miRTarBase - #MIRT051327 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIF1A   
Synonyms ATSV, C2orf20, HSN2C, MRD9, SPG30, UNC104
Description kinesin family member 1A
Transcript NM_004321   
Expression
Putative miRNA Targets on KIF1A
3'UTR of KIF1A
(miRNA target sites are highlighted)
>KIF1A|NM_004321|3'UTR
   1 ACCTGAGCCCTCCCGTGACAGCCGGCAGGCCCAGCCCATCCCCTCCCTCATCCTCGTCTGTCCTGTCACCTGCCGCCCAG
  81 CCCCTCTCCTGCCAGACAGCCCACGACCGGGTCGACCCCCCAGGGGACGCCCATGCCAGGCCCGGGGACCTGTGCCACAC
 161 GACCAGCTGTGCTCCCAGCAGAGGCTGTGCGTGTCAGTTCTTCTTGCAGAATGTGCTCTGGTGGAACAAGTTGGGAGAGG
 241 CTGGGGGGGCCAAGGGCACAGGTTACGGGGGTTCTTGCTGCCGTTCTAATATTTTTTTAAGCATAGACAGACTTATAATT
 321 AATATACGTTAGTTAGTGACATTGAAACAGTCAACTCGGAAATTAACTATAAGACTTGTTCTATTTATAAGTATTTATTT
 401 CTAATGCCTCCACATAGCCCTGTAATATTCAGATGGAACCCCCAACCACCTCCACCCTGTTTGTTCCCACATGTGTCTCC
 481 CAAGCCTGCTAGGGACAGGCAGGGCAGGGACAGCCACCTTGGAAGGCCGCAGTGAGGAGCTGTCTGGACCAGTGGGGCAC
 561 CTTGGGGCTAGCACACGGGTGTATCGCCTGGGCCCCAGGCTTCTCCATGGCCACATGGGTCCTGGGTGTATGTGTGGGAG
 641 AGTGGGGGGGTGTCTTTGGTGCCTGAAGTCTGCGCGGCATGGAGGGTGGTGTGAGTTCCTCTGGTGGGAGGGAGAACGCA
 721 CATCTCTTCTGGGCGGCCACCTGAGGAGTGACTCCAAGAAGAGTTCCGGCAGCTTTCCCCAGGAAAGGGTGAGGGGTGAC
 801 ACTCGGCTCTGGCTCTGAGATGAGGCAGACGGCACCCAGGCTGTGATCTGTCCTGGGCGGGGACCAGGAGGGAGCGGGGT
 881 CGGGATCACCTGCCAGTGTGCAGACTCTGGGACTGCGTGCTGTCTCCGGACCATCAGGGTAGGGTGGTGGGTTGAGACCA
 961 GGAAGTCAGGGAAGATCGGAATTCAGGGCGACGGTCTAGGTGTCGAGGGCTGTGGCGCAGCCTCTTCAGCTGCGGCGAGA
1041 AATGGAGTGAGTCAAGGTAGCTTCTGGGAAGAAATGCTGCCATTAGCAGGTTTCTTGCAAAGACTTTCCTCTCTTTGTTC
1121 CCAGGGCAGAGAGTTTCTGTGAGTCCCACTGAGAAAATCCCATGGGGTGGGGGTATCCTGGTCGGTCGGCAATGGAGGGT
1201 GGCTGGCTTGGTGGTTATTGTCTTCAAGGAGCTCTTCGCTGCTGCATCTGCGGTGTCCCTTTGTTCTTGTCCCATTTCAC
1281 CCCCTCTGCAGACACCAATGTCCGAGGGCCACCCAGGACAGGACGGGGGTCAGCCCCAAGCTGAGAGTCTGGTCATAGGA
1361 GTCATGTCCAGAGGCCTAGGGAGGTTTTAGGGCCCTCCCCACCCACACCCACAGGTCGATTTGGTCTCTTTTTAGCTCAA
1441 GGAAAGACAGTAGCCAAGCAACAGAGCCCCTCTCCCGCCGTGGCCCGTGGGAGCAGTTACATCGGGTCTGGTGCTCCAGA
1521 CCTAGGGCCCAGCACTTTCATCAGATCCTGCCTCCTGGAGTGGGGGAAACGCAGCACCCCACTGGTTCTGAGGCCCCTAC
1601 CCTCCCAGGCTGTCCCACGTGATGCTGACATGAGCCTCAGAGACCCCAATCCCATGCCTGGGGGAGAGACAGCGGCTCAG
1681 GAGTGGGGGAGCACGGGCCTTCTACACCACATGGGAAGGCTCTGGCATGAGGTTTTCCTTTGGGAAGGTTGTTTGGGCCC
1761 CTGAAGTTCCATCTCCGAGAGTGGTGTGCAGGGCAGGCCAGGGCCCATGCTGGCTGCAGTCTCTGTGGCTGCCTGCCTGG
1841 GCCAGCCTGTTTGGGAGCTGGGACTGTGGGCTCGCCTTTTCGTACCTGGGCTCAGGTGCGGTGTGGCCACCGCCACCCTC
1921 ATCCCCTGCCTGGGAGGCTCTCCCAGGGGCTGATGGGGGGGTTCTGTGAGGGAGAATCAGGGCTCGGGAAGCCACGCCTG
2001 GGAAGGCAGGACACAGGACACAGCAGCTTTCTTTGGAAATCTCCCAGGTGAGGATTCACATCCCAAAATAAAATTCAGAA
2081 GCCAGGTGGCCTGTGCTCCCCATGGGTGACCTCTGGAGGCAGTGGACCAAGATGCAGCAAGGAGAGGATGCAGAACAGCT
2161 TCTTGCAGAAGCACCTGCTCCGGCATCCAGCGCTGCCTGGAGGCAGGAAGGAGAGGCAGGGCAGGACACGCTGGTCTGAG
2241 ATGAGGGGGAGCCCCACGGGCCCCAGGCAGGCTAGAGGAGGCACAGGCCCTGCCACGGCCAACTCAGGTCAGCCAGCCTG
2321 AGGCTGTGGCCTCCAAAGGGTCTGGGCGCACCCCCCAGGTCGCAGGTGTCTGAGGCCAGCCAACCTGCAGAGCACTCGCG
2401 GCGTGGGTGGGCTGAGTGGAGGTGCCTGGGAGCTGCCTAAATTCAGAAGCCTCCACTGCCATGGAGACTGCCTGGCTGTG
2481 TCCTCTCAGCCAGGTGCCGTGTTGGCCTTGGCTAGGACCCAGAGCCACACTGCAGCCTCCGCCGACTCCCTCCTTCCGGG
2561 CCTGCTCTAGTGAGGAGTGCCTAAGCCAGGACCCAGAAACTCAGAGTTGATGGTGAGAGGAGGCCGCCTGAGTCAGGACA
2641 CCTGGCTTCTTGAAAAGTTCGCTCTGCCAGAAACCACCTAGGGACCACGTTAGCTGCCTTCCTTGAGCTCCCCAGGAGTC
2721 GGTTTCCACATCTGTGAGGTGGAGGGCTGGTGTGGAGGTGCTCATGGGGTGCGGTGCTTGGGAGACAGCCAGGCCCAGGG
2801 TGGCTGCTGCTTCCTGCTAAGTGGGGGAGGTGAGACAGATCTGGAAAGCCGTCTCCCTCAGATGGTTTCATTTAATGCTT
2881 TATACTGCCGAGTCTGGGGGCTTGTTTTGGTTTGGGGGCAGCCATCCTCCACCAGAAAGGGGGAGCTCCTTCCGCTGCGG
2961 CTCCAGATAGATGGGGATGCCGGGCTCCAGGCCGACCAGCACTTGGGATCTGATGGGACACGGCCAGTGCCTAGGGGTGC
3041 CAAGTCCAAGGCCTCCCACTGGGAGTCATCGCTGAGAAGATGCCAATGTTTCATCCACCGGCTGCACAGGCACAAACTCC
3121 CCCACCCAGGACGGCTGTGATGAGGTGGCCCTCCCTGTCAACCCTGGTCCCTGGAGTCCCCAGCACCTGGGGCCCTGGTG
3201 GGGCTGATGTCACAGGTGTTTACTGTGCTGCTGCACTGGTCCTATGCCAGCCTCACCCATGTGGGGACCACGGAAGGCAC
3281 ACTCCCTTACCCCCGGTGCCGGGCCGTGCGGTCCCCCAGACGGACAGCAGCTGTGGCGACCTGCGTTTCTCCCTGGGCCT
