miRTarBase - #MIRT051342 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SEC63   
Synonyms DNAJC23, ERdj2, PCLD2, PRO2507, SEC63L
Description SEC63 homolog, protein translocation regulator
Transcript NM_007214   
Expression
Putative miRNA Targets on SEC63
3'UTR of SEC63
(miRNA target sites are highlighted)
>SEC63|NM_007214|3'UTR
   1 GCAGTACTCTGAATGGACCACAGTGTTTGCACATATTTGCAATTTTTTGCTGTTTTGGAAGTGTATCATAAACCAGAAAC
  81 AGTACAGAACTGATGTTGAGGGAGGTGTAGTTTTTTTACTCTTGAAATGGGTGCATAATATAACTAGGCAGTGGCGGTGC
 161 CTTGGTACAACCTGAAAAATGTTAAGGCTTATTGAAACCTTTCAAGTAGGGGATGGTACATTTATTTCATCTGCAAATGA
 241 TAATAAATCCTTTGTTATTATAACTGTCCAGAAGTGTGGGCTATGTATTATCTGATCAGTCTATGGTCCCAGTAAAAGTA
 321 AAGATGCAGGAAACACAGTCTGTAAATGAGCGACTTTTCTTTGTTCAGCTTTAGTTTTAGCAAACACCACAAATATGTTT
 401 TAAGTAACATCGCTCAAGTTTAAGTAACATCGCTCAAGTTGATAATCTCTTGATAAGCTCTGTTGTTGACATTTTGCAGT
 481 GATACAACAGCTCCACTCATAGATTTAAACTTTTATTTTTACTTATCTTGGTCATAAGTTGGCATTCTCTCACATTCCAC
 561 ATGATATAGAGGGCTACGTTTTGGAATTTTCCTTTTCTTAATTGCCCAGAGTTATCAGACAGATTATAAAAATGGCTTTT
 641 AATGGCTTAAACCATTTCTAAACCTCTATCTTAGCAGATCAATGCAGGATCTAATTCTTTTGATAAGTTCTAGCTCTAAA
 721 AGTGATAGTGGGACTGTATGTTTTCTGATACTGGTGGCTTATGTTATTAAACCTTTTTTAAAAAAGGTTCACTCTAAAAG
 801 CTGAACTACATCCTTAGTTTTCAGTCTACTTGACTCTATCAGGAGCTTTTTAAGGAAAGTAAGTATAACATGCAAAGGAA
 881 GCTTTTTTTGTATTCATTTTGGACTCCTGTCAATAAAAATAGAAGTTTGTTGACTCGTTTTATGTTTCAATGGTGTGTGT
 961 CTTTTTACTATCAGGACATAAATAGGGCAATCCACTTCTTTATTTTTCAACTAAAGATTGAATAGTATTGTACATTACTG
1041 CTAAAGTGACTGCTATTTCTGTATACTGTAGAAAAACCCAGGAGTGAGAGGGATTTCCCCTCATAGTACAACTGGAAGGA
1121 TAGTGCTTGTAAAGAGTAGAGATGTGTACATGATGAATCATTGAGGGAGGGTGGATATTTTTATTCCTAGATATGGAGGA
1201 AACATAAGTCTGTAGTATTATAAAACTGATTGTAATAATTCTTTCCTATCAAAATCTCCATAGGTCAAAATATTGTTGGA
1281 ATACTAAAATTTGCAACCTTGTTTACTTTAAAAGGTTGCCACTTTCAGTGCAGAATACTACCGGCATCTTGTTACTGCAA
1361 TAGTTGGAAATAAAATGTGAAAATTAGCAAAACCATGAATGGTTTTTTTGGTTCTAAATTTAAGATGTAATATTTCCTAT
1441 AAAAGGGTGAAAGCAGTTTCTTTCTCTATAACCTCAATCACCAGTTTAGTGAGAGCCTTTCTTGGCAGGCAGGAGGCAGT
1521 GTCACTGAGGATTTTTTTCATTTACTTCATTGTACAAGTAGGAGGGTGGGTTTAATTTTCAAATCAGGTTCTGCTGTGAA
1601 GCACCAGTGTCTTGAGGCAGCTACTGATTACCTAAGTGTGGTGGCAGGGGGTAAGCCAGCTGGTGTCAAGTGAAAGGAGG
1681 GATTAGAGAAAACAGGTGTGGCACGAAGGCAAGGAAACTGAGCAGACAAGACAGAACAATGTGTAGAATGCATATTTCCT
1761 AGTTTTCTTGAAAGATTTCAAGAAAAGTTGTTTTTTTTTTTCTAGTGGCTACTTTGCCTTAAAGAGGCTTTATAAGTTCA
1841 TTCACACAGCTGGCTTCTCTGGTTTTAAGATTCTGGAGAGGATGATAACCTAGTAACACCACAGTGCTTAAAAAAAAAAA
1921 AAAAAAAAAAACTACCATCACCAGAAAATTCCACCAGTTTGTTTTCCTTTTCTCTTTGTGTGATGTGTATGTACTTCCCA
2001 ACTAAGTAAAATAAAATTTCCTCTAGTGAGTGCTTTAGGTAACCTCTTTCCATATGGCAGTAGTGAAAGAACTGAGCCTT
2081 CAGTTGATAGTTCTTCTCTCTCCAGCAAGTCGCTAAACTCCACATCCCTTCGTTTTTCCTCTGGAATGAGAATAACAAAC
2161 TATCCTAGTTTGCATTTAATCTAATGGAAACTTGAGCAAAGTTTCAATTTTCTTCCTATAAAGAAACTGACATTTTGTCA
2241 ACAATTGATGAGCCTATAGATCATACAGTGTATAGGAAGTGAAATTGAAACAGTTAAATTATGTGATATTTTTCTCTAAT
2321 TGGTAAAGTACCTATTAAAATACAGCTGTTCATGAGGAGACTTACCACAATTCAAAGTGTAGCAGTTGTGTATTTTAGCA
2401 TTATAATATTTGATTGAGGCCCTGAGGTGTTAATATCTCAATCTCAGAGTTAGATGTTCATGTCCTTTTTGAATTTTTTA
2481 AACATTTTTCATAATTTTTTTTTTAAGTTAGGGAGCACATTGAGTGAAGTTCTCTGTGTAGAACAATACCTTCTGCTCTG
2561 CTTCTCCCAGCTTTCACTGAGGGCTGGAAAAGGACAGGCCTGTCCAGCTGTACTGTCCCACTGTGTATGGGGAAGCTCAG
2641 GCTCTGGTGGAAGCAGGGGGCGTGGATGTCAAACAACTGATGTGGAAACAGGGAGGGAGAGATATAATGAGGCTCTCTAG
2721 GCATGTTATTTTTGACCACAAGTTTTGTTCAGTTTGCTTCAGCCAATCCAAACCATATACTAGAGTGTTCTGTAGTCACA
2801 ATTCTTATTTCAAATGTAATTCAGCACCTTACATAATTTTTGAGAGGTTGTCATTCATCACATATTTACTGAGTTTCTAT
2881 GTGCCAGGCTCTGTGACTGGATACTGGAGCTATCAAAATGAAAAAAATAGTGTTAAGAACTCACTCGCTGGTGTTAGAGC
2961 AGGTAGATGAGTGGCAATCCATTTAAATCCATTTGCCTTGGCTATTATTTGGAATGCCTTTTTTTTTTTTTAGTCTATCT
3041 ACTGTAGGCAGAAGAATTATTTCTTTAGGGGCTAGCTGTTTATTTTGCTGGCCTTTTTTTCTCTCTTTCTCTTTTTCTTC
3121 TTAAGACGGAGTCTCGCTCTGTCCTCCAGGCTGGAGGAGTGCAGTGGCACGATCTCAGCTCACTGCAACCTCCGCCTCCC
3201 AGCTTCAAGCGATTCTTCTGCCTCAGCCTCCTGAGTAGCTGGGACTGCAGGTGCATGCCACCACACCCAGCTAATTTTTT
3281 AATTTTTAGTAGAGATGGGATTTTGCCACGTTGTCCAGCCTGGTCTCGAACTCCTGGCCTCAAGTGATCAGCCCTCCTCA
3361 GCCTCCCAAAGTGCTGGCATTACAGGCATGAGCCACTGCGCCCAGCCTGTTGGGTTTTTTTGGAAAAAAAACAAAAACAA
3441 CAAATCATCATCCTTTCCTTTAAAATGTTTTTTTTTTTTTAAGAAACAATTTTCCCACAAACGGTCTGATTTAACTCCAT
3521 GAAATCCTCTATTTAGACTGCCTTAAAGTGAAATAACTGTTGGTGAACCATAACATTTTGCCAGCTGTGTAGTGATTAGT
