
rs936823731 620 dbSNP
rs1294801125 636 dbSNP
rs1321988375 637 dbSNP
rs35368635 638 dbSNP
rs543347220 640 dbSNP
rs914964187 651 dbSNP
rs942713699 653 dbSNP
rs1358390223 659 dbSNP
rs1324898776 667 dbSNP
rs374500274 675 dbSNP
rs569392218 676 dbSNP
rs1484945405 680 dbSNP
rs1459239914 682 dbSNP
rs1204676654 685 dbSNP
rs1262476367 686 dbSNP
rs1451947802 687 dbSNP
rs1182276879 697 dbSNP
rs1034949686 698 dbSNP
rs1366570766 704 dbSNP
rs188120236 705 dbSNP
rs1445549155 707 dbSNP
rs1165081164 708 dbSNP
rs986818683 720 dbSNP
rs577443596 721 dbSNP
rs950736923 722 dbSNP
rs763524865 724 dbSNP
rs1334531559 738 dbSNP
rs1381808362 745 dbSNP
rs1025545433 747 dbSNP
rs1463629703 753 dbSNP
rs1315393298 769 dbSNP
rs1238591772 770 dbSNP
rs879122825 776 dbSNP
rs551150758 777 dbSNP
rs749981466 786 dbSNP
rs531309489 790 dbSNP
rs899271066 791 dbSNP
rs1202335694 794 dbSNP
rs1214612175 803 dbSNP
rs1358899808 805 dbSNP
rs369416744 809 dbSNP
rs1244622895 812 dbSNP
rs1417007418 812 dbSNP
rs1007765395 820 dbSNP
rs560996320 821 dbSNP
rs148629007 838 dbSNP
rs1157841891 844 dbSNP
rs145634304 849 dbSNP
rs1299127076 863 dbSNP
rs1174211833 864 dbSNP
rs557409999 864 dbSNP
rs1363902919 866 dbSNP
rs1448627898 871 dbSNP
rs1034110747 880 dbSNP
rs1370887509 883 dbSNP
rs1391056613 893 dbSNP
rs1052024051 896 dbSNP
rs1388158755 902 dbSNP
rs1221715466 905 dbSNP
rs543825138 905 dbSNP
rs971089441 914 dbSNP
rs1313340169 916 dbSNP
rs1212854685 921 dbSNP
rs1231585116 922 dbSNP
rs1480472167 928 dbSNP
rs34238737 928 dbSNP
rs1176299428 938 dbSNP
rs934869004 939 dbSNP
rs1162459197 942 dbSNP
rs1252022690 946 dbSNP
rs1462401388 950 dbSNP
rs1196697640 956 dbSNP
rs902197267 957 dbSNP
rs1415024786 965 dbSNP
rs1178066496 975 dbSNP
rs1352553336 984 dbSNP
rs1009895928 985 dbSNP
rs140773271 985 dbSNP
rs1352615243 990 dbSNP
rs1403304888 993 dbSNP
rs1282803106 996 dbSNP
rs1391918686 1003 dbSNP
rs1042097559 1004 dbSNP
rs1221439074 1008 dbSNP
rs1271454452 1012 dbSNP
rs1307305495 1016 dbSNP
rs1206377949 1017 dbSNP
rs527248289 1020 dbSNP
rs1001001799 1025 dbSNP
rs1196815907 1038 dbSNP
rs1245634902 1040 dbSNP
rs1478033546 1046 dbSNP
rs185077502 1049 dbSNP
rs1039768657 1051 dbSNP
rs1055245517 1054 dbSNP
rs937869224 1055 dbSNP
rs1169031489 1057 dbSNP
rs1209650789 1063 dbSNP
rs1423040655 1077 dbSNP
rs559345783 1086 dbSNP
rs1350571673 1087 dbSNP
rs1438642685 1093 dbSNP
rs982013939 1098 dbSNP
rs144952458 1105 dbSNP
rs929973184 1132 dbSNP
rs1340760418 1133 dbSNP
rs1303524294 1136 dbSNP
rs1357664577 1138 dbSNP
rs1219799472 1142 dbSNP
rs573431379 1146 dbSNP
rs192543303 1154 dbSNP
rs368101722 1166 dbSNP
rs544349433 1169 dbSNP
rs1464441629 1172 dbSNP
rs963705572 1175 dbSNP
rs1372237043 1178 dbSNP
rs1017690900 1180 dbSNP
rs979928531 1190 dbSNP
rs1442502967 1192 dbSNP
rs1306099798 1203 dbSNP
rs765458481 1213 dbSNP
rs971587388 1223 dbSNP
rs188705359 1237 dbSNP
rs1429029834 1239 dbSNP
rs1316393143 1240 dbSNP
rs1008021800 1243 dbSNP
rs555409243 1245 dbSNP
rs955704381 1255 dbSNP
rs533955358 1257 dbSNP
rs1030479916 1258 dbSNP
rs566555517 1259 dbSNP
rs770252389 1263 dbSNP
rs765125303 1264 dbSNP
rs1043329104 1269 dbSNP
rs1281597793 1272 dbSNP
rs761554568 1280 dbSNP
rs1209282873 1304 dbSNP
rs893430056 1310 dbSNP
rs183308472 1311 dbSNP
rs1186624918 1321 dbSNP
rs78284325 1323 dbSNP
rs929977848 1327 dbSNP
rs918554484 1329 dbSNP
rs1483030063 1334 dbSNP
rs1038297151 1339 dbSNP
rs1278669988 1341 dbSNP
rs1201646906 1346 dbSNP
rs941296845 1349 dbSNP
rs1162032874 1352 dbSNP
rs1342329367 1353 dbSNP
rs1404601923 1358 dbSNP
rs927186274 1359 dbSNP
rs1273862402 1369 dbSNP
rs1335355144 1371 dbSNP
rs980370203 1372 dbSNP
rs1342623600 1386 dbSNP
rs1228695288 1391 dbSNP
rs1277342880 1398 dbSNP
rs145507872 1407 dbSNP
rs1228520518 1415 dbSNP
rs1286238203 1415 dbSNP
rs1046244916 1416 dbSNP
rs140134977 1418 dbSNP
rs919214646 1429 dbSNP
rs988545120 1431 dbSNP
rs192595360 1432 dbSNP
rs1443860093 1437 dbSNP
rs1032680540 1447 dbSNP
rs1400244717 1449 dbSNP
rs963416514 1449 dbSNP
rs1411410 1452 dbSNP
rs1427289149 1458 dbSNP
rs1466030347 1462 dbSNP
rs968301149 1469 dbSNP
rs986248780 1470 dbSNP
rs187993084 1472 dbSNP
rs1414588167 1474 dbSNP
rs779620305 1475 dbSNP
rs1307782935 1478 dbSNP
rs1007487175 1484 dbSNP
rs771846158 1487 dbSNP
rs1030406228 1493 dbSNP