3361 GTGCTTCCTGTAGTTAGTCCGTCCCCTGGTTCCCCTGTGGCTCAGAGGCCGCGTCCCTGGCTTGTACATATGTGATTGCT
3441 GTGGGCACACCCCAGACCCCATGTCATAGCTGCCGTCCCGACGTCACGACGCCTGTCCCGATGTCTTACACCCGAGTGTT
3521 AGCCCTAGGCTCCTGTACTGTGCGTGCACTTGAGGCTCTGTCCAATTAAGAAATAAATGTGGCTCTTACTCAACACAGTC
3601 AAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU-ACACGACGAu 5'
            ||:::  ||| ||||||||| 
Target 5' caCAGGTGTTTACTGTGCTGCTg 3'
3211 - 3233 164.00 -19.50
2
miRNA  3' guGUUU-GGUAAUAC--ACGACGAu 5'
            ||:: |||  :||  ||||||| 
Target 5' gcCAGGCCCAGGGTGGCTGCTGCTt 3'
2788 - 2812 154.00 -18.40
3
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             :|:|: ||   ||||||  
Target 5' aagGAGCTCTTCGCTGCTGCat 3'
1226 - 1247 131.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
897954 15 ClinVar
335253 23 ClinVar
335252 35 ClinVar
897953 38 ClinVar
335251 108 ClinVar
896337 120 ClinVar
335250 129 ClinVar
896336 190 ClinVar
335249 241 ClinVar
896335 244 ClinVar
896334 249 ClinVar
335248 250 ClinVar
896333 267 ClinVar
896332 347 ClinVar
335247 485 ClinVar
335246 552 ClinVar
894897 555 ClinVar
894896 574 ClinVar
335245 576 ClinVar
894895 768 ClinVar
894894 821 ClinVar
335244 830 ClinVar
899025 912 ClinVar
335243 1005 ClinVar
899024 1111 ClinVar
335242 1187 ClinVar
335241 1205 ClinVar
899023 1209 ClinVar
335240 1237 ClinVar
899022 1241 ClinVar
897885 1251 ClinVar
897884 1418 ClinVar
897883 1456 ClinVar
897882 1486 ClinVar
897881 1487 ClinVar
897880 1581 ClinVar
335239 1615 ClinVar
897879 1630 ClinVar
896269 1662 ClinVar
335238 1685 ClinVar
335237 1686 ClinVar
335236 1694 ClinVar
335235 1743 ClinVar
335234 1776 ClinVar
335233 1823 ClinVar
335232 1883 ClinVar
894829 1951 ClinVar
894828 1959 ClinVar
335231 1960 ClinVar
894826 1960 ClinVar
894827 1960 ClinVar
335230 1973 ClinVar
894825 1978 ClinVar
335229 2133 ClinVar
335228 2160 ClinVar
335227 2257 ClinVar
898959 2361 ClinVar
898958 2362 ClinVar
898957 2399 ClinVar
898956 2403 ClinVar
335226 2458 ClinVar
898955 2490 ClinVar
898954 2498 ClinVar
335225 2499 ClinVar
897803 2505 ClinVar
897802 2541 ClinVar
335224 2542 ClinVar
335223 2543 ClinVar
335222 2576 ClinVar
335221 2632 ClinVar
897801 2720 ClinVar
335220 2738 ClinVar
335219 2794 ClinVar
896200 2796 ClinVar
896199 2840 ClinVar
335218 2851 ClinVar
896198 2897 ClinVar
335217 2954 ClinVar
335216 3035 ClinVar
335215 3038 ClinVar
895922 3287 ClinVar
895921 3300 ClinVar
895920 3306 ClinVar
335214 3309 ClinVar
335213 3345 ClinVar
895919 3373 ClinVar
335212 3410 ClinVar
898884 3483 ClinVar
335211 3488 ClinVar
335210 3494 ClinVar
335209 3499 ClinVar
898883 3514 ClinVar
335208 3596 ClinVar
COSN30150840 4 COSMIC
COSN31602516 14 COSMIC
COSN30188172 15 COSMIC
COSN30592075 17 COSMIC
COSN30571788 21 COSMIC
COSN26554444 26 COSMIC
COSN30477960 52 COSMIC
COSN30154026 55 COSMIC
COSN30710676 56 COSMIC
COSN30457012 58 COSMIC
COSN28855112 68 COSMIC
COSN8608910 69 COSMIC
COSN24557338 75 COSMIC
COSN32064761 91 COSMIC
COSN30515489 95 COSMIC
COSN1236498 102 COSMIC
COSN30180386 114 COSMIC
COSN30629123 128 COSMIC
COSN31597126 143 COSMIC
COSN30506281 144 COSMIC
COSN31561825 266 COSMIC
COSN20090759 281 COSMIC
COSN32063193 283 COSMIC
COSN22631169 446 COSMIC
COSN6176448 475 COSMIC
COSN7242260 529 COSMIC
COSN27683904 585 COSMIC
COSN9997600 588 COSMIC
COSN32064688 606 COSMIC
COSN29602765 644 COSMIC
COSN22160913 1053 COSMIC
COSN32042546 1131 COSMIC
COSN15448582 1817 COSMIC
COSN17200765 1900 COSMIC
COSN26696758 2713 COSMIC
COSN19176278 2773 COSMIC
COSN29172893 3088 COSMIC
COSN20090758 3301 COSMIC
COSN4803432 3322 COSMIC
COSN31579904 3386 COSMIC
COSN26549115 3490 COSMIC
COSN28750819 3494 COSMIC
COSN30544431 3499 COSMIC
COSN31540162 3513 COSMIC
COSN31513685 3514 COSMIC
COSN31571966 3532 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1416308066 3 dbSNP
rs751236889 9 dbSNP
rs763602305 10 dbSNP
rs775303081 14 dbSNP
rs949782720 14 dbSNP
rs762837283 15 dbSNP
rs1343410937 21 dbSNP
rs531276835 23 dbSNP
rs372244073 24 dbSNP
rs771850738 24 dbSNP
rs563350862 26 dbSNP
rs776542312 28 dbSNP