3601 CCAAATATGTCTCAAGAAGTTAGCACCAAGCATTCTCATCCATTTAAACTTGATGCTAGGGCTATTTTGCAAAACTTAAA
3681 AAGATGCGATCTTGTACATATTTCTGTAACCTGAGCTGAAAACCCAAATAACAATCATTGACATACTTTAGGGCTATTGT
3761 TTCAGGTGGGGGTGTATACATCCCAGGGGCGTGGAGATGATCAATCCATTGAGGAAGTATTAAGATGATTATTTGTATTT
3841 AATCTCATCCTTTTAAATTTCTATTTTTGTGTGTTTTATAATGTACATAATATATTGTACAATTGTACACTTCTATTATT
3921 TATAAATAAACATTTATTGGTGCATTAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               :| ||| | |||||:| 
Target 5' tatttGCAATTTTTTGCTGTTt 3'
34 - 55 141.00 -7.70
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||:|   | || ||||| 
Target 5' ttCAAATC---AGGTTCTGCTg 3'
1578 - 1596 129.00 -14.90
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|:| || ||  | ||||| 
Target 5' tgTAGAACAATACCTTCTGCTc 3'
2537 - 2558 128.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
906563 24 ClinVar
354888 123 ClinVar
354887 129 ClinVar
354886 256 ClinVar
354885 257 ClinVar
904975 273 ClinVar
354884 358 ClinVar
354882 396 ClinVar
354883 396 ClinVar
354881 411 ClinVar
904194 432 ClinVar
904195 432 ClinVar
904193 437 ClinVar
354880 514 ClinVar
904192 549 ClinVar
904191 577 ClinVar
354879 861 ClinVar
907522 874 ClinVar
354878 907 ClinVar
907521 936 ClinVar
907520 1037 ClinVar
907519 1061 ClinVar
907518 1071 ClinVar
354877 1108 ClinVar
354876 1113 ClinVar
354875 1116 ClinVar
906511 1178 ClinVar
354874 1230 ClinVar
354873 1343 ClinVar
354871 1398 ClinVar
906510 1420 ClinVar
354870 1433 ClinVar
354869 1471 ClinVar
904917 1475 ClinVar
354868 1526 ClinVar
904916 1568 ClinVar
354867 1612 ClinVar
904915 1650 ClinVar
904914 1655 ClinVar
354866 1685 ClinVar
904140 1696 ClinVar
354865 1705 ClinVar
904139 1725 ClinVar
904138 1760 ClinVar
354864 1793 ClinVar
354863 1794 ClinVar
904137 1832 ClinVar
354862 1839 ClinVar
354861 1901 ClinVar
354860 1921 ClinVar
907457 1931 ClinVar
354858 1932 ClinVar
354859 1932 ClinVar
354856 1933 ClinVar
354857 1933 ClinVar
354855 1937 ClinVar
354854 1938 ClinVar
354853 1941 ClinVar
907456 2041 ClinVar
354852 2046 ClinVar
354851 2086 ClinVar
907455 2131 ClinVar
354850 2223 ClinVar
906468 2287 ClinVar
906467 2301 ClinVar
354849 2376 ClinVar
906466 2379 ClinVar
354848 2456 ClinVar
906465 2465 ClinVar
354847 2480 ClinVar
354846 2505 ClinVar
354845 2522 ClinVar
354844 2607 ClinVar
904850 2618 ClinVar
354843 2624 ClinVar
354842 2662 ClinVar
904849 2704 ClinVar
354841 2705 ClinVar
904848 2783 ClinVar
904072 2791 ClinVar
354840 2811 ClinVar
354839 2833 ClinVar
354838 2862 ClinVar
354837 2876 ClinVar
354836 2886 ClinVar
904071 2946 ClinVar
354834 3032 ClinVar
354835 3032 ClinVar
904070 3032 ClinVar
354833 3107 ClinVar
907405 3116 ClinVar
354832 3127 ClinVar
354831 3128 ClinVar
907404 3133 ClinVar
354830 3170 ClinVar
354829 3171 ClinVar
354828 3210 ClinVar
354827 3334 ClinVar
906400 3390 ClinVar
354826 3393 ClinVar
906399 3430 ClinVar
354825 3431 ClinVar
354824 3433 ClinVar
354823 3434 ClinVar
905883 3456 ClinVar
354822 3469 ClinVar
354820 3481 ClinVar
354821 3481 ClinVar
905882 3489 ClinVar
354819 3497 ClinVar
354818 3498 ClinVar
354817 3499 ClinVar
354816 3501 ClinVar
354815 3502 ClinVar
354814 3510 ClinVar
354813 3575 ClinVar
354812 3580 ClinVar
354811 3704 ClinVar
354810 3705 ClinVar
354809 3772 ClinVar
354808 3800 ClinVar
904008 3819 ClinVar
354807 3895 ClinVar
354806 3948 ClinVar
COSN30192756 1 COSMIC
COSN31594883 42 COSMIC
COSN26994174 43 COSMIC
COSN31497867 95 COSMIC
COSN31510578 101 COSMIC
COSN30508134 115 COSMIC
COSN28739197 123 COSMIC
COSN31490438 149 COSMIC
COSN31555094 155 COSMIC
COSN31574316 177 COSMIC
COSN8791941 194 COSMIC
COSN30543474 216 COSMIC
COSN6720141 278 COSMIC
COSN8493415 415 COSMIC
COSN17181866 449 COSMIC
COSN31515888 490 COSMIC
COSN32196633 498 COSMIC
COSN31567607 503 COSMIC
COSN20787918 645 COSMIC
COSN31536254 688 COSMIC
COSN25248346 735 COSMIC
COSN26240602 780 COSMIC
COSN28649274 812 COSMIC
COSN21800465 1031 COSMIC
COSN31596135 1216 COSMIC
COSN31482467 1218 COSMIC
COSN32196632 1326 COSMIC
COSN28817349 1398 COSMIC
COSN16495620 1482 COSMIC
COSN6720140 1500 COSMIC
COSN30174633 1530 COSMIC
COSN20103233 1788 COSMIC
COSN20103231 1910 COSMIC
COSN2133095 2115 COSMIC
COSN21720852 2206 COSMIC
COSN28198095 2221 COSMIC