rs1030166247 1496 dbSNP
rs1343025815 1497 dbSNP
rs1232442393 1499 dbSNP
rs1193910988 1500 dbSNP
rs1256471775 1500 dbSNP
rs1346884809 1500 dbSNP
rs999055535 1507 dbSNP
rs897241238 1510 dbSNP
rs1207548796 1511 dbSNP
rs967503254 1512 dbSNP
rs527363238 1513 dbSNP
rs1432599443 1519 dbSNP
rs1200241725 1521 dbSNP
rs1379928831 1539 dbSNP
rs1168420841 1541 dbSNP
rs1371542621 1548 dbSNP
rs1012214714 1552 dbSNP
rs1238540460 1557 dbSNP
rs1190285353 1558 dbSNP
rs1309393538 1567 dbSNP
rs1387985175 1569 dbSNP
rs941327935 1571 dbSNP
rs1440188570 1574 dbSNP
rs183309857 1577 dbSNP
rs1055223992 1596 dbSNP
rs113989133 1597 dbSNP
rs41277935 1603 dbSNP
rs1296677720 1604 dbSNP
rs1342537600 1606 dbSNP
rs1230892978 1613 dbSNP
rs147534437 1613 dbSNP
rs929144403 1617 dbSNP
rs989051479 1619 dbSNP
rs934447003 1621 dbSNP
rs925693505 1632 dbSNP
rs1188421619 1635 dbSNP
rs1391169370 1651 dbSNP
rs897628017 1653 dbSNP
rs1170115703 1658 dbSNP
rs1366401632 1670 dbSNP
rs1457072010 1670 dbSNP
rs1293678298 1672 dbSNP
rs74453264 1678 dbSNP
rs1432832731 1680 dbSNP
rs1445740391 1684 dbSNP
rs941916921 1687 dbSNP
rs910450259 1688 dbSNP
rs1436948620 1699 dbSNP
rs1310271602 1702 dbSNP
rs1321417533 1703 dbSNP
rs1018954336 1710 dbSNP
rs986563697 1711 dbSNP
rs1267316871 1719 dbSNP
rs933298215 1721 dbSNP
rs1348543501 1726 dbSNP
rs373741696 1741 dbSNP
rs752891211 1743 dbSNP
rs564478217 1744 dbSNP
rs1249134246 1752 dbSNP
rs573751991 1756 dbSNP
rs1182177518 1763 dbSNP
rs1255901888 1764 dbSNP
rs1436040290 1765 dbSNP
rs1029869569 1773 dbSNP
rs1391070087 1780 dbSNP
rs1369703557 1784 dbSNP
rs1455151064 1786 dbSNP
rs1158366027 1787 dbSNP
rs1389352691 1789 dbSNP
rs977471616 1791 dbSNP
rs781345211 1792 dbSNP
rs1415057583 1796 dbSNP
rs967554164 1801 dbSNP
rs1315054037 1809 dbSNP
rs1348729094 1810 dbSNP
rs1165434413 1814 dbSNP
rs1268815926 1817 dbSNP
rs1331930928 1820 dbSNP
rs1208628318 1826 dbSNP
rs1255788446 1832 dbSNP
rs1472101697 1833 dbSNP
rs1483747324 1840 dbSNP
rs1182117229 1842 dbSNP
rs1021779808 1848 dbSNP
rs190000569 1857 dbSNP
rs370296151 1859 dbSNP
rs1471394328 1860 dbSNP
rs1236330137 1862 dbSNP
rs1180909604 1863 dbSNP
rs959243587 1866 dbSNP
rs374433760 1869 dbSNP
rs1002317204 1873 dbSNP
rs755227755 1877 dbSNP
rs1358391064 1880 dbSNP
rs1466313703 1882 dbSNP
rs577725997 1883 dbSNP
rs139680282 1896 dbSNP
rs1289131974 1904 dbSNP
rs897680323 1909 dbSNP
rs1291781031 1914 dbSNP
rs1217987941 1916 dbSNP
rs557733064 1918 dbSNP
rs150606948 1920 dbSNP
rs751576086 1924 dbSNP
rs941858839 1926 dbSNP
rs889063455 1932 dbSNP
rs1481901389 1933 dbSNP
rs766494096 1941 dbSNP
rs1251913254 1947 dbSNP
rs1473264154 1961 dbSNP
rs1189418746 1962 dbSNP
rs925721440 1968 dbSNP
rs187580057 1972 dbSNP
rs1433667793 1976 dbSNP
rs1248547371 1980 dbSNP
rs1178045319 1981 dbSNP
rs868395462 1982 dbSNP
rs1308797542 1986 dbSNP
rs1042757007 1987 dbSNP
rs1292994339 1993 dbSNP
rs41277933 1994 dbSNP
rs1221421480 2013 dbSNP
rs933318115 2026 dbSNP
rs775568807 2031 dbSNP
rs910177305 2035 dbSNP
rs1274847000 2044 dbSNP
rs1439168013 2049 dbSNP
rs1218788579 2052 dbSNP
rs1245618280 2059 dbSNP
rs1488801064 2072 dbSNP
rs534809652 2076 dbSNP
rs535749933 2078 dbSNP
rs765490642 2079 dbSNP
rs1403785309 2082 dbSNP
rs1164255345 2087 dbSNP
rs946139196 2092 dbSNP
rs568701747 2094 dbSNP
rs1319083276 2096 dbSNP
rs141846719 2102 dbSNP
rs1436337590 2103 dbSNP
rs1413663856 2106 dbSNP
rs1341115697 2107 dbSNP
rs1017039812 2109 dbSNP
rs961510395 2109 dbSNP
rs1005600906 2114 dbSNP
rs1450777779 2115 dbSNP
rs1246070184 2116 dbSNP
rs1464369405 2117 dbSNP
rs1189023475 2120 dbSNP
rs768679600 2126 dbSNP
rs990759214 2137 dbSNP
rs1187480024 2155 dbSNP
rs1471967405 2156 dbSNP
rs1162817722 2157 dbSNP
rs1414663581 2164 dbSNP
rs1407105200 2166 dbSNP
rs958900088 2167 dbSNP
rs533924415 2174 dbSNP
rs1014660366 2175 dbSNP
rs1323033694 2200 dbSNP
rs1339017886 2214 dbSNP
rs1445367663 2218 dbSNP
rs895758040 2222 dbSNP
rs566528493 2223 dbSNP
rs998656937 2228 dbSNP
rs1265661502 2235 dbSNP
rs776138591 2239 dbSNP
rs904330043 2252 dbSNP
rs981624246 2254 dbSNP
rs1286088939 2260 dbSNP
rs970378897 2268 dbSNP
rs1187129794 2269 dbSNP
rs1042788435 2270 dbSNP
rs1230611355 2289 dbSNP
rs1476291940 2290 dbSNP
rs1486084873 2295 dbSNP
rs1180189941 2296 dbSNP
rs943159732 2297 dbSNP
rs1024572060 2303 dbSNP