rs368053227 29 dbSNP
rs1180271087 30 dbSNP
rs747005832 32 dbSNP
rs375874661 35 dbSNP
rs772148613 38 dbSNP
rs748374545 40 dbSNP
rs930262089 41 dbSNP
rs1242595613 43 dbSNP
rs779468930 50 dbSNP
rs920170527 55 dbSNP
rs974297206 56 dbSNP
rs942876187 62 dbSNP
rs1248734858 65 dbSNP
rs1015454204 69 dbSNP
rs1193951429 72 dbSNP
rs911369171 74 dbSNP
rs56051420 84 dbSNP
rs1368153918 97 dbSNP
rs1251577310 102 dbSNP
rs987292027 103 dbSNP
rs1190935025 104 dbSNP
rs548422454 105 dbSNP
rs1061113 108 dbSNP
rs562109203 109 dbSNP
rs957295332 111 dbSNP
rs1033330948 113 dbSNP
rs1001432481 115 dbSNP
rs895227286 116 dbSNP
rs1055639642 120 dbSNP
rs970315998 121 dbSNP
rs1281123911 122 dbSNP
rs936642381 124 dbSNP
rs540308680 125 dbSNP
rs573357958 126 dbSNP
rs1024104800 128 dbSNP
rs779232085 129 dbSNP
rs1326734497 139 dbSNP
rs186456890 143 dbSNP
rs1317627786 147 dbSNP
rs886182139 151 dbSNP
rs1443246886 157 dbSNP
rs1047424971 160 dbSNP
rs564598846 161 dbSNP
rs898802782 177 dbSNP
rs1403773929 183 dbSNP
rs954396239 184 dbSNP
rs1171512358 185 dbSNP
rs921006450 190 dbSNP
rs557161979 191 dbSNP
rs1326508236 206 dbSNP
rs1349008064 206 dbSNP
rs377466581 206 dbSNP
rs962327389 231 dbSNP
rs1289498670 232 dbSNP
rs757646908 240 dbSNP
rs1061114 241 dbSNP
rs942924768 244 dbSNP
rs1170024330 245 dbSNP
rs911386347 248 dbSNP
rs1004050126 250 dbSNP
rs886055835 250 dbSNP
rs1191751592 254 dbSNP
rs1024679629 257 dbSNP
rs1253827612 262 dbSNP
rs1051255489 266 dbSNP
rs934101335 267 dbSNP
rs1444604441 270 dbSNP
rs913299465 271 dbSNP
rs1377680830 272 dbSNP
rs1258372793 277 dbSNP
rs1210279724 278 dbSNP
rs988842486 282 dbSNP
rs1012732534 283 dbSNP
rs957373477 289 dbSNP
rs1385607743 299 dbSNP
rs1399180796 299 dbSNP
rs764357969 304 dbSNP
rs1301255593 307 dbSNP
rs1215372721 318 dbSNP
rs1331752247 322 dbSNP
rs1235568349 327 dbSNP
rs1339913365 328 dbSNP
rs760855881 328 dbSNP
rs1341752661 330 dbSNP
rs752874992 331 dbSNP
rs1205563338 336 dbSNP
rs757813982 338 dbSNP
rs925954394 342 dbSNP
rs575874302 345 dbSNP
rs980430784 346 dbSNP
rs180713855 347 dbSNP
rs1268015187 352 dbSNP
rs1434373916 355 dbSNP
rs903815857 358 dbSNP
rs1024594527 365 dbSNP
rs536101201 369 dbSNP
rs1042422718 373 dbSNP
rs1449704765 373 dbSNP
rs747654713 375 dbSNP
rs1375128095 378 dbSNP
rs1456772553 386 dbSNP
rs1293429595 387 dbSNP
rs1392149605 389 dbSNP
rs945393872 401 dbSNP
rs780728687 404 dbSNP
rs1364653263 412 dbSNP
rs767656848 418 dbSNP
rs1229391455 419 dbSNP
rs1300176362 424 dbSNP
rs1319664293 432 dbSNP
rs1014040348 439 dbSNP
rs1051806697 440 dbSNP
rs1265908604 446 dbSNP
rs1489440612 447 dbSNP
rs56134660 450 dbSNP
rs1413638246 455 dbSNP
rs1206206148 456 dbSNP
rs1246897646 458 dbSNP
rs932825812 463 dbSNP
rs1373039125 466 dbSNP
rs921447650 469 dbSNP
rs1253690107 471 dbSNP
rs1170153409 473 dbSNP
rs886055834 485 dbSNP
rs759473935 486 dbSNP
rs1369513662 502 dbSNP
rs941118466 503 dbSNP
rs908333254 504 dbSNP
rs1387988166 514 dbSNP
rs111464546 515 dbSNP
rs1419300057 516 dbSNP
rs1026032721 519 dbSNP
rs1166493909 528 dbSNP
rs994522424 529 dbSNP
rs898828496 530 dbSNP
rs868583458 533 dbSNP
rs367698654 537 dbSNP
rs1007585594 539 dbSNP
rs890039757 540 dbSNP
rs1187769791 548 dbSNP
rs1267501195 550 dbSNP
rs1484737989 551 dbSNP
rs866854968 552 dbSNP
rs934132231 553 dbSNP
rs913376386 555 dbSNP
rs1437443065 556 dbSNP
rs1181574443 560 dbSNP
rs1257281857 561 dbSNP
rs1053215337 562 dbSNP
rs1476428358 568 dbSNP
rs1271092296 574 dbSNP
rs552928475 576 dbSNP
rs1000916696 577 dbSNP
rs534342286 579 dbSNP
rs1357574662 580 dbSNP
rs980120148 583 dbSNP
rs1303702991 586 dbSNP
rs1357131372 606 dbSNP
rs948685441 607 dbSNP
rs917146857 610 dbSNP
rs992649898 615 dbSNP
rs1351060933 624 dbSNP
rs950570979 626 dbSNP
rs774347884 628 dbSNP
rs1051327089 635 dbSNP
rs1326396288 643 dbSNP
rs973134127 644 dbSNP
rs1251675688 649 dbSNP
rs1395596338 650 dbSNP
rs1178965985 651 dbSNP
rs570194191 651 dbSNP
rs1164917039 656 dbSNP
rs899960455 658 dbSNP
rs1432743352 670 dbSNP
rs1177023250 673 dbSNP
rs770766794 674 dbSNP
rs1017726095 675 dbSNP