COSN30234836 2494 COSMIC
COSN24883188 2599 COSMIC
COSN20091442 2704 COSMIC
COSN32065719 2835 COSMIC
COSN25793437 3103 COSMIC
COSN20103225 3468 COSMIC
COSN20091441 3498 COSMIC
COSN20103219 3572 COSMIC
COSN2133094 3790 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs756322072 8 dbSNP
rs376333856 13 dbSNP
rs1350657855 18 dbSNP
rs1220241546 19 dbSNP
rs1343346649 22 dbSNP
rs758228757 23 dbSNP
rs1262061519 24 dbSNP
rs750254807 27 dbSNP
rs764880428 30 dbSNP
rs756436374 32 dbSNP
rs1482082068 33 dbSNP
rs1199345227 37 dbSNP
rs1256289760 41 dbSNP
rs776210937 42 dbSNP
rs1462577724 48 dbSNP
rs745633662 49 dbSNP
rs781189060 49 dbSNP
rs1408807605 50 dbSNP
rs1005716747 58 dbSNP
rs371790865 61 dbSNP
rs543586366 65 dbSNP
rs888522470 73 dbSNP
rs1178376829 75 dbSNP
rs1049868504 77 dbSNP
rs1172039916 87 dbSNP
rs1433662005 91 dbSNP
rs932619066 92 dbSNP
rs1403069715 95 dbSNP
rs922639064 101 dbSNP
rs912611481 106 dbSNP
rs1418739619 113 dbSNP
rs1330001769 115 dbSNP
rs503068 123 dbSNP
rs1447913895 125 dbSNP
rs552904217 129 dbSNP
rs921280064 130 dbSNP
rs1232139911 131 dbSNP
rs1256060037 144 dbSNP
rs1325147902 155 dbSNP
rs368255232 158 dbSNP
rs913858734 158 dbSNP
rs536554088 165 dbSNP
rs1257284194 167 dbSNP
rs979298243 170 dbSNP
rs989305075 176 dbSNP
rs1178685834 179 dbSNP
rs373902561 189 dbSNP
rs567912399 191 dbSNP
rs551244693 192 dbSNP
rs967965842 212 dbSNP
rs1378276599 220 dbSNP
rs1470960182 229 dbSNP
rs926345835 254 dbSNP
rs111637159 256 dbSNP
rs148053936 257 dbSNP
rs1024604872 258 dbSNP
rs1014420001 262 dbSNP
rs1385871155 265 dbSNP
rs961607160 266 dbSNP
rs114293361 270 dbSNP
rs528561785 275 dbSNP
rs187946337 294 dbSNP
rs888647259 297 dbSNP
rs755234325 301 dbSNP
rs996946298 303 dbSNP
rs1206598645 308 dbSNP
rs1263447612 312 dbSNP
rs901127927 315 dbSNP
rs1048788992 338 dbSNP
rs1269802227 338 dbSNP
rs1488075916 338 dbSNP
rs145607851 351 dbSNP
rs898788290 352 dbSNP
rs529945456 358 dbSNP
rs1429615853 359 dbSNP
rs1173246009 391 dbSNP
rs1403487775 393 dbSNP
rs1348649115 395 dbSNP
rs368205255 396 dbSNP
rs1053725913 397 dbSNP
rs1367010819 408 dbSNP
rs140498555 411 dbSNP
rs146789617 412 dbSNP
rs1216257055 419 dbSNP
rs926490740 424 dbSNP
rs1353791017 428 dbSNP
rs980895437 431 dbSNP
rs970506593 432 dbSNP
rs1293718981 433 dbSNP
rs758920128 435 dbSNP
rs1214789202 441 dbSNP
rs1262560839 441 dbSNP
rs971699319 442 dbSNP
rs1392073560 451 dbSNP
rs1188370434 456 dbSNP
rs1412197884 457 dbSNP
rs184724336 467 dbSNP
rs979434161 469 dbSNP
rs1387527785 470 dbSNP
rs1015781456 471 dbSNP
rs1417469421 476 dbSNP
rs749971405 500 dbSNP
rs952955266 504 dbSNP
rs1300595334 513 dbSNP
rs968365367 513 dbSNP
rs557190642 514 dbSNP
rs997460871 525 dbSNP
rs901249999 527 dbSNP
rs1202479404 530 dbSNP
rs1351318160 534 dbSNP
rs1483784279 537 dbSNP
rs544797554 540 dbSNP
rs1285504888 542 dbSNP
rs77234282 544 dbSNP
rs1251167096 549 dbSNP
rs960540814 555 dbSNP
rs1035288375 560 dbSNP
rs1184812954 568 dbSNP
rs1245354955 570 dbSNP
rs761474758 577 dbSNP
rs1297648190 578 dbSNP
rs1244633912 584 dbSNP
rs1019739911 592 dbSNP
rs1380047190 593 dbSNP
rs1402122901 594 dbSNP
rs1027322287 600 dbSNP
rs1009551987 607 dbSNP
rs1453276857 608 dbSNP
rs552698380 623 dbSNP
rs1374589051 624 dbSNP
rs897493860 624 dbSNP
rs1054084646 625 dbSNP
rs1396319734 628 dbSNP
rs1015821013 639 dbSNP
rs936609766 640 dbSNP
rs904986064 649 dbSNP
rs1225738417 653 dbSNP
rs370370757 666 dbSNP
rs776206428 667 dbSNP
rs949280341 668 dbSNP
rs917655995 680 dbSNP
rs1296284973 682 dbSNP
rs891274091 684 dbSNP
rs1463433358 688 dbSNP
rs971813769 698 dbSNP
rs536241008 700 dbSNP
rs1178373197 701 dbSNP
rs932729203 703 dbSNP
rs899965698 704 dbSNP
rs1189869704 706 dbSNP
rs940338874 710 dbSNP
rs1189160521 713 dbSNP
rs1424031192 714 dbSNP
rs1469814678 718 dbSNP
rs1177993189 735 dbSNP
rs1397973028 736 dbSNP
rs866276558 749 dbSNP
rs908889256 754 dbSNP
rs1465077678 760 dbSNP
rs1043791132 763 dbSNP
rs1337371459 772 dbSNP
rs1250224229 774 dbSNP
rs1273237179 780 dbSNP
rs1345134710 790 dbSNP
rs1224149918 801 dbSNP
rs946704846 805 dbSNP
rs1316567832 806 dbSNP
rs1198631880 808 dbSNP
rs1274140102 810 dbSNP
rs145029071 810 dbSNP
rs913905087 813 dbSNP
rs1175885045 816 dbSNP
rs1219840811 832 dbSNP
rs1245719277 834 dbSNP
rs752582823 838 dbSNP