rs41277931 2312 dbSNP
rs1400557265 2314 dbSNP
rs1414215581 2317 dbSNP
rs1295509253 2318 dbSNP
rs1359425769 2323 dbSNP
rs868253680 2327 dbSNP
rs552524291 2333 dbSNP
rs1214151301 2334 dbSNP
rs1285982128 2343 dbSNP
rs1368607663 2343 dbSNP
rs1276869839 2346 dbSNP
rs1051468021 2347 dbSNP
rs1281160078 2355 dbSNP
rs897606558 2367 dbSNP
rs1016004890 2372 dbSNP
rs1199702027 2374 dbSNP
rs1365407053 2382 dbSNP
rs1486809416 2387 dbSNP
rs532449333 2388 dbSNP
rs532909581 2396 dbSNP
rs368005058 2397 dbSNP
rs972946182 2400 dbSNP
rs961540773 2402 dbSNP
rs1477973285 2406 dbSNP
rs1432183953 2412 dbSNP
rs1173599786 2415 dbSNP
rs1397260250 2416 dbSNP
rs888923825 2431 dbSNP
rs1050786959 2434 dbSNP
rs1436216290 2434 dbSNP
rs997412398 2438 dbSNP
rs1169176164 2444 dbSNP
rs1391510174 2444 dbSNP
rs1330270728 2445 dbSNP
rs1309046639 2447 dbSNP
rs148102620 2456 dbSNP
rs1426807587 2458 dbSNP
rs1041769772 2459 dbSNP
rs1349693886 2461 dbSNP
rs1274131020 2466 dbSNP
rs1483492588 2476 dbSNP
rs1197670502 2495 dbSNP
rs1265358671 2498 dbSNP
rs1189158929 2501 dbSNP
rs550881057 2516 dbSNP
rs1477574132 2529 dbSNP
rs1252274609 2531 dbSNP
rs970199131 2535 dbSNP
rs946023333 2541 dbSNP
rs1023454536 2542 dbSNP
rs1482043863 2564 dbSNP
rs768356098 2565 dbSNP
rs1272518194 2571 dbSNP
rs1054507381 2572 dbSNP
rs960283288 2587 dbSNP
rs1031555881 2602 dbSNP
rs1169201359 2603 dbSNP
rs1312896983 2607 dbSNP
rs998687941 2612 dbSNP
rs1372942084 2616 dbSNP
rs904444969 2623 dbSNP
rs1280979135 2642 dbSNP
rs1042904558 2648 dbSNP
rs1343228769 2659 dbSNP
rs1229873477 2661 dbSNP
rs1263775617 2665 dbSNP
rs937513177 2672 dbSNP
rs1210980149 2677 dbSNP
rs1255493754 2681 dbSNP
rs1463908389 2683 dbSNP
rs927455736 2688 dbSNP
rs888894346 2696 dbSNP
rs1428759976 2698 dbSNP
rs1194793446 2699 dbSNP
rs75737888 2702 dbSNP
rs1456926388 2710 dbSNP
rs971643804 2712 dbSNP
rs1164982845 2721 dbSNP
rs191015320 2732 dbSNP
rs1396652177 2737 dbSNP
rs539990737 2739 dbSNP
rs374102250 2741 dbSNP
rs1319713813 2743 dbSNP
rs1362332248 2749 dbSNP
rs1384141998 2751 dbSNP
rs774844919 2755 dbSNP
rs897446285 2757 dbSNP
rs961732041 2767 dbSNP
rs771676767 2775 dbSNP
rs1349143454 2786 dbSNP
rs1298156984 2787 dbSNP
rs1234017569 2790 dbSNP
rs1016428689 2791 dbSNP
rs1466090836 2801 dbSNP
rs1005943235 2805 dbSNP
rs1360452179 2807 dbSNP
rs1173430070 2812 dbSNP
rs1269165707 2815 dbSNP
rs958789551 2816 dbSNP
rs1468984169 2817 dbSNP
rs1487029864 2824 dbSNP
rs1036027642 2837 dbSNP
rs1253703819 2838 dbSNP
rs940290856 2840 dbSNP
rs370394457 2842 dbSNP
rs879860675 2855 dbSNP
rs774614241 2856 dbSNP
rs1471512044 2858 dbSNP
rs1250961707 2862 dbSNP
rs1158249563 2867 dbSNP
rs997338567 2868 dbSNP
rs1182435102 2876 dbSNP
rs1483617131 2878 dbSNP
rs948879072 2878 dbSNP
rs1300831583 2880 dbSNP
rs1401845584 2881 dbSNP
rs1257837047 2882 dbSNP
rs1415610888 2889 dbSNP
rs563587984 2891 dbSNP
rs901796239 2903 dbSNP
rs1323131364 2904 dbSNP
rs993286242 2907 dbSNP
rs1269051511 2919 dbSNP
rs564206145 2921 dbSNP
rs1041655116 2924 dbSNP
rs545898683 2930 dbSNP
rs536625341 2936 dbSNP
rs1231585931 2946 dbSNP
rs116812945 2949 dbSNP
rs1031670257 2957 dbSNP
rs1306906173 2957 dbSNP
rs893103339 2960 dbSNP
rs1211090352 2961 dbSNP
rs1054960906 2973 dbSNP
rs1259016318 2977 dbSNP
rs73461064 2983 dbSNP
rs1380639871 2986 dbSNP
rs968634120 2993 dbSNP
rs113862839 2997 dbSNP
rs78925463 2998 dbSNP
rs1420800146 2999 dbSNP
rs36159321 3003 dbSNP
rs61138921 3003 dbSNP
rs1376794781 3004 dbSNP
rs1435576940 3005 dbSNP
rs7034536 3008 dbSNP
rs1368814545 3011 dbSNP
rs575204555 3015 dbSNP
rs529865628 3018 dbSNP
rs1376249193 3021 dbSNP
rs1217965554 3024 dbSNP
rs1301037886 3032 dbSNP
rs561084760 3038 dbSNP
rs897570974 3046 dbSNP
rs972918477 3049 dbSNP
rs1281965137 3061 dbSNP
rs1165314550 3064 dbSNP
rs962029570 3081 dbSNP
rs187028187 3082 dbSNP
rs1181796424 3088 dbSNP
rs1481581564 3091 dbSNP
rs984847058 3105 dbSNP
rs1460965958 3109 dbSNP
rs777552182 3113 dbSNP
rs888720342 3123 dbSNP
rs1454512323 3137 dbSNP
rs1388595265 3138 dbSNP
rs200502399 3138 dbSNP
rs751933896 3138 dbSNP
rs755139913 3146 dbSNP
rs1171294336 3155 dbSNP
rs975953165 3180 dbSNP
rs1293420191 3184 dbSNP
rs747314061 3189 dbSNP
rs1372213199 3202 dbSNP
rs1463770001 3208 dbSNP
rs965830851 3210 dbSNP
rs1246110498 3212 dbSNP