rs941569299 676 dbSNP
rs1007207112 682 dbSNP
rs908279794 683 dbSNP
rs982521964 687 dbSNP
rs1414349364 695 dbSNP
rs1366245278 701 dbSNP
rs1219354005 708 dbSNP
rs949717848 717 dbSNP
rs1490049528 718 dbSNP
rs890061172 719 dbSNP
rs1231402597 720 dbSNP
rs551831185 721 dbSNP
rs1438813613 722 dbSNP
rs1207241588 731 dbSNP
rs1029935612 734 dbSNP
rs958879691 735 dbSNP
rs536755357 749 dbSNP
rs1032964122 751 dbSNP
rs1397079207 754 dbSNP
rs1447894615 757 dbSNP
rs978589982 761 dbSNP
rs967227544 762 dbSNP
rs1167671512 766 dbSNP
rs536932972 767 dbSNP
rs1009670783 768 dbSNP
rs1321478156 777 dbSNP
rs1213032940 778 dbSNP
rs1436518845 789 dbSNP
rs955380475 793 dbSNP
rs891972774 800 dbSNP
rs548126746 801 dbSNP
rs997076828 804 dbSNP
rs1340458299 805 dbSNP
rs529999168 805 dbSNP
rs900078348 807 dbSNP
rs936119192 807 dbSNP
rs1371899284 808 dbSNP
rs559417152 809 dbSNP
rs377657592 811 dbSNP
rs773115422 830 dbSNP
rs948735832 831 dbSNP
rs1188128777 840 dbSNP
rs917224269 841 dbSNP
rs1242960351 844 dbSNP
rs1347500667 846 dbSNP
rs1161271323 854 dbSNP
rs1412893230 855 dbSNP
rs992707271 858 dbSNP
rs1046775100 859 dbSNP
rs949842377 865 dbSNP
rs1433765796 870 dbSNP
rs1193212801 872 dbSNP
rs916887615 874 dbSNP
rs1055859049 875 dbSNP
rs929190287 876 dbSNP
rs1282798669 881 dbSNP
rs756624246 882 dbSNP
rs1234429132 892 dbSNP
rs1275677903 894 dbSNP
rs769614870 896 dbSNP
rs1327132878 897 dbSNP
rs925843199 898 dbSNP
rs978704171 901 dbSNP
rs1285166957 903 dbSNP
rs189536509 912 dbSNP
rs1185066513 916 dbSNP
rs528460761 917 dbSNP
rs184469969 920 dbSNP
rs955653525 922 dbSNP
rs986253937 927 dbSNP
rs564493190 928 dbSNP
rs546272235 936 dbSNP
rs1159301400 947 dbSNP
rs1386598735 949 dbSNP
rs1333166885 951 dbSNP
rs1412416389 951 dbSNP
rs954381760 958 dbSNP
rs1216333740 968 dbSNP
rs575815935 977 dbSNP
rs563896050 978 dbSNP
rs1415832257 982 dbSNP
rs1349210711 984 dbSNP
rs997234500 986 dbSNP
rs1280222017 989 dbSNP
rs1353005229 990 dbSNP
rs542103771 991 dbSNP
rs964040737 992 dbSNP
rs1278236015 993 dbSNP
rs1485864048 994 dbSNP
rs1029966343 996 dbSNP
rs1315870918 1000 dbSNP
rs998448274 1004 dbSNP
rs58502378 1005 dbSNP
rs1236108775 1013 dbSNP
rs1031884797 1016 dbSNP
rs1000352591 1017 dbSNP
rs553422427 1019 dbSNP
rs1171611176 1027 dbSNP
rs1364455174 1028 dbSNP
rs541351100 1033 dbSNP
rs1430640266 1036 dbSNP
rs887238261 1037 dbSNP
rs1369182462 1043 dbSNP
rs1409735806 1045 dbSNP
rs1047226841 1047 dbSNP
rs1044499709 1049 dbSNP
rs948774593 1055 dbSNP
rs576384972 1056 dbSNP
rs1231221860 1058 dbSNP
rs1175573125 1067 dbSNP
rs1435365338 1068 dbSNP
rs1274435382 1075 dbSNP
rs1348909021 1085 dbSNP
rs1272228612 1098 dbSNP
rs1394739630 1109 dbSNP
rs1196306496 1110 dbSNP
rs73119967 1111 dbSNP
rs1449322005 1115 dbSNP
rs1055573407 1119 dbSNP
rs371267224 1122 dbSNP
rs1057051254 1125 dbSNP
rs936990735 1126 dbSNP
rs1263567585 1131 dbSNP
rs776101995 1132 dbSNP
rs1299221636 1134 dbSNP
rs1399287889 1142 dbSNP
rs1385113330 1146 dbSNP
rs145262952 1147 dbSNP
rs879214217 1150 dbSNP
rs1371929785 1166 dbSNP
rs1443364884 1169 dbSNP
rs1295765155 1170 dbSNP
rs569698266 1173 dbSNP
rs1037966615 1180 dbSNP
rs941884903 1181 dbSNP
rs554728410 1183 dbSNP
rs1347887748 1184 dbSNP
rs3732342 1187 dbSNP
rs746439602 1188 dbSNP
rs1253063382 1189 dbSNP
rs954413379 1193 dbSNP
rs1469470396 1201 dbSNP
rs886055833 1205 dbSNP
rs779540973 1221 dbSNP
rs1309704876 1230 dbSNP
rs1428239561 1233 dbSNP
rs3732341 1237 dbSNP
rs547687011 1239 dbSNP
rs114566813 1241 dbSNP
rs139653512 1251 dbSNP
rs1031911756 1252 dbSNP
rs1000827893 1257 dbSNP
rs1395310156 1264 dbSNP
rs1463118032 1268 dbSNP
rs1318764540 1272 dbSNP
rs1315303768 1274 dbSNP
rs954589677 1282 dbSNP
rs34515156 1285 dbSNP
rs922664609 1291 dbSNP
rs1338540739 1294 dbSNP
rs975533956 1295 dbSNP
rs1273779904 1296 dbSNP
rs1311352176 1299 dbSNP
rs968916439 1303 dbSNP
rs552643698 1304 dbSNP
rs566569073 1308 dbSNP
rs1264285666 1314 dbSNP
rs377565618 1324 dbSNP
rs778141448 1325 dbSNP
rs757549114 1327 dbSNP
rs1057081754 1328 dbSNP
rs531029550 1342 dbSNP
rs971256554 1342 dbSNP