rs984738971 842 dbSNP
rs1200919585 845 dbSNP
rs528176477 856 dbSNP
rs9480810 861 dbSNP
rs1398553186 866 dbSNP
rs756408316 874 dbSNP
rs1322681397 879 dbSNP
rs1365150220 880 dbSNP
rs965559270 889 dbSNP
rs1305016862 890 dbSNP
rs571893658 907 dbSNP
rs1226785991 909 dbSNP
rs1245037841 911 dbSNP
rs1271223490 920 dbSNP
rs141309531 936 dbSNP
rs528589123 937 dbSNP
rs1392941270 942 dbSNP
rs1289667298 950 dbSNP
rs778885262 953 dbSNP
rs961714892 955 dbSNP
rs1260404926 970 dbSNP
rs1302471108 972 dbSNP
rs763953078 976 dbSNP
rs1487638571 977 dbSNP
rs1193299672 985 dbSNP
rs1374679462 987 dbSNP
rs1032346800 989 dbSNP
rs1015024912 990 dbSNP
rs112056572 998 dbSNP
rs1385693776 1001 dbSNP
rs1425526774 1009 dbSNP
rs1363773047 1010 dbSNP
rs1358876138 1011 dbSNP
rs1381667433 1012 dbSNP
rs1319099993 1013 dbSNP
rs145311611 1023 dbSNP
rs1446524288 1030 dbSNP
rs1045418058 1034 dbSNP
rs536922747 1037 dbSNP
rs201586133 1038 dbSNP
rs896343932 1040 dbSNP
rs1349536329 1047 dbSNP
rs1205166478 1053 dbSNP
rs549153458 1055 dbSNP
rs529276372 1057 dbSNP
rs1186828380 1062 dbSNP
rs1243676881 1063 dbSNP
rs538845937 1071 dbSNP
rs900017970 1071 dbSNP
rs1378655135 1077 dbSNP
rs1044199851 1082 dbSNP
rs754683735 1089 dbSNP
rs908992673 1092 dbSNP
rs1473779230 1102 dbSNP
rs984463216 1103 dbSNP
rs931669284 1104 dbSNP
rs892453199 1105 dbSNP
rs560882192 1108 dbSNP
rs939281915 1111 dbSNP
rs886060953 1113 dbSNP
rs1454874006 1115 dbSNP
rs541858963 1116 dbSNP
rs947842426 1120 dbSNP
rs1349443064 1131 dbSNP
rs1261963732 1134 dbSNP
rs745778550 1136 dbSNP
rs1342171927 1142 dbSNP
rs1258592469 1160 dbSNP
rs965507478 1161 dbSNP
rs114792201 1178 dbSNP
rs962128135 1184 dbSNP
rs1014582254 1193 dbSNP
rs530688153 1194 dbSNP
rs1365765272 1204 dbSNP
rs1477049791 1209 dbSNP
rs1175827974 1210 dbSNP
rs956773713 1214 dbSNP
rs1471267275 1219 dbSNP
rs954379828 1220 dbSNP
rs769938865 1226 dbSNP
rs188437808 1230 dbSNP
rs1000861972 1231 dbSNP
rs1029834435 1240 dbSNP
rs545142076 1242 dbSNP
rs1222328359 1246 dbSNP
rs1387443152 1250 dbSNP
rs969820686 1252 dbSNP
rs964157637 1254 dbSNP
rs1196734422 1266 dbSNP
rs1023530263 1273 dbSNP
rs1384445895 1283 dbSNP
rs1013471332 1285 dbSNP
rs1480798443 1302 dbSNP
rs1197354333 1304 dbSNP
rs1252870574 1315 dbSNP
rs866560483 1316 dbSNP
rs1022448187 1320 dbSNP
rs1198754141 1322 dbSNP
rs1010984194 1332 dbSNP
rs1481699716 1336 dbSNP
rs1169076234 1337 dbSNP
rs1459076506 1340 dbSNP
rs896282377 1342 dbSNP
rs886060952 1343 dbSNP
rs1036149735 1344 dbSNP
rs1176209626 1346 dbSNP
rs1479718819 1357 dbSNP
rs1300295334 1358 dbSNP
rs748388077 1361 dbSNP
rs1379903972 1362 dbSNP
rs1404002602 1365 dbSNP
rs1003921337 1366 dbSNP
rs1346919255 1377 dbSNP
rs1216260767 1383 dbSNP
rs1004705108 1384 dbSNP
rs887521815 1392 dbSNP
rs1294697651 1394 dbSNP
rs556907 1398 dbSNP
rs931642597 1406 dbSNP
rs921606827 1409 dbSNP
rs1044981574 1410 dbSNP
rs1489915402 1410 dbSNP
rs1259132838 1412 dbSNP
rs559391504 1414 dbSNP
rs1490843353 1415 dbSNP
rs1210194804 1416 dbSNP
rs1465106361 1422 dbSNP
rs1184875247 1431 dbSNP
rs1261590017 1432 dbSNP
rs886060951 1433 dbSNP
rs944275216 1446 dbSNP
rs755217383 1447 dbSNP
rs988300761 1449 dbSNP
rs1221490389 1450 dbSNP
rs1367066591 1454 dbSNP
rs34143156 1458 dbSNP
rs558176694 1468 dbSNP
rs886060950 1471 dbSNP
rs1346970654 1473 dbSNP
rs1037971514 1476 dbSNP
rs940448022 1478 dbSNP
rs907577021 1479 dbSNP
rs925374977 1484 dbSNP
rs1383904919 1494 dbSNP
rs1310300236 1506 dbSNP
rs1358552385 1508 dbSNP
rs1246450791 1511 dbSNP
rs1292709263 1517 dbSNP
rs557911 1526 dbSNP
rs573660152 1527 dbSNP
rs1344777757 1530 dbSNP
rs921622890 1531 dbSNP
rs1325919004 1532 dbSNP
rs1188869831 1534 dbSNP
rs556969720 1539 dbSNP
rs969389082 1549 dbSNP
rs1024057928 1550 dbSNP
rs1013577881 1560 dbSNP
rs960602326 1562 dbSNP
rs1184617252 1564 dbSNP
rs1389699603 1564 dbSNP
rs1386667349 1568 dbSNP
rs1398636725 1586 dbSNP
rs1336429031 1587 dbSNP
rs1345331084 1588 dbSNP
rs1468580350 1595 dbSNP
rs1455282628 1597 dbSNP
rs1014821083 1606 dbSNP
rs76842245 1612 dbSNP
rs1004654453 1616 dbSNP
rs964295863 1618 dbSNP
rs1316943996 1629 dbSNP
rs1385232433 1639 dbSNP
rs1222339435 1648 dbSNP
rs887625622 1649 dbSNP
rs1048774131 1650 dbSNP
rs1317524712 1651 dbSNP
rs1218055230 1653 dbSNP
rs1261761696 1655 dbSNP