rs779993679 3221 dbSNP
rs1324064923 3223 dbSNP
rs1311262347 3224 dbSNP
rs1213561651 3227 dbSNP
rs1273098702 3230 dbSNP
rs1219306314 3236 dbSNP
rs145695037 3236 dbSNP
rs993006901 3240 dbSNP
rs1468835964 3241 dbSNP
rs1195343539 3249 dbSNP
rs1170124061 3254 dbSNP
rs200566470 3267 dbSNP
rs1187267822 3273 dbSNP
rs1421785265 3275 dbSNP
rs1403630874 3282 dbSNP
rs1164148175 3283 dbSNP
rs1395935167 3286 dbSNP
rs142558781 3288 dbSNP
rs568871012 3291 dbSNP
rs1432454849 3293 dbSNP
rs1383897140 3307 dbSNP
rs550297749 3309 dbSNP
rs1429627225 3312 dbSNP
rs1270363176 3315 dbSNP
rs1363606558 3319 dbSNP
rs113313356 3320 dbSNP
rs750875032 3326 dbSNP
rs1292128392 3331 dbSNP
rs1033036672 3337 dbSNP
rs10557868 3339 dbSNP
rs181440515 3358 dbSNP
rs1162914068 3367 dbSNP
rs1444078094 3372 dbSNP
rs1446176615 3380 dbSNP
rs546402793 3386 dbSNP
rs1244107609 3390 dbSNP
rs1471917374 3393 dbSNP
rs201377207 3394 dbSNP
rs1418589834 3400 dbSNP
rs1445521831 3409 dbSNP
rs1261426578 3413 dbSNP
rs1210780690 3416 dbSNP
rs138069679 3417 dbSNP
rs1388393024 3417 dbSNP
rs1320654171 3421 dbSNP
rs1264192503 3422 dbSNP
rs1346665569 3424 dbSNP
rs190438922 3435 dbSNP
rs1311759553 3438 dbSNP
rs1222489307 3439 dbSNP
rs1342168809 3442 dbSNP
rs563915896 3451 dbSNP
rs950219272 3454 dbSNP
rs1235097299 3456 dbSNP
rs1286333407 3457 dbSNP
rs1349846814 3459 dbSNP
rs75454397 3460 dbSNP
rs1325455876 3461 dbSNP
rs1440919204 3463 dbSNP
rs1210353394 3469 dbSNP
rs1014661061 3475 dbSNP
rs1037266459 3476 dbSNP
rs941647062 3477 dbSNP
rs1180076102 3490 dbSNP
rs1301602527 3491 dbSNP
rs575637372 3494 dbSNP
rs1005904971 3501 dbSNP
rs887409508 3505 dbSNP
rs1311858745 3506 dbSNP
rs1388389955 3519 dbSNP
rs1416144996 3539 dbSNP
rs1305613650 3540 dbSNP
rs910113602 3545 dbSNP
rs186428079 3566 dbSNP
rs758082926 3571 dbSNP
rs931638414 3581 dbSNP
rs41277929 3586 dbSNP
rs1233869309 3598 dbSNP
rs376631570 3611 dbSNP
rs764610097 3616 dbSNP
rs1203190260 3618 dbSNP
rs1249894926 3619 dbSNP
rs965881536 3627 dbSNP
rs1199926614 3633 dbSNP
rs1245377552 3634 dbSNP
rs1454074217 3636 dbSNP
rs866369882 3647 dbSNP
rs938844819 3648 dbSNP
rs1020105696 3649 dbSNP
rs989031831 3652 dbSNP
rs1041754178 3653 dbSNP
rs1165660513 3662 dbSNP
rs1267221383 3672 dbSNP
rs947397211 3675 dbSNP
rs1199256595 3680 dbSNP
rs1368669651 3686 dbSNP
rs1439944847 3687 dbSNP
rs1483681464 3693 dbSNP
rs575223438 3694 dbSNP
rs1193548069 3695 dbSNP
rs145642141 3695 dbSNP
rs1338245165 3707 dbSNP
rs986142426 3718 dbSNP
rs1340109750 3722 dbSNP
rs1256219187 3727 dbSNP
rs1033332512 3731 dbSNP
rs1001580295 3733 dbSNP
rs1468406236 3734 dbSNP
rs1234963838 3737 dbSNP
rs1329075923 3738 dbSNP
rs1255275285 3747 dbSNP
rs1455307298 3750 dbSNP
rs1190522304 3753 dbSNP
rs1372022101 3754 dbSNP
rs905830026 3757 dbSNP
rs1024349480 3761 dbSNP
rs1392280490 3763 dbSNP
rs1460846654 3764 dbSNP
rs1326348671 3769 dbSNP
rs1396321297 3788 dbSNP
rs541670060 3793 dbSNP
rs577542770 3803 dbSNP
rs753995928 3816 dbSNP
rs1327228586 3817 dbSNP
rs897229666 3817 dbSNP
rs1037191401 3821 dbSNP
rs1352225802 3829 dbSNP
rs961845832 3842 dbSNP
rs1014692051 3858 dbSNP
rs1275471513 3860 dbSNP
rs941519561 3862 dbSNP
rs888743992 3863 dbSNP
rs1050394112 3867 dbSNP
rs564857272 3878 dbSNP
rs951772289 3884 dbSNP
rs1395948766 3890 dbSNP
rs1481548248 3892 dbSNP
rs150077367 3894 dbSNP
rs1428740078 3901 dbSNP
rs1173313092 3904 dbSNP
rs1194772250 3905 dbSNP
rs931675316 3910 dbSNP
rs539560386 3911 dbSNP
rs1011901063 3914 dbSNP
rs140714193 3917 dbSNP
rs921569889 3922 dbSNP
rs894742078 3923 dbSNP
rs975848080 3925 dbSNP
rs181866797 3927 dbSNP
rs1288042523 3930 dbSNP
rs912972116 3931 dbSNP
rs1384125172 3937 dbSNP
rs1311161217 3938 dbSNP
rs1234459771 3941 dbSNP
rs1354854476 3941 dbSNP
rs1295702673 3942 dbSNP
rs535049487 3944 dbSNP
rs1199111788 3950 dbSNP
rs1315619750 3951 dbSNP
rs988694296 3953 dbSNP
rs1261663931 3958 dbSNP
rs1254575723 3960 dbSNP
rs1206456727 3963 dbSNP
rs368119198 3964 dbSNP
rs903326760 3966 dbSNP
rs1436651746 3967 dbSNP
rs150957411 3971 dbSNP
rs925893881 3973 dbSNP
rs980391282 3981 dbSNP
rs145176567 3985 dbSNP
rs1417238745 3987 dbSNP
rs397716530 3999 dbSNP
rs1321004315 4003 dbSNP
rs914650153 4008 dbSNP
rs1455564534 4009 dbSNP
rs34851555 4009 dbSNP
rs59959569 4009 dbSNP
rs367915275 4010 dbSNP
rs1314830992 4011 dbSNP