rs1344768398 1343 dbSNP
rs1454488419 1345 dbSNP
rs897799804 1351 dbSNP
rs951622507 1355 dbSNP
rs1025934680 1356 dbSNP
rs1357322894 1357 dbSNP
rs1170911466 1359 dbSNP
rs1037640832 1364 dbSNP
rs375563430 1365 dbSNP
rs941905197 1368 dbSNP
rs756419691 1370 dbSNP
rs1305690701 1374 dbSNP
rs1050680233 1376 dbSNP
rs752927858 1378 dbSNP
rs922998380 1385 dbSNP
rs1217494674 1389 dbSNP
rs987834796 1389 dbSNP
rs1210605174 1392 dbSNP
rs371007788 1399 dbSNP
rs1189911934 1400 dbSNP
rs1034485794 1406 dbSNP
rs1258744793 1414 dbSNP
rs1476478972 1417 dbSNP
rs115877951 1418 dbSNP
rs11552616 1423 dbSNP
rs1161524197 1424 dbSNP
rs924917958 1426 dbSNP
rs866927510 1432 dbSNP
rs979044140 1447 dbSNP
rs1313266855 1451 dbSNP
rs904152498 1456 dbSNP
rs1042754394 1458 dbSNP
rs969367914 1461 dbSNP
rs1023172162 1464 dbSNP
rs1373394319 1465 dbSNP
rs1225021526 1466 dbSNP
rs1013019788 1470 dbSNP
rs1481396932 1475 dbSNP
rs1251475936 1476 dbSNP
rs571198151 1477 dbSNP
rs1281474134 1479 dbSNP
rs542390399 1480 dbSNP
rs866269519 1483 dbSNP
rs530196248 1486 dbSNP
rs897826687 1487 dbSNP
rs1354973571 1495 dbSNP
rs1016646530 1501 dbSNP
rs559527021 1504 dbSNP
rs1265485296 1514 dbSNP
rs751575058 1515 dbSNP
rs942795718 1521 dbSNP
rs376811838 1522 dbSNP
rs1393164034 1527 dbSNP
rs1174550327 1528 dbSNP
rs1396627036 1530 dbSNP
rs1347286268 1532 dbSNP
rs1427656053 1533 dbSNP
rs1169636471 1538 dbSNP
rs1355047583 1540 dbSNP
rs1397522584 1542 dbSNP
rs1291313599 1543 dbSNP
rs118065059 1551 dbSNP
rs1441148730 1558 dbSNP
rs751703925 1559 dbSNP
rs577161038 1562 dbSNP
rs910002914 1563 dbSNP
rs1350489452 1564 dbSNP
rs1397837458 1565 dbSNP
rs879151616 1566 dbSNP
rs933128038 1570 dbSNP
rs901649246 1571 dbSNP
rs1184803303 1577 dbSNP
rs1026303902 1579 dbSNP
rs558128100 1581 dbSNP
rs993108355 1585 dbSNP
rs1468122005 1595 dbSNP
rs960460986 1599 dbSNP
rs1255189633 1601 dbSNP
rs1420309204 1609 dbSNP
rs935033128 1612 dbSNP
rs543044129 1615 dbSNP
rs1447372752 1616 dbSNP
rs1250797251 1617 dbSNP
rs796065839 1618 dbSNP
rs1411574565 1619 dbSNP
rs1162649077 1620 dbSNP
rs1393093931 1621 dbSNP
rs1456761693 1630 dbSNP
rs1001252981 1637 dbSNP
rs766383750 1640 dbSNP
rs1327434312 1647 dbSNP
rs762956823 1649 dbSNP
rs1214903379 1653 dbSNP
rs916134088 1662 dbSNP
rs1363151994 1663 dbSNP
rs1216799560 1670 dbSNP
rs576072415 1673 dbSNP
rs192884333 1674 dbSNP
rs1009891839 1678 dbSNP
rs1275205888 1683 dbSNP
rs3732340 1685 dbSNP
rs142220621 1686 dbSNP
rs972132809 1691 dbSNP
rs1389889371 1692 dbSNP
rs3732339 1694 dbSNP
rs941906730 1695 dbSNP
rs909951641 1698 dbSNP
rs1385927266 1707 dbSNP
rs1461723897 1713 dbSNP
rs1048492217 1716 dbSNP
rs1393679486 1717 dbSNP
rs1161319392 1720 dbSNP
rs1016308958 1725 dbSNP
rs768191398 1726 dbSNP
rs746588133 1728 dbSNP
rs1454902717 1737 dbSNP
rs3732338 1743 dbSNP
rs1355386502 1752 dbSNP
rs1233927632 1758 dbSNP
rs1295220887 1761 dbSNP
rs369089699 1767 dbSNP
rs1028927971 1769 dbSNP
rs771530865 1776 dbSNP
rs1448460414 1781 dbSNP
rs1437401816 1785 dbSNP
rs901680361 1786 dbSNP
rs1052259532 1803 dbSNP
rs1256671960 1805 dbSNP
rs189757459 1807 dbSNP
rs935106623 1810 dbSNP
rs1361527550 1815 dbSNP
rs960330317 1816 dbSNP
rs903582723 1819 dbSNP
rs1043428042 1822 dbSNP
rs7566538 1823 dbSNP
rs1409722692 1847 dbSNP
rs530842068 1851 dbSNP
rs1402733463 1866 dbSNP
rs1288367304 1870 dbSNP
rs570045314 1873 dbSNP
rs916222653 1874 dbSNP
rs1260192238 1876 dbSNP
rs778192994 1881 dbSNP
rs548349076 1882 dbSNP
rs886055832 1883 dbSNP
rs1231743388 1885 dbSNP
rs928843524 1899 dbSNP
rs374914456 1900 dbSNP
rs1212928339 1901 dbSNP
rs1248402546 1905 dbSNP
rs1436664565 1906 dbSNP
rs1369894325 1911 dbSNP
rs962177975 1912 dbSNP
rs1452207109 1913 dbSNP
rs71404662 1919 dbSNP
rs1172675616 1923 dbSNP
rs1394857818 1931 dbSNP
rs1383847665 1934 dbSNP
rs1016748980 1940 dbSNP
rs1030005316 1946 dbSNP
rs1390853166 1948 dbSNP
rs1477065469 1955 dbSNP
rs1417277838 1956 dbSNP
rs1396513192 1959 dbSNP
rs184324379 1960 dbSNP
rs541275784 1961 dbSNP
rs1195818776 1962 dbSNP
rs1454154399 1962 dbSNP
rs886055831 1973 dbSNP