rs578240380 1658 dbSNP
rs1204680126 1664 dbSNP
rs1011451992 1666 dbSNP
rs1370816663 1667 dbSNP
rs1176338936 1678 dbSNP
rs1408278287 1684 dbSNP
rs558069212 1685 dbSNP
rs1031472863 1690 dbSNP
rs1040060632 1696 dbSNP
rs944388796 1698 dbSNP
rs1242164173 1704 dbSNP
rs672444 1705 dbSNP
rs751575467 1706 dbSNP
rs1441212203 1709 dbSNP
rs1279138598 1712 dbSNP
rs111462032 1713 dbSNP
rs1195135297 1715 dbSNP
rs1374357568 1719 dbSNP
rs758856454 1727 dbSNP
rs1337416854 1732 dbSNP
rs1272518372 1738 dbSNP
rs1281502838 1742 dbSNP
rs1230729520 1755 dbSNP
rs113742308 1761 dbSNP
rs1052713626 1770 dbSNP
rs1204927522 1783 dbSNP
rs1265383996 1787 dbSNP
rs1436370271 1789 dbSNP
rs1826 1790 dbSNP
rs886060949 1793 dbSNP
rs150602806 1794 dbSNP
rs756079460 1794 dbSNP
rs1196617002 1795 dbSNP
rs75288082 1795 dbSNP
rs1428058001 1796 dbSNP
rs935492517 1797 dbSNP
rs1178416086 1798 dbSNP
rs79414717 1798 dbSNP
rs1417313268 1799 dbSNP
rs1394998335 1801 dbSNP
rs1329331298 1802 dbSNP
rs200166121 1802 dbSNP
rs746154677 1802 dbSNP
rs760174425 1802 dbSNP
rs762932419 1802 dbSNP
rs772716920 1802 dbSNP
rs797009384 1802 dbSNP
rs1345039822 1805 dbSNP
rs566079762 1808 dbSNP
rs1224213143 1809 dbSNP
rs1407336624 1812 dbSNP
rs1338047196 1818 dbSNP
rs925457526 1822 dbSNP
rs1169879683 1824 dbSNP
rs1214316094 1827 dbSNP
rs150031834 1839 dbSNP
rs1384141268 1841 dbSNP
rs948131064 1843 dbSNP
rs916695991 1847 dbSNP
rs1200986208 1850 dbSNP
rs992105166 1859 dbSNP
rs907715366 1868 dbSNP
rs1435955959 1877 dbSNP
rs1253905179 1879 dbSNP
rs1051928868 1882 dbSNP
rs1207300771 1900 dbSNP
rs10872020 1901 dbSNP
rs1291199955 1902 dbSNP
rs1226797307 1904 dbSNP
rs1358786228 1908 dbSNP
rs1187036515 1909 dbSNP
rs1285105504 1910 dbSNP
rs1325653461 1915 dbSNP
rs868241695 1915 dbSNP
rs1441953236 1919 dbSNP
rs921594503 1920 dbSNP
rs1244221359 1921 dbSNP
rs886060948 1921 dbSNP
rs1310388574 1922 dbSNP
rs1359668611 1923 dbSNP
rs1224110453 1925 dbSNP
rs1281461505 1926 dbSNP
rs1446368742 1927 dbSNP
rs1193725971 1928 dbSNP
rs1411037595 1929 dbSNP
rs1364384259 1930 dbSNP
rs1162139145 1931 dbSNP
rs1165090424 1932 dbSNP
rs1243768806 1932 dbSNP
rs1382799839 1932 dbSNP
rs1425487702 1932 dbSNP
rs1478104546 1932 dbSNP
rs375415877 1932 dbSNP
rs55885857 1932 dbSNP
rs76061129 1932 dbSNP
rs761484141 1932 dbSNP
rs764235619 1932 dbSNP
rs886060947 1932 dbSNP
rs746774536 1933 dbSNP
rs772400721 1933 dbSNP
rs886060946 1933 dbSNP
rs960716775 1934 dbSNP
rs1314749093 1935 dbSNP
rs535127807 1937 dbSNP
rs886060945 1938 dbSNP
rs886060944 1941 dbSNP
rs569736144 1957 dbSNP
rs1468413439 1963 dbSNP
rs915443876 1971 dbSNP
rs1205188087 1972 dbSNP
rs549730581 1974 dbSNP
rs1253791219 1975 dbSNP
rs1182790399 1985 dbSNP
rs989760277 1989 dbSNP
rs957066496 1994 dbSNP
rs951878734 2008 dbSNP
rs1362266319 2017 dbSNP
rs183158268 2017 dbSNP
rs1469737300 2019 dbSNP
rs1159188093 2021 dbSNP
rs1391510005 2024 dbSNP
rs1468654365 2036 dbSNP
rs1336499601 2037 dbSNP
rs1027905260 2041 dbSNP
rs1268226819 2043 dbSNP
rs1304488238 2044 dbSNP
rs139373195 2046 dbSNP
rs1239181898 2049 dbSNP
rs1289632476 2051 dbSNP
rs551327259 2052 dbSNP
rs1453487265 2073 dbSNP
rs1290869071 2076 dbSNP
rs1223503736 2077 dbSNP
rs191293627 2079 dbSNP
rs879757443 2083 dbSNP
rs1012217232 2084 dbSNP
rs550478845 2086 dbSNP
rs1008552223 2090 dbSNP
rs1016567829 2092 dbSNP
rs1229519134 2094 dbSNP
rs1414200697 2095 dbSNP
rs375163000 2098 dbSNP
rs886253649 2099 dbSNP
rs1438001823 2108 dbSNP
rs1051633501 2109 dbSNP
rs891487661 2111 dbSNP
rs1052660229 2112 dbSNP
rs1395360240 2113 dbSNP
rs1391555645 2114 dbSNP
rs1317190093 2125 dbSNP
rs900221026 2126 dbSNP
rs935591622 2131 dbSNP
rs1159679607 2132 dbSNP
rs1283905893 2134 dbSNP
rs542731884 2139 dbSNP
rs1225009069 2154 dbSNP
rs1480045338 2155 dbSNP
rs1422993179 2159 dbSNP
rs947023662 2162 dbSNP
rs1254238713 2168 dbSNP
rs1489896394 2181 dbSNP
rs914259552 2185 dbSNP
rs1189484814 2186 dbSNP
rs1435379439 2187 dbSNP
rs1168797823 2200 dbSNP
rs775935619 2205 dbSNP
rs948272766 2207 dbSNP
rs1247427927 2213 dbSNP
rs1170157396 2216 dbSNP
rs916643518 2220 dbSNP
rs9986549 2223 dbSNP
rs1215302512 2229 dbSNP
rs1463745561 2234 dbSNP
rs1303190315 2237 dbSNP
rs1369666953 2237 dbSNP
rs1380399117 2242 dbSNP
rs573745763 2244 dbSNP
rs1326872968 2246 dbSNP