rs1024285771 4012 dbSNP
rs1014198877 4014 dbSNP
rs1308165231 4016 dbSNP
rs1331024638 4016 dbSNP
rs1277701903 4017 dbSNP
rs1441398190 4024 dbSNP
rs1241901140 4026 dbSNP
rs931979802 4034 dbSNP
rs1346667667 4036 dbSNP
rs1211066025 4037 dbSNP
rs537370620 4038 dbSNP
rs975993229 4039 dbSNP
rs528352834 4048 dbSNP
rs574660472 4049 dbSNP
rs888579697 4053 dbSNP
rs570665173 4055 dbSNP
rs1414657996 4066 dbSNP
rs997078218 4067 dbSNP
rs760134858 4070 dbSNP
rs901406909 4077 dbSNP
rs1023363548 4086 dbSNP
rs773768298 4089 dbSNP
rs1352767157 4101 dbSNP
rs1040092200 4116 dbSNP
rs1461948709 4136 dbSNP
rs1368494821 4143 dbSNP
rs1376139415 4144 dbSNP
rs1188987512 4149 dbSNP
rs1303128439 4149 dbSNP
rs141736315 4151 dbSNP
rs764158458 4163 dbSNP
rs1280137623 4169 dbSNP
rs1053239771 4175 dbSNP
rs935854854 4176 dbSNP
rs772982181 4181 dbSNP
rs925746818 4184 dbSNP
rs1305203685 4185 dbSNP
rs189463909 4187 dbSNP
rs1251855431 4188 dbSNP
rs1466036787 4188 dbSNP
rs1459029117 4191 dbSNP
rs184135049 4194 dbSNP
rs1252081100 4201 dbSNP
rs1223096001 4208 dbSNP
rs1195690125 4212 dbSNP
rs1417487670 4216 dbSNP
rs1428048233 4233 dbSNP
rs1357006174 4234 dbSNP
rs1003039882 4263 dbSNP
rs1285932760 4270 dbSNP
rs11139928 4279 dbSNP
rs1020438755 4287 dbSNP
rs1011683323 4288 dbSNP
rs917158354 4290 dbSNP
rs1325671088 4293 dbSNP
rs1380757902 4294 dbSNP
rs1203054843 4295 dbSNP
rs992829979 4297 dbSNP
rs747169457 4305 dbSNP
rs1050506653 4311 dbSNP
rs1276296534 4325 dbSNP
rs1436101082 4329 dbSNP
rs931985067 4334 dbSNP
rs1295655051 4335 dbSNP
rs961321140 4338 dbSNP
rs1015686926 4339 dbSNP
rs1272352601 4353 dbSNP
rs1468712937 4364 dbSNP
rs1400528387 4365 dbSNP
rs901806540 4366 dbSNP
rs1240622291 4368 dbSNP
rs1415134715 4375 dbSNP
rs1006022240 4376 dbSNP
rs940620210 4377 dbSNP
rs907778558 4383 dbSNP
rs1164789725 4391 dbSNP
rs1419178825 4393 dbSNP
rs1463378652 4396 dbSNP
rs1442238097 4400 dbSNP
rs1316672026 4407 dbSNP
rs1343128856 4411 dbSNP
rs1429519672 4414 dbSNP
rs984644001 4414 dbSNP
rs1341790783 4417 dbSNP
rs370083680 4422 dbSNP
rs916327517 4430 dbSNP
rs1335360413 4443 dbSNP
rs1188738260 4445 dbSNP
rs1028933058 4446 dbSNP
rs879438592 4453 dbSNP
rs901459277 4456 dbSNP
rs1316572333 4457 dbSNP
rs147937019 4460 dbSNP
rs1484706719 4461 dbSNP
rs1187267213 4465 dbSNP
rs1258904486 4478 dbSNP
rs1474050406 4481 dbSNP
rs1452023821 4484 dbSNP
rs752588163 4491 dbSNP
rs1008568621 4494 dbSNP
rs780374260 4495 dbSNP
rs977715614 4498 dbSNP
rs181425202 4500 dbSNP
rs767604226 4503 dbSNP
rs1052885479 4504 dbSNP
rs935724198 4506 dbSNP
rs967629258 4509 dbSNP
rs1450045320 4516 dbSNP
rs7857137 4531 dbSNP
rs1011715876 4535 dbSNP
rs1224568886 4540 dbSNP
rs1044244263 4544 dbSNP
rs1229359317 4545 dbSNP
rs1210346746 4551 dbSNP
rs948555757 4562 dbSNP
rs1444651295 4565 dbSNP
rs577605028 4578 dbSNP
rs1232696295 4579 dbSNP
rs1470740152 4581 dbSNP
rs917169706 4585 dbSNP
rs992671157 4592 dbSNP
rs940038257 4593 dbSNP
rs189448570 4608 dbSNP
rs996316768 4611 dbSNP
rs1402219245 4620 dbSNP
rs144843929 4625 dbSNP
rs1335059052 4631 dbSNP
rs1430449995 4631 dbSNP
rs1040425180 4632 dbSNP
rs573267929 4636 dbSNP
rs1369061104 4639 dbSNP
rs1233773017 4640 dbSNP
rs886372674 4648 dbSNP
rs1048978562 4649 dbSNP
rs1423309215 4661 dbSNP
rs1345914843 4663 dbSNP
rs1028398878 4682 dbSNP
rs373324734 4688 dbSNP
rs965496022 4693 dbSNP
rs1168711925 4696 dbSNP
rs1192560703 4702 dbSNP
rs916377523 4712 dbSNP
rs1019883332 4713 dbSNP
rs1431148804 4726 dbSNP
rs1395774828 4735 dbSNP
rs991057135 4745 dbSNP
rs1416931635 4747 dbSNP
rs1185639976 4760 dbSNP
rs113478179 4761 dbSNP
rs1440487188 4766 dbSNP
rs1304498384 4767 dbSNP
rs1333027184 4768 dbSNP
rs891476928 4776 dbSNP
rs1269668325 4778 dbSNP
rs1031785032 4780 dbSNP
rs1220937048 4783 dbSNP
rs184067978 4785 dbSNP
rs966321204 4793 dbSNP
rs1214668615 4794 dbSNP
rs1267669437 4797 dbSNP
rs192303844 4819 dbSNP
rs1020503965 4829 dbSNP
rs567749745 4830 dbSNP
rs904313266 4834 dbSNP
rs1478121540 4836 dbSNP
rs1298001224 4852 dbSNP
rs1044088155 4861 dbSNP
rs948564000 4862 dbSNP
rs1460772773 4866 dbSNP
rs567189382 4868 dbSNP
rs895625179 4874 dbSNP
rs1271147423 4884 dbSNP
rs1380678240 4888 dbSNP
rs1214210982 4897 dbSNP
rs966176147 4900 dbSNP
rs148787203 4905 dbSNP
rs1004899471 4909 dbSNP
rs886405120 4911 dbSNP
rs1234363366 4914 dbSNP