rs1196012011 1978 dbSNP
rs1038951254 1985 dbSNP
rs1261586406 1986 dbSNP
rs371874284 1995 dbSNP
rs953523669 1996 dbSNP
rs887625035 2000 dbSNP
rs532646072 2006 dbSNP
rs1028960470 2007 dbSNP
rs565272286 2024 dbSNP
rs1325402951 2033 dbSNP
rs1372006229 2040 dbSNP
rs544112020 2059 dbSNP
rs918550711 2074 dbSNP
rs997467877 2082 dbSNP
rs1325687446 2083 dbSNP
rs1228022270 2088 dbSNP
rs1271921632 2093 dbSNP
rs965948374 2096 dbSNP
rs1030862566 2098 dbSNP
rs999752749 2103 dbSNP
rs1273384706 2116 dbSNP
rs575919536 2118 dbSNP
rs1233819508 2119 dbSNP
rs1203062377 2129 dbSNP
rs148679317 2133 dbSNP
rs1428363393 2150 dbSNP
rs1043881925 2156 dbSNP
rs542317043 2159 dbSNP
rs886055830 2160 dbSNP
rs1326976405 2166 dbSNP
rs1317473677 2171 dbSNP
rs530179622 2181 dbSNP
rs1056050818 2182 dbSNP
rs866132223 2185 dbSNP
rs938977097 2191 dbSNP
rs928875664 2192 dbSNP
rs988524647 2193 dbSNP
rs1293348514 2199 dbSNP
rs572145556 2199 dbSNP
rs1030532975 2212 dbSNP
rs1236427005 2220 dbSNP
rs1259842132 2221 dbSNP
rs940868955 2229 dbSNP
rs909359489 2230 dbSNP
rs997173478 2232 dbSNP
rs1475924827 2234 dbSNP
rs1373010837 2235 dbSNP
rs1484988307 2236 dbSNP
rs1192053263 2238 dbSNP
rs964761344 2245 dbSNP
rs1042679650 2250 dbSNP
rs1486725412 2250 dbSNP
rs1017446756 2252 dbSNP
rs1363448732 2254 dbSNP
rs1210485660 2255 dbSNP
rs11547136 2257 dbSNP
rs1275318532 2258 dbSNP
rs1197343104 2261 dbSNP
rs887573756 2268 dbSNP
rs1047563129 2288 dbSNP
rs1339763332 2296 dbSNP
rs1277555391 2297 dbSNP
rs1305766199 2304 dbSNP
rs953454902 2305 dbSNP
rs921966597 2310 dbSNP
rs993774272 2324 dbSNP
rs976061157 2325 dbSNP
rs371732611 2326 dbSNP
rs1288568443 2333 dbSNP
rs1346213759 2336 dbSNP
rs1210787570 2339 dbSNP
rs748454995 2342 dbSNP
rs781532503 2347 dbSNP
rs1356862067 2348 dbSNP
rs965980617 2350 dbSNP
rs770163204 2351 dbSNP
rs1030936024 2352 dbSNP
rs538861917 2353 dbSNP
rs1250027800 2354 dbSNP
rs577985841 2356 dbSNP
rs770607402 2357 dbSNP
rs999424230 2358 dbSNP
rs1433931952 2359 dbSNP
rs1357102806 2361 dbSNP
rs192120362 2362 dbSNP
rs1022092389 2366 dbSNP
rs1448488637 2376 dbSNP
rs1300881806 2378 dbSNP
rs1369216421 2384 dbSNP
rs755130193 2390 dbSNP
rs569194600 2393 dbSNP
rs1314493193 2397 dbSNP
rs894897662 2398 dbSNP
rs746714441 2399 dbSNP
rs1169244817 2400 dbSNP
rs369709176 2402 dbSNP
rs115916702 2403 dbSNP
rs1453500930 2404 dbSNP
rs1187337307 2405 dbSNP
rs1194058867 2406 dbSNP
rs1037040390 2414 dbSNP
rs1427117944 2420 dbSNP
rs947624181 2424 dbSNP
rs940914503 2425 dbSNP
rs909380184 2430 dbSNP
rs1234829658 2451 dbSNP
rs914860135 2453 dbSNP
rs1466782521 2455 dbSNP
rs988975112 2456 dbSNP
rs62187810 2458 dbSNP
rs1438250252 2461 dbSNP
rs923031950 2462 dbSNP
rs1257158305 2465 dbSNP
rs1196730470 2470 dbSNP
rs1336891548 2471 dbSNP
rs1273696428 2476 dbSNP
rs1370235481 2482 dbSNP
rs548607067 2490 dbSNP
rs536347076 2498 dbSNP
rs565866804 2499 dbSNP
rs1200607329 2501 dbSNP
rs1271461536 2502 dbSNP
rs1271896945 2503 dbSNP
rs563883502 2505 dbSNP
rs966050571 2514 dbSNP
rs1222648265 2522 dbSNP
rs1248207183 2523 dbSNP
rs1474340014 2529 dbSNP
rs1185844900 2530 dbSNP
rs547569925 2540 dbSNP
rs923896641 2541 dbSNP
rs886055829 2542 dbSNP
rs141926687 2543 dbSNP
rs1416596954 2544 dbSNP
rs967981990 2544 dbSNP
rs1325194677 2546 dbSNP
rs951958794 2547 dbSNP
rs1022588591 2557 dbSNP
rs565159017 2558 dbSNP
rs896341383 2567 dbSNP
rs79286402 2576 dbSNP
rs763857001 2577 dbSNP
rs1229095150 2578 dbSNP
rs1292355207 2581 dbSNP
rs905827455 2602 dbSNP
rs1214806076 2605 dbSNP
rs1263752602 2607 dbSNP
rs1044407068 2613 dbSNP
rs1185770911 2614 dbSNP
rs1343042027 2616 dbSNP
rs372765668 2619 dbSNP
rs1034747622 2625 dbSNP
rs532041350 2626 dbSNP
rs1164581998 2629 dbSNP
rs771705587 2632 dbSNP
rs1325445161 2660 dbSNP
rs1178038440 2661 dbSNP
rs1361628943 2668 dbSNP
rs893373195 2671 dbSNP
rs1311661076 2676 dbSNP
rs35208990 2679 dbSNP
rs1053808923 2682 dbSNP
rs1448863712 2686 dbSNP
rs560711716 2688 dbSNP
rs896829464 2689 dbSNP
rs934816254 2690 dbSNP
rs1015227048 2695 dbSNP
rs532742045 2696 dbSNP