rs982318619 2248 dbSNP
rs1209775277 2253 dbSNP
rs939326949 2255 dbSNP
rs907888645 2256 dbSNP
rs1221878337 2257 dbSNP
rs1023692733 2265 dbSNP
rs983348415 2266 dbSNP
rs1185359431 2268 dbSNP
rs1299825146 2270 dbSNP
rs375774624 2272 dbSNP
rs879335961 2280 dbSNP
rs1190874533 2285 dbSNP
rs1383038116 2286 dbSNP
rs1040000139 2287 dbSNP
rs1351049386 2293 dbSNP
rs1432398333 2296 dbSNP
rs1450989498 2297 dbSNP
rs1288272637 2301 dbSNP
rs1385550693 2302 dbSNP
rs1437055917 2303 dbSNP
rs1312592437 2309 dbSNP
rs1380879245 2310 dbSNP
rs1245440406 2311 dbSNP
rs1016290939 2312 dbSNP
rs1320920494 2318 dbSNP
rs770167245 2320 dbSNP
rs1213708639 2324 dbSNP
rs1005194531 2331 dbSNP
rs1027608032 2334 dbSNP
rs1210996781 2338 dbSNP
rs974968605 2344 dbSNP
rs563284645 2352 dbSNP
rs1357283577 2362 dbSNP
rs759686141 2365 dbSNP
rs1415491160 2368 dbSNP
rs78776458 2376 dbSNP
rs997269603 2379 dbSNP
rs1433750663 2384 dbSNP
rs900356254 2392 dbSNP
rs1458699851 2407 dbSNP
rs1334455836 2409 dbSNP
rs759753301 2418 dbSNP
rs1008666976 2420 dbSNP
rs1425926527 2423 dbSNP
rs1303695362 2427 dbSNP
rs891435225 2434 dbSNP
rs1447837671 2436 dbSNP
rs1250147924 2447 dbSNP
rs1306322813 2447 dbSNP
rs1230705143 2455 dbSNP
rs151325651 2456 dbSNP
rs558416401 2465 dbSNP
rs1254682877 2466 dbSNP
rs904089518 2468 dbSNP
rs187799727 2474 dbSNP
rs200116970 2480 dbSNP
rs1176146277 2490 dbSNP
rs948194219 2491 dbSNP
rs572577470 2493 dbSNP
rs555652030 2494 dbSNP
rs924179980 2495 dbSNP
rs982370635 2497 dbSNP
rs113337131 2505 dbSNP
rs533448594 2505 dbSNP
rs1056438239 2508 dbSNP
rs990884926 2516 dbSNP
rs886060943 2522 dbSNP
rs1281982613 2526 dbSNP
rs762659536 2528 dbSNP
rs1220204808 2529 dbSNP
rs1281105217 2533 dbSNP
rs535569282 2538 dbSNP
rs1048185509 2541 dbSNP
rs909198319 2543 dbSNP
rs930691383 2544 dbSNP
rs983431994 2548 dbSNP
rs144966422 2563 dbSNP
rs1196612832 2567 dbSNP
rs920491180 2593 dbSNP
rs950784001 2603 dbSNP
rs771224758 2606 dbSNP
rs549810875 2607 dbSNP
rs1417046027 2610 dbSNP
rs1409152408 2618 dbSNP
rs964513587 2621 dbSNP
rs368337970 2624 dbSNP
rs1371374416 2625 dbSNP
rs1169448059 2627 dbSNP
rs1431746871 2634 dbSNP
rs1030175475 2637 dbSNP
rs760351863 2647 dbSNP
rs1331053567 2656 dbSNP
rs1423506437 2660 dbSNP
rs513325 2662 dbSNP
rs1276973931 2663 dbSNP
rs955764776 2677 dbSNP
rs964494835 2679 dbSNP
rs1483835904 2682 dbSNP
rs1251743853 2685 dbSNP
rs1203721146 2692 dbSNP
rs1343665776 2697 dbSNP
rs1017417544 2702 dbSNP
rs1031445877 2703 dbSNP
rs687374 2705 dbSNP
rs1474988710 2712 dbSNP
rs968429923 2718 dbSNP
rs746579958 2724 dbSNP
rs1022939471 2725 dbSNP
rs565885758 2728 dbSNP
rs1391051310 2749 dbSNP
rs1451505825 2763 dbSNP
rs1012506699 2769 dbSNP
rs895278711 2779 dbSNP
rs1390017904 2783 dbSNP
rs1056553973 2794 dbSNP
rs759560731 2799 dbSNP
rs1319589410 2801 dbSNP
rs551516552 2804 dbSNP
rs886512494 2808 dbSNP
rs74799313 2811 dbSNP
rs1396407360 2816 dbSNP
rs1372441092 2817 dbSNP
rs930617215 2818 dbSNP
rs906881969 2826 dbSNP
rs879445151 2832 dbSNP
rs886060942 2833 dbSNP
rs771671466 2849 dbSNP
rs1372457015 2852 dbSNP
rs1169350476 2857 dbSNP
rs1039330790 2858 dbSNP
rs1466423039 2860 dbSNP
rs886060941 2862 dbSNP
rs1182049493 2869 dbSNP
rs375514344 2876 dbSNP
rs774365082 2879 dbSNP
rs1165040694 2880 dbSNP
rs182441835 2886 dbSNP
rs955878485 2887 dbSNP
rs770990522 2889 dbSNP
rs978546697 2891 dbSNP
rs916737233 2896 dbSNP
rs968754607 2897 dbSNP
rs1333151633 2907 dbSNP
rs866855119 2908 dbSNP
rs1055331814 2910 dbSNP
rs942195743 2913 dbSNP
rs1180623272 2914 dbSNP
rs1484346103 2919 dbSNP
rs1251863763 2920 dbSNP
rs1277215581 2923 dbSNP
rs1208750748 2928 dbSNP
rs909264652 2928 dbSNP
rs1269936513 2944 dbSNP
rs748298477 2946 dbSNP
rs1255779090 2947 dbSNP
rs1266851375 2959 dbSNP
rs1012576336 2960 dbSNP
rs1189726676 2965 dbSNP
rs1231180764 2966 dbSNP
rs748122439 2968 dbSNP
rs959608787 2979 dbSNP
rs1472303100 2984 dbSNP
rs1245148502 2989 dbSNP
rs1316102518 2991 dbSNP
rs1286275628 2997 dbSNP
rs1230114924 3019 dbSNP
rs1172315913 3020 dbSNP
rs1402497390 3021 dbSNP
rs34250899 3032 dbSNP
rs886060940 3032 dbSNP
rs923296669 3032 dbSNP
rs983954863 3032 dbSNP
rs1351065695 3033 dbSNP
rs1256315599 3035 dbSNP
rs1308662457 3037 dbSNP
rs975957317 3038 dbSNP
rs1386295533 3042 dbSNP
rs964631274 3051 dbSNP