rs939957614 4921 dbSNP
rs1358047185 4922 dbSNP
rs1260474424 4923 dbSNP
rs1049010150 4932 dbSNP
rs1195185080 4938 dbSNP
rs1255389712 4959 dbSNP
rs994804514 4961 dbSNP
rs1165220981 4962 dbSNP
rs1408689023 4970 dbSNP
rs1403596753 4971 dbSNP
rs908441554 4976 dbSNP
rs984561851 4979 dbSNP
rs1158168141 4995 dbSNP
rs1361374276 5004 dbSNP
rs931327157 5006 dbSNP
rs921351013 5015 dbSNP
rs757825775 5018 dbSNP
rs975459191 5031 dbSNP
rs534644734 5032 dbSNP
rs945048395 5033 dbSNP
rs1238745385 5035 dbSNP
rs1284931728 5042 dbSNP
rs1353957082 5044 dbSNP
rs111288369 5052 dbSNP
rs1218247649 5055 dbSNP
rs1352264945 5055 dbSNP
rs1169237299 5060 dbSNP
rs1485311781 5062 dbSNP
rs914950547 5067 dbSNP
rs1258046879 5071 dbSNP
rs989544950 5072 dbSNP
rs1019769378 5079 dbSNP
rs144394634 5091 dbSNP
rs988288115 5096 dbSNP
rs1414704024 5099 dbSNP
rs957671417 5102 dbSNP
rs1171867257 5103 dbSNP
rs1374879640 5104 dbSNP
rs1467033947 5114 dbSNP
rs187495901 5116 dbSNP
rs185109829 5128 dbSNP
rs1310446316 5130 dbSNP
rs1377190193 5131 dbSNP
rs1241793998 5132 dbSNP
rs1300650540 5135 dbSNP
rs1480013558 5141 dbSNP
rs530588147 5149 dbSNP
rs879675951 5151 dbSNP
rs904157224 5161 dbSNP
rs1022683300 5177 dbSNP
rs1012597276 5178 dbSNP
rs756547358 5179 dbSNP
rs1257736840 5181 dbSNP
rs570156241 5184 dbSNP
rs1195075221 5187 dbSNP
rs753023006 5197 dbSNP
rs192362742 5198 dbSNP
rs767160319 5204 dbSNP
rs1313033899 5208 dbSNP
rs1265274847 5213 dbSNP
rs1433895693 5215 dbSNP
rs1048269297 5218 dbSNP
rs1323357662 5221 dbSNP
rs1371919535 5223 dbSNP
rs1289452386 5224 dbSNP
rs1461863009 5226 dbSNP
rs1393660067 5230 dbSNP
rs1332474745 5231 dbSNP
rs149971052 5232 dbSNP
rs1448569267 5233 dbSNP
rs139277920 5234 dbSNP
rs1039827395 5255 dbSNP
rs187908000 5256 dbSNP
rs1302754550 5269 dbSNP
rs773590753 5279 dbSNP
rs1217889704 5280 dbSNP
rs1334348699 5302 dbSNP
rs770378999 5312 dbSNP
rs1377415314 5321 dbSNP
rs1211567362 5323 dbSNP
rs912645171 5329 dbSNP
rs906338502 5330 dbSNP
rs1192998093 5333 dbSNP
rs1042201988 5351 dbSNP
rs550069370 5363 dbSNP
rs1161131609 5365 dbSNP
rs945165142 5372 dbSNP
rs1164640302 5375 dbSNP
rs1417268976 5383 dbSNP
rs146329856 5388 dbSNP
rs956858791 5390 dbSNP
rs565404565 5395 dbSNP
rs1176660293 5398 dbSNP
rs182436964 5402 dbSNP
rs1483649214 5406 dbSNP
rs371524634 5408 dbSNP
rs191510711 5411 dbSNP
rs1322569283 5421 dbSNP
rs975364867 5426 dbSNP
rs1461103129 5430 dbSNP
rs1269186220 5432 dbSNP
rs1240462539 5435 dbSNP
rs966202749 5436 dbSNP
rs879571690 5442 dbSNP
rs968808505 5447 dbSNP
rs1194449131 5449 dbSNP
rs1266042733 5455 dbSNP
rs1474508940 5464 dbSNP
rs912103273 5475 dbSNP
rs983611836 5478 dbSNP
rs1405630672 5485 dbSNP
rs950802211 5487 dbSNP
rs561129195 5489 dbSNP
rs1228379288 5498 dbSNP
rs773857017 5501 dbSNP
rs1028131158 5502 dbSNP
rs1451482979 5510 dbSNP
rs973443166 5511 dbSNP
rs1389046708 5517 dbSNP
rs959602856 5521 dbSNP
rs1379572619 5527 dbSNP
rs1290446229 5539 dbSNP
rs1451410294 5540 dbSNP
rs1344513015 5552 dbSNP
rs1165469443 5564 dbSNP
rs1229785972 5566 dbSNP
rs1282479848 5575 dbSNP
rs1469449356 5578 dbSNP
rs748428352 5582 dbSNP
rs959815470 5586 dbSNP
rs541562590 5594 dbSNP
rs1387175105 5597 dbSNP
rs1217521564 5612 dbSNP
rs1288164029 5614 dbSNP
rs1181926015 5621 dbSNP
rs1484982719 5623 dbSNP
rs1187413854 5626 dbSNP
rs574190549 5627 dbSNP
rs906454756 5649 dbSNP
rs1175839267 5654 dbSNP
rs1378171783 5659 dbSNP
rs762873506 5661 dbSNP
rs886912317 5664 dbSNP
rs1207236089 5670 dbSNP
rs1158739060 5671 dbSNP
rs1361842790 5677 dbSNP
rs1432817094 5683 dbSNP
rs1333471771 5686 dbSNP
rs1359648892 5687 dbSNP
rs1450023638 5698 dbSNP
rs1485129397 5699 dbSNP
rs11139923 5701 dbSNP
rs142074971 5702 dbSNP
rs899731028 5709 dbSNP
rs1345872408 5716 dbSNP
rs866163343 5718 dbSNP
rs577085977 5735 dbSNP
rs899456395 5756 dbSNP
rs1202870081 5758 dbSNP
rs944019739 5761 dbSNP
rs1457059974 5762 dbSNP
rs1365434191 5770 dbSNP
rs1178821479 5774 dbSNP
rs1040712658 5776 dbSNP
rs1476783857 5777 dbSNP
rs1171468841 5780 dbSNP
rs1283914192 5784 dbSNP
rs558547448 5790 dbSNP
rs912655005 5791 dbSNP
rs769556795 5793 dbSNP
rs1297336395 5796 dbSNP
rs1329059062 5797 dbSNP
rs1399210555 5804 dbSNP
rs1380300501 5805 dbSNP
rs935513204 5811 dbSNP
rs537332651 5817 dbSNP
rs1369038810 5828 dbSNP
rs1293980486 5832 dbSNP