rs1176580355 2697 dbSNP
rs923452654 2699 dbSNP
rs1256734761 2701 dbSNP
rs1253558172 2711 dbSNP
rs542654180 2720 dbSNP
rs761818813 2721 dbSNP
rs910337155 2727 dbSNP
rs71428458 2738 dbSNP
rs1352555639 2739 dbSNP
rs932151025 2740 dbSNP
rs951739420 2743 dbSNP
rs1172250677 2745 dbSNP
rs900648315 2752 dbSNP
rs1443569163 2757 dbSNP
rs1375375660 2758 dbSNP
rs1372168271 2763 dbSNP
rs1415067633 2764 dbSNP
rs1336226439 2766 dbSNP
rs1293528388 2772 dbSNP
rs1441752225 2773 dbSNP
rs1040482195 2790 dbSNP
rs944736578 2791 dbSNP
rs35366750 2792 dbSNP
rs557055784 2794 dbSNP
rs756743128 2796 dbSNP
rs865826814 2798 dbSNP
rs1231813897 2803 dbSNP
rs376744469 2821 dbSNP
rs368702339 2823 dbSNP
rs1035271818 2836 dbSNP
rs991117542 2836 dbSNP
rs1270235042 2839 dbSNP
rs771582093 2840 dbSNP
rs1239628526 2844 dbSNP
rs568042951 2850 dbSNP
rs71428457 2851 dbSNP
rs1377472615 2852 dbSNP
rs961105746 2863 dbSNP
rs893155330 2877 dbSNP
rs1174899952 2884 dbSNP
rs1015697344 2889 dbSNP
rs545138670 2890 dbSNP
rs999515548 2892 dbSNP
rs1190583803 2898 dbSNP
rs1438382460 2905 dbSNP
rs1005204990 2916 dbSNP
rs1487450411 2932 dbSNP
rs1243726041 2933 dbSNP
rs1331509596 2935 dbSNP
rs1235319473 2939 dbSNP
rs888080676 2939 dbSNP
rs1215926253 2945 dbSNP
rs770269600 2953 dbSNP
rs577880393 2954 dbSNP
rs1466874660 2957 dbSNP
rs943581694 2958 dbSNP
rs556335494 2959 dbSNP
rs1201576836 2961 dbSNP
rs900677749 2975 dbSNP
rs910286217 2981 dbSNP
rs1477514524 2982 dbSNP
rs1040554180 2984 dbSNP
rs1048828549 2991 dbSNP
rs187583583 2993 dbSNP
rs1293225183 2994 dbSNP
rs1391170281 3000 dbSNP
rs1388306947 3008 dbSNP
rs1316049052 3015 dbSNP
rs930285012 3019 dbSNP
rs1217788262 3020 dbSNP
rs1364742777 3021 dbSNP
rs1218657524 3022 dbSNP
rs1289898008 3024 dbSNP
rs1279507501 3026 dbSNP
rs573927495 3035 dbSNP
rs1042813676 3036 dbSNP
rs946753975 3037 dbSNP
rs116352370 3038 dbSNP
rs990700531 3039 dbSNP
rs1488973422 3045 dbSNP
rs1212040403 3058 dbSNP
rs937896441 3059 dbSNP
rs927835884 3070 dbSNP
rs371740773 3071 dbSNP
rs1378038469 3073 dbSNP
rs1265419945 3076 dbSNP
rs867840946 3080 dbSNP
rs927941135 3086 dbSNP
rs555633059 3093 dbSNP
rs1369271343 3099 dbSNP
rs536685475 3100 dbSNP
rs565753372 3111 dbSNP
rs1359715638 3112 dbSNP
rs1421575585 3115 dbSNP
rs879805847 3117 dbSNP
rs183341317 3123 dbSNP
rs957319449 3126 dbSNP
rs908299693 3128 dbSNP
rs1032097359 3129 dbSNP
rs538749982 3132 dbSNP
rs1212641017 3133 dbSNP
rs1485808155 3134 dbSNP
rs998902687 3135 dbSNP
rs571467469 3136 dbSNP
rs1353519681 3145 dbSNP
rs1028370161 3149 dbSNP
rs1217973162 3150 dbSNP
rs1288799855 3152 dbSNP
rs1484691492 3155 dbSNP
rs1181381684 3156 dbSNP
rs902091534 3158 dbSNP
rs1257060039 3170 dbSNP
rs550390223 3179 dbSNP
rs1425756555 3182 dbSNP
rs996463343 3184 dbSNP
rs531907622 3203 dbSNP
rs1160320312 3210 dbSNP
rs1007669856 3225 dbSNP
rs1309577620 3228 dbSNP
rs1296997377 3230 dbSNP
rs1465066229 3231 dbSNP
rs889298863 3235 dbSNP
rs1380766561 3241 dbSNP
rs1218554404 3244 dbSNP
rs1048776703 3246 dbSNP
rs1338564562 3268 dbSNP
rs930401109 3271 dbSNP
rs747222344 3272 dbSNP
rs1401802535 3276 dbSNP
rs1036434251 3280 dbSNP
rs1301246063 3287 dbSNP
rs939053106 3290 dbSNP
rs1019145615 3294 dbSNP
rs561653280 3295 dbSNP
rs1171347748 3296 dbSNP
rs780369009 3300 dbSNP
rs902653269 3301 dbSNP
rs138892630 3303 dbSNP
rs1189488322 3305 dbSNP
rs1011371859 3306 dbSNP
rs886055828 3309 dbSNP
rs1031795815 3313 dbSNP
rs3796117 3314 dbSNP
rs1481860944 3318 dbSNP
rs1365979540 3320 dbSNP
rs560209675 3321 dbSNP
rs927870313 3322 dbSNP
rs999245438 3333 dbSNP
rs758559894 3337 dbSNP
rs1257614400 3338 dbSNP
rs1046269500 3341 dbSNP
rs1019588131 3343 dbSNP
rs939887063 3344 dbSNP
rs545073996 3345 dbSNP
rs1027769248 3347 dbSNP
rs1191639499 3347 dbSNP
rs14111 3354 dbSNP
rs533104075 3355 dbSNP
rs1169367634 3370 dbSNP
rs983893149 3373 dbSNP
rs1339889033 3380 dbSNP
rs755514644 3381 dbSNP
rs1393331181 3385 dbSNP
rs938985901 3390 dbSNP
rs1294590710 3397 dbSNP
rs879914938 3402 dbSNP
rs1370391027 3404 dbSNP
rs1217393082 3408 dbSNP
rs146087816 3410 dbSNP