rs563366308 3054 dbSNP
rs543480883 3055 dbSNP
rs1254632623 3056 dbSNP
rs1431894573 3066 dbSNP
rs1458649916 3070 dbSNP
rs532923896 3071 dbSNP
rs1467893207 3078 dbSNP
rs886629059 3092 dbSNP
rs1369528489 3093 dbSNP
rs1429869568 3106 dbSNP
rs1473832415 3107 dbSNP
rs754929374 3107 dbSNP
rs778940501 3107 dbSNP
rs576915633 3109 dbSNP
rs1048249009 3111 dbSNP
rs35633374 3111 dbSNP
rs67353291 3111 dbSNP
rs71551320 3111 dbSNP
rs191015128 3114 dbSNP
rs994941537 3116 dbSNP
rs776754126 3119 dbSNP
rs1197471585 3121 dbSNP
rs564652288 3124 dbSNP
rs541730962 3127 dbSNP
rs114322175 3128 dbSNP
rs555935885 3129 dbSNP
rs1487793814 3130 dbSNP
rs890357088 3133 dbSNP
rs541971835 3135 dbSNP
rs934450975 3136 dbSNP
rs929419489 3142 dbSNP
rs186286561 3143 dbSNP
rs978878540 3144 dbSNP
rs976091310 3145 dbSNP
rs780300285 3146 dbSNP
rs1363245995 3149 dbSNP
rs1456957220 3153 dbSNP
rs556224063 3155 dbSNP
rs12529777 3170 dbSNP
rs542434422 3171 dbSNP
rs957205770 3182 dbSNP
rs959722665 3183 dbSNP
rs1300086054 3189 dbSNP
rs1320054100 3190 dbSNP
rs1035211944 3193 dbSNP
rs982343575 3194 dbSNP
rs746375919 3196 dbSNP
rs779461851 3208 dbSNP
rs1247727942 3209 dbSNP
rs570848637 3210 dbSNP
rs553848663 3211 dbSNP
rs1190175574 3212 dbSNP
rs1411153061 3218 dbSNP
rs1031946103 3221 dbSNP
rs1164819640 3228 dbSNP
rs1370142151 3230 dbSNP
rs1303552081 3232 dbSNP
rs977186484 3233 dbSNP
rs1389191640 3250 dbSNP
rs1436986597 3259 dbSNP
rs995456773 3271 dbSNP
rs1388213037 3277 dbSNP
rs971170302 3280 dbSNP
rs1377207538 3295 dbSNP
rs899241881 3296 dbSNP
rs1017724126 3297 dbSNP
rs1007540000 3309 dbSNP
rs1227167893 3312 dbSNP
rs1268041871 3315 dbSNP
rs1389926256 3316 dbSNP
rs1330307918 3323 dbSNP
rs1172488842 3327 dbSNP
rs890472743 3328 dbSNP
rs534928663 3332 dbSNP
rs112894937 3334 dbSNP
rs1198989014 3344 dbSNP
rs1012553143 3345 dbSNP
rs1245830321 3350 dbSNP
rs1158405932 3352 dbSNP
rs1412588788 3353 dbSNP
rs1458652158 3357 dbSNP
rs1173646139 3375 dbSNP
rs549248405 3386 dbSNP
rs1447492677 3388 dbSNP
rs142738269 3390 dbSNP
rs753567214 3392 dbSNP
rs592939 3393 dbSNP
rs887937627 3400 dbSNP
rs866707493 3413 dbSNP
rs929388296 3414 dbSNP
rs1235137539 3421 dbSNP
rs1276874915 3422 dbSNP
rs549878026 3422 dbSNP
rs901894118 3424 dbSNP
rs1040445530 3430 dbSNP
rs592989 3431 dbSNP
rs62427368 3433 dbSNP
rs886060939 3433 dbSNP
rs886060938 3434 dbSNP
rs928313476 3437 dbSNP
rs982291693 3441 dbSNP
rs1252487324 3444 dbSNP
rs564123949 3447 dbSNP
rs910563550 3449 dbSNP
rs1189257702 3453 dbSNP
rs1437615979 3453 dbSNP
rs1424288391 3461 dbSNP
rs757396524 3464 dbSNP
rs751676462 3465 dbSNP
rs1414816585 3466 dbSNP
rs1177125275 3468 dbSNP
rs1377471845 3469 dbSNP
rs540628373 3469 dbSNP
rs1327364313 3471 dbSNP
rs1371726754 3479 dbSNP
rs74363323 3480 dbSNP
rs1444907448 3481 dbSNP
rs56104837 3481 dbSNP
rs886060937 3481 dbSNP
rs369259412 3483 dbSNP
rs1220152112 3488 dbSNP
rs1027018659 3489 dbSNP
rs1394756417 3490 dbSNP
rs973575967 3495 dbSNP
rs6933329 3497 dbSNP
rs577860076 3498 dbSNP
rs143966094 3499 dbSNP
rs765658706 3500 dbSNP
rs377612532 3501 dbSNP
rs181941841 3502 dbSNP
rs1449743357 3503 dbSNP
rs1236642030 3504 dbSNP
rs766097083 3509 dbSNP
rs780704813 3509 dbSNP
rs555871275 3510 dbSNP
rs1371315806 3511 dbSNP
rs1444013609 3515 dbSNP
rs1256789698 3517 dbSNP
rs1322199688 3518 dbSNP
rs903086774 3519 dbSNP
rs1043390555 3527 dbSNP
rs1026567857 3530 dbSNP
rs1349775013 3534 dbSNP
rs1437664274 3538 dbSNP
rs1328282932 3542 dbSNP
rs1362595329 3553 dbSNP
rs1227302876 3554 dbSNP
rs1011386105 3555 dbSNP
rs559219742 3560 dbSNP
rs1297864555 3563 dbSNP
rs1204434577 3567 dbSNP
rs1226090809 3570 dbSNP
rs869039609 3574 dbSNP
rs10685655 3575 dbSNP
rs1341534091 3576 dbSNP
rs847120 3580 dbSNP
rs386704681 3581 dbSNP
rs1230843206 3582 dbSNP
rs1040414631 3588 dbSNP
rs943482057 3589 dbSNP
rs1476455038 3591 dbSNP
rs889110314 3594 dbSNP
rs1340355674 3601 dbSNP
rs1283917550 3611 dbSNP
rs1406399915 3614 dbSNP
rs1054899350 3615 dbSNP
rs1386982790 3619 dbSNP
rs570573252 3620 dbSNP
rs1342715629 3621 dbSNP
rs1055437925 3625 dbSNP
rs1314015187 3630 dbSNP
rs1327794688 3631 dbSNP
rs1445208763 3642 dbSNP
rs1041668439 3657 dbSNP
rs1187137036 3658 dbSNP
rs1235130236 3663 dbSNP
rs1266148976 3669 dbSNP
rs766476181 3672 dbSNP
rs928428454 3678 dbSNP