rs979990777 5835 dbSNP
rs983638495 5844 dbSNP
rs929432030 5851 dbSNP
rs369972639 5853 dbSNP
rs973858039 5860 dbSNP
rs1458523479 5868 dbSNP
rs959483025 5875 dbSNP
rs1034132417 5876 dbSNP
rs116719286 5877 dbSNP
rs1197552124 5880 dbSNP
rs916823644 5887 dbSNP
rs536789359 5901 dbSNP
rs1478979507 5908 dbSNP
rs959659172 5923 dbSNP
rs1168396563 5945 dbSNP
rs1422807377 5949 dbSNP
rs1020801920 5951 dbSNP
rs1035409495 5957 dbSNP
rs1028767370 5963 dbSNP
rs1003936870 5965 dbSNP
rs1388855430 5966 dbSNP
rs1373842230 5969 dbSNP
rs1386371349 5972 dbSNP
rs1324309915 5976 dbSNP
rs1195682021 5980 dbSNP
rs951306581 5995 dbSNP
rs761622901 5996 dbSNP
rs995731928 5997 dbSNP
rs1278172485 6007 dbSNP
rs776292921 6009 dbSNP
rs1220920065 6015 dbSNP
rs188116573 6020 dbSNP
rs1271584015 6023 dbSNP
rs1039603621 6024 dbSNP
rs547822224 6029 dbSNP
rs997038637 6030 dbSNP
rs1008241663 6031 dbSNP
rs377322134 6043 dbSNP
rs532374395 6044 dbSNP
rs899573282 6045 dbSNP
rs182492560 6050 dbSNP
rs1195596326 6051 dbSNP
rs1366450498 6058 dbSNP
rs868086315 6066 dbSNP
rs1342332470 6071 dbSNP
rs1252697520 6074 dbSNP
rs1164093923 6077 dbSNP
rs1224802487 6082 dbSNP
rs943661732 6083 dbSNP
rs1418000623 6085 dbSNP
rs890725797 6089 dbSNP
rs1047976673 6092 dbSNP
rs1301755824 6094 dbSNP
rs929464637 6095 dbSNP
rs1052967593 6096 dbSNP
rs550241212 6102 dbSNP
rs903924345 6110 dbSNP
rs1043934670 6112 dbSNP
rs948219878 6116 dbSNP
rs746133723 6124 dbSNP
rs992336195 6129 dbSNP
rs938363051 6130 dbSNP
rs920801167 6149 dbSNP
rs928294450 6159 dbSNP
rs530031283 6162 dbSNP
rs1213837375 6167 dbSNP
rs951189034 6168 dbSNP
rs938126023 6171 dbSNP
rs1253960042 6203 dbSNP
rs561190454 6205 dbSNP
rs1187981703 6210 dbSNP
rs1397303365 6218 dbSNP
rs1370487490 6221 dbSNP
rs1437989811 6225 dbSNP
rs1158132994 6228 dbSNP
rs1361188410 6250 dbSNP
rs973906620 6251 dbSNP
rs982094139 6252 dbSNP
rs970671510 6253 dbSNP
rs1402106589 6257 dbSNP
rs1397046317 6259 dbSNP
rs1315201423 6262 dbSNP
rs1460681417 6287 dbSNP
rs963838968 6288 dbSNP
rs1237445116 6294 dbSNP
rs779130134 6297 dbSNP
rs1353848109 6302 dbSNP
rs542764249 6305 dbSNP
rs1254236340 6307 dbSNP
rs1008127069 6327 dbSNP
rs1481652145 6335 dbSNP
rs891030526 6338 dbSNP
rs1199416621 6339 dbSNP
rs1031031189 6340 dbSNP
rs1456625453 6341 dbSNP
rs1178213363 6346 dbSNP
rs999927614 6354 dbSNP
rs1381115636 6357 dbSNP
rs1441674306 6359 dbSNP
rs1174040593 6361 dbSNP
rs903977159 6363 dbSNP
rs1032623891 6367 dbSNP
rs1304989482 6368 dbSNP
rs1437839438 6369 dbSNP
rs1252075844 6376 dbSNP
rs1446469032 6377 dbSNP
rs996678661 6383 dbSNP
rs1377163545 6389 dbSNP
rs1225036075 6397 dbSNP
rs1298473139 6400 dbSNP
rs1311546015 6401 dbSNP
rs1233815212 6408 dbSNP
rs1264801284 6419 dbSNP
rs138886188 6421 dbSNP
rs1197754953 6431 dbSNP
rs1019346487 6437 dbSNP
rs558992050 6446 dbSNP
rs1225099355 6449 dbSNP
rs886735828 6450 dbSNP
rs1266704955 6453 dbSNP
rs895289818 6455 dbSNP
rs781575662 6456 dbSNP
rs1056660197 6457 dbSNP
rs1321236262 6462 dbSNP
rs1465488061 6465 dbSNP
rs995902959 6485 dbSNP
rs1400579038 6488 dbSNP
rs1443850036 6489 dbSNP
rs939626745 6489 dbSNP
rs771170680 6493 dbSNP
rs1228940925 6508 dbSNP
rs1338315198 6510 dbSNP
rs1217794350 6512 dbSNP
rs1258407305 6513 dbSNP
rs879048724 6515 dbSNP
rs1219603209 6526 dbSNP
rs190682109 6529 dbSNP
rs994191004 6530 dbSNP
rs567599826 6559 dbSNP
rs769026667 6560 dbSNP
rs1396015314 6570 dbSNP
rs1477741663 6578 dbSNP
rs1420849100 6585 dbSNP
rs75405179 6586 dbSNP
rs1471159326 6590 dbSNP
rs185677623 6591 dbSNP
rs377037653 6594 dbSNP
rs1162303547 6598 dbSNP
rs1348914571 6605 dbSNP
rs1046428719 6614 dbSNP
rs986619025 6615 dbSNP
rs1358566543 6619 dbSNP
rs1399273617 6622 dbSNP
rs763414015 6625 dbSNP
rs1179018538 6627 dbSNP
rs1226378840 6630 dbSNP
rs1436775629 6632 dbSNP
rs955352504 6633 dbSNP
rs1243369318 6635 dbSNP
rs1322551801 6643 dbSNP
rs1224818858 6651 dbSNP
rs1205177942 6655 dbSNP
rs1459766347 6656 dbSNP
rs34849250 6665 dbSNP
rs759403441 6665 dbSNP
rs913942477 6678 dbSNP
rs1217941374 6680 dbSNP
rs1244301214 6685 dbSNP
rs988093257 6688 dbSNP
rs1031335068 6689 dbSNP
rs796447846 6691 dbSNP
rs999534025 6695 dbSNP
rs73461062 6703 dbSNP
rs1164961131 6704 dbSNP
rs181899381 6709 dbSNP
rs756608892 6714 dbSNP
rs753041820 6716 dbSNP
rs1298787012 6723 dbSNP
rs895213642 6724 dbSNP