rs544425393 3411 dbSNP
rs1220683454 3412 dbSNP
rs750528319 3413 dbSNP
rs757597330 3419 dbSNP
rs1222064957 3422 dbSNP
rs1248337648 3423 dbSNP
rs1019222756 3428 dbSNP
rs1192904938 3431 dbSNP
rs1009131996 3448 dbSNP
rs1478525674 3451 dbSNP
rs1458024108 3452 dbSNP
rs1367380765 3457 dbSNP
rs915196163 3464 dbSNP
rs966908442 3473 dbSNP
rs751907688 3474 dbSNP
rs1420476491 3475 dbSNP
rs1021507347 3479 dbSNP
rs989311607 3480 dbSNP
rs1341145896 3482 dbSNP
rs1456668203 3483 dbSNP
rs1011026164 3487 dbSNP
rs779053001 3488 dbSNP
rs1055073548 3490 dbSNP
rs1002172714 3491 dbSNP
rs4613 3494 dbSNP
rs1286661158 3495 dbSNP
rs1355814724 3497 dbSNP
rs566825730 3499 dbSNP
rs540160115 3500 dbSNP
rs1183308244 3502 dbSNP
rs1416398567 3502 dbSNP
rs1418270774 3505 dbSNP
rs908403595 3506 dbSNP
rs572061895 3508 dbSNP
rs763459222 3512 dbSNP
rs1317778653 3513 dbSNP
rs553759523 3514 dbSNP
rs1286231564 3530 dbSNP
rs1374300223 3538 dbSNP
rs1239199011 3540 dbSNP
rs538737424 3543 dbSNP
rs763817154 3544 dbSNP
rs750785594 3552 dbSNP
rs975131449 3555 dbSNP
rs1374370930 3560 dbSNP
rs1442555488 3573 dbSNP
rs943704213 3585 dbSNP
rs1387244354 3593 dbSNP
rs912193189 3593 dbSNP
rs143001518 3596 dbSNP
rs1381367404 3598 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.828 2.5e-9 -0.001 5.0e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.557 2.9e-3 0.492 8.5e-3 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.399 2.7e-2 -0.357 4.3e-2 24 Click to see details
GSE14794 Lymphoblastoid cells -0.145 8.6e-2 -0.103 1.7e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.305 9.6e-2 -0.301 9.9e-2 20 Click to see details
GSE27834 Pluripotent stem cells 0.32 1.1e-1 0.382 7.2e-2 16 Click to see details
GSE19536 Breast cancer -0.102 1.6e-1 -0.130 9.9e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.112 1.6e-1 -0.102 1.9e-1 79 Click to see details
GSE38226 Liver fibrosis -0.223 1.7e-1 -0.184 2.1e-1 21 Click to see details
GSE21032 Prostate cancer 0.101 1.8e-1 0.106 1.7e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.163 2.2e-1 -0.027 4.5e-1 25 Click to see details
GSE21849 B cell lymphoma 0.109 2.9e-1 0.090 3.2e-1 29 Click to see details
GSE21687 Ependynoma primary tumors 0.068 3.0e-1 -0.060 3.2e-1 64 Click to see details
GSE28260 Renal cortex and medulla 0.162 3.0e-1 0.115 3.5e-1 13 Click to see details
GSE17306 Multiple myeloma 0.067 3.2e-1 0.130 1.9e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.062 3.8e-1 -0.175 2.0e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.069 3.9e-1 -0.105 3.3e-1 20 Click to see details
GSE19350 CNS germ cell tumors -0.069 4.2e-1 -0.077 4.1e-1 12 Click to see details
GSE28544 Breast cancer -0.029 4.5e-1 0.137 2.6e-1 24 Click to see details
GSE17498 Multiple myeloma 0.015 4.6e-1 0.010 4.8e-1 40 Click to see details
GSE17498 Multiple myeloma 0.015 4.6e-1 0.010 4.8e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.564 0 -0.570 0 32 Click to see details
KIRC 0.248 0.02 0.248 0.02 68 Click to see details
CESC -0.997 0.02 -1.000 0.5 3 Click to see details
HNSC -0.253 0.05 -0.294 0.03 42 Click to see details
PAAD -0.861 0.07 -0.800 0.1 4 Click to see details
KICH 0.228 0.14 0.229 0.14 25 Click to see details
ESCA -0.347 0.15 -0.245 0.23 11 Click to see details
CHOL -0.344 0.18 -0.233 0.27 9 Click to see details
UCEC -0.194 0.21 -0.216 0.19 19 Click to see details
KIRP 0.106 0.28 0.147 0.21 32 Click to see details
LUAD -0.177 0.29 -0.280 0.19 12 Click to see details
PRAD 0.068 0.32 0.055 0.35 50 Click to see details
BLCA 0.118 0.32 0.230 0.18 18 Click to see details
BRCA 0.048 0.33 0.011 0.46 84 Click to see details
LUSC 0.059 0.36 0.033 0.42 38 Click to see details
THCA -0.035 0.4 -0.147 0.13 59 Click to see details
PCPG 0.133 0.46 0.500 0.33 3 Click to see details
LIHC 0.014 0.46 -0.053 0.36 49 Click to see details
COAD -0.014 0.49 0.143 0.37 8 Click to see details
COAD -0.014 0.49 0.143 0.37 8 Click to see details
COAD -0.014 0.49 0.143 0.37 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2