rs1209082968 3682 dbSNP
rs1248915125 3683 dbSNP
rs1448906603 3685 dbSNP
rs116664363 3687 dbSNP
rs917110043 3688 dbSNP
rs1167799245 3700 dbSNP
rs554141897 3704 dbSNP
rs886060936 3705 dbSNP
rs1160305060 3709 dbSNP
rs991223438 3710 dbSNP
rs1412337438 3723 dbSNP
rs929662353 3727 dbSNP
rs1429939122 3728 dbSNP
rs570264936 3730 dbSNP
rs1340610414 3738 dbSNP
rs1416062707 3747 dbSNP
rs1286418522 3749 dbSNP
rs974074062 3752 dbSNP
rs1228800992 3754 dbSNP
rs886060935 3772 dbSNP
rs1161177600 3776 dbSNP
rs77397602 3782 dbSNP
rs1199009579 3790 dbSNP
rs910724535 3791 dbSNP
rs1486063443 3796 dbSNP
rs986337328 3797 dbSNP
rs886060934 3800 dbSNP
rs1190106458 3808 dbSNP
rs776610053 3809 dbSNP
rs954767684 3818 dbSNP
rs1030448903 3819 dbSNP
rs1183363214 3827 dbSNP
rs1365984885 3830 dbSNP
rs1477235397 3842 dbSNP
rs1171683795 3849 dbSNP
rs1181340150 3855 dbSNP
rs1482054538 3858 dbSNP
rs1305588098 3869 dbSNP
rs1369888203 3876 dbSNP
rs1410288171 3879 dbSNP
rs1249655731 3887 dbSNP
rs951085034 3888 dbSNP
rs566002908 3894 dbSNP
rs12661966 3895 dbSNP
rs779858222 3897 dbSNP
rs1289436927 3903 dbSNP
rs535673894 3909 dbSNP
rs1272489056 3910 dbSNP
rs1482769179 3913 dbSNP
rs1196946456 3918 dbSNP
rs747599176 3918 dbSNP
rs966166034 3919 dbSNP
rs1226884406 3921 dbSNP
rs1198544953 3933 dbSNP
rs967801950 3934 dbSNP
rs1455259497 3942 dbSNP
rs1166177019 3947 dbSNP
rs374547546 3948 dbSNP
rs1228277695 3949 dbSNP
rs750360550 3949 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.753 1.7e-5 0.747 2.1e-5 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.656 1.9e-4 0.615 5.3e-4 25 Click to see details
GSE21032 Prostate cancer 0.364 3.6e-4 0.296 3.3e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.663 7.2e-4 0.764 4.4e-5 20 Click to see details
GSE32688 Pancreatic cancer -0.535 8.0e-4 -0.084 3.2e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.421 7.6e-2 -0.346 1.2e-1 13 Click to see details
GSE38226 Liver fibrosis -0.304 9.0e-2 -0.090 3.5e-1 21 Click to see details
GSE14794 Lymphoblastoid cells 0.13 1.1e-1 0.119 1.3e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.226 1.4e-1 -0.265 1.1e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.27 1.6e-1 0.415 5.5e-2 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.227 1.7e-1 -0.403 3.9e-2 20 Click to see details
GSE17498 Multiple myeloma 0.146 1.8e-1 0.233 7.4e-2 40 Click to see details
GSE28544 Breast cancer 0.122 2.9e-1 0.283 9.0e-2 24 Click to see details
GSE19350 CNS germ cell tumors 0.18 2.9e-1 -0.140 3.3e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.105 3.1e-1 0.053 4.0e-1 25 Click to see details
GSE19783 ER- ER- breast cancer 0.057 3.1e-1 0.033 3.9e-1 79 Click to see details
GSE21849 B cell lymphoma -0.057 3.8e-1 -0.091 3.2e-1 29 Click to see details
GSE17306 Multiple myeloma -0.031 4.2e-1 -0.088 2.7e-1 49 Click to see details
GSE19536 Breast cancer 0.01 4.6e-1 -0.018 4.3e-1 100 Click to see details
GSE21687 Ependynoma primary tumors 0.006 4.8e-1 0.028 4.1e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.006 4.8e-1 0.028 4.1e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.439 0 -0.390 0.01 42 Click to see details
STAD -0.405 0.01 -0.470 0 32 Click to see details
BRCA 0.241 0.01 0.201 0.03 84 Click to see details
LIHC -0.284 0.02 -0.338 0.01 49 Click to see details
BLCA -0.416 0.04 -0.496 0.02 18 Click to see details
KIRC 0.171 0.08 0.139 0.13 68 Click to see details
PAAD -0.644 0.18 -0.800 0.1 4 Click to see details
THCA -0.122 0.18 -0.214 0.05 59 Click to see details
PCPG 0.794 0.21 0.500 0.33 3 Click to see details
UCEC 0.188 0.22 0.175 0.24 19 Click to see details
PRAD -0.099 0.25 -0.090 0.27 50 Click to see details
KIRP -0.124 0.25 -0.102 0.29 32 Click to see details
CHOL -0.187 0.31 -0.250 0.26 9 Click to see details
COAD -0.198 0.32 -0.429 0.14 8 Click to see details
LUSC -0.062 0.36 -0.085 0.31 38 Click to see details
ESCA -0.084 0.4 -0.045 0.45 11 Click to see details
KICH 0.043 0.42 0.088 0.34 25 Click to see details
LUAD 0.058 0.43 0.070 0.41 12 Click to see details
CESC -0.024 0.49 -0.500 0.33 3 Click to see details
CESC -0.024 0.49 -0.500 0.33 3 Click to see details
CESC -0.024 0.49 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1