rs1056585208 6727 dbSNP
rs1003657395 6729 dbSNP
rs576283676 6732 dbSNP
rs1019377785 6734 dbSNP
rs554808936 6735 dbSNP
rs1376340835 6736 dbSNP
rs886731918 6738 dbSNP
rs1315918422 6740 dbSNP
rs1454795664 6742 dbSNP
rs1048413015 6746 dbSNP
rs547591711 6749 dbSNP
rs1441186517 6750 dbSNP
rs951104312 6757 dbSNP
rs1401699807 6759 dbSNP
rs1238366214 6766 dbSNP
rs1025345081 6771 dbSNP
rs995166716 6778 dbSNP
rs1387761965 6779 dbSNP
rs1157401978 6784 dbSNP
rs1438605686 6787 dbSNP
rs781427260 6791 dbSNP
rs373216223 6795 dbSNP
rs17418588 6796 dbSNP
rs566199582 6808 dbSNP
rs919563823 6830 dbSNP
rs1175115852 6832 dbSNP
rs1359481138 6842 dbSNP
rs1002790366 6844 dbSNP
rs1038026177 6846 dbSNP
rs942455252 6850 dbSNP
rs910966734 6851 dbSNP
rs868769409 6864 dbSNP
rs1281287495 6867 dbSNP
rs1448579120 6871 dbSNP
rs547937738 6874 dbSNP
rs539107821 6879 dbSNP
rs913974977 6882 dbSNP
rs955345672 6883 dbSNP
rs1279917411 6885 dbSNP
rs1326159952 6890 dbSNP
rs141263707 6896 dbSNP
rs751283664 6898 dbSNP
rs118149814 6908 dbSNP
rs978384769 6919 dbSNP
rs1181925065 6931 dbSNP
rs1234062520 6946 dbSNP
rs1477016119 6946 dbSNP
rs925199135 6947 dbSNP
rs762499993 6951 dbSNP
rs1429881270 6952 dbSNP
rs1248312753 6956 dbSNP
rs1380827603 6961 dbSNP
rs550143859 6964 dbSNP
rs1283882575 6972 dbSNP
rs749959222 6978 dbSNP
rs1431920915 6980 dbSNP
rs975318200 6984 dbSNP
rs1435820147 6986 dbSNP
rs1276026670 6987 dbSNP
rs531911728 6988 dbSNP
rs1347938674 7005 dbSNP
rs1316781484 7019 dbSNP
rs1217192363 7023 dbSNP
rs1012187161 7026 dbSNP
rs942611203 7029 dbSNP
rs1316942202 7032 dbSNP
rs1195976450 7037 dbSNP
rs1274632286 7052 dbSNP
rs959480847 7059 dbSNP
rs1035063233 7060 dbSNP
rs376797823 7069 dbSNP
rs1003724061 7071 dbSNP
rs1481338226 7075 dbSNP
rs1164906048 7081 dbSNP
rs117460827 7088 dbSNP
rs1422606416 7108 dbSNP
rs1201418768 7110 dbSNP
rs75278177 7111 dbSNP
rs12353216 7123 dbSNP
rs1186813096 7126 dbSNP
rs776472696 7128 dbSNP
rs1404912646 7149 dbSNP
rs143211759 7150 dbSNP
rs962374267 7161 dbSNP
rs1240157520 7165 dbSNP
rs1192322818 7179 dbSNP
rs540805272 7181 dbSNP
rs1341561540 7193 dbSNP
rs1230037639 7196 dbSNP
rs759769034 7198 dbSNP
rs777550450 7200 dbSNP
rs910978151 7210 dbSNP
rs1353814565 7212 dbSNP
rs1016932119 7216 dbSNP
rs1271021569 7217 dbSNP
rs1050796445 7220 dbSNP
rs774759369 7226 dbSNP
rs531309096 7236 dbSNP
rs771297400 7238 dbSNP
rs532227425 7242 dbSNP
rs564776333 7248 dbSNP
rs1357458377 7257 dbSNP
rs1289335322 7258 dbSNP
rs1262360154 7259 dbSNP
rs1215391605 7260 dbSNP
rs1341847032 7262 dbSNP
rs1268816611 7263 dbSNP
rs1399828949 7264 dbSNP
rs905446682 7265 dbSNP
rs1346675369 7266 dbSNP
rs1025128569 7267 dbSNP
rs1387121189 7270 dbSNP
rs1417902388 7272 dbSNP
rs1013689123 7276 dbSNP
rs1052495842 7276 dbSNP
rs892569012 7276 dbSNP
rs1305554090 7277 dbSNP
rs1338349368 7278 dbSNP
rs1244722937 7285 dbSNP
rs1315275581 7294 dbSNP
rs1402555615 7297 dbSNP
rs369490781 7298 dbSNP
rs79765027 7312 dbSNP
rs1486118140 7313 dbSNP
rs576415512 7313 dbSNP
rs903892086 7313 dbSNP
rs778007247 7315 dbSNP
rs1167081581 7317 dbSNP
rs562160249 7318 dbSNP
rs1245172299 7320 dbSNP
rs554870489 7329 dbSNP
rs1437964105 7332 dbSNP
rs1158118638 7334 dbSNP
rs1364883435 7336 dbSNP
rs1306937520 7337 dbSNP
rs915148380 7339 dbSNP
rs990818352 7340 dbSNP
rs959325796 7344 dbSNP
rs1171210987 7345 dbSNP
rs542920968 7356 dbSNP
rs200403871 7358 dbSNP
rs1401994382 7378 dbSNP
rs1453809742 7379 dbSNP
rs1489862347 7380 dbSNP
rs756118282 7390 dbSNP
rs1035081487 7391 dbSNP
rs1004014604 7393 dbSNP
rs912463512 7401 dbSNP
rs1443947514 7402 dbSNP
rs1205434856 7412 dbSNP
rs950814547 7418 dbSNP
rs986648322 7423 dbSNP
rs1254137200 7424 dbSNP
rs929764193 7431 dbSNP
rs1439748407 7432 dbSNP
rs1026930350 7441 dbSNP
rs752607918 7446 dbSNP
rs77796450 7458 dbSNP
rs899455623 7459 dbSNP
rs973811600 7460 dbSNP
rs962776256 7462 dbSNP
rs1218400907 7463 dbSNP
rs1324807768 7464 dbSNP
rs1285669235 7466 dbSNP
rs1222236588 7470 dbSNP
rs1366231910 7471 dbSNP
rs191836842 7476 dbSNP
rs1298285027 7477 dbSNP
rs1443802367 7480 dbSNP
rs1017832118 7506 dbSNP
rs748665469 7516 dbSNP
rs538800866 7519 dbSNP
rs1330339511 7523 dbSNP
rs1297136882 7525 dbSNP
rs889425331 7528 dbSNP
rs1373481783 7531 dbSNP
rs1470064903 7535 dbSNP
rs571664960 7540 dbSNP
rs1431172231 7549 dbSNP