miRTarBase - #MIRT051321 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCNYL1   
Synonyms -
Description cyclin Y like 1
Transcript NM_001142300   
Other Transcripts NM_152523   
Expression
Putative miRNA Targets on CCNYL1
3'UTR of CCNYL1
(miRNA target sites are highlighted)
>CCNYL1|NM_001142300|3'UTR
   1 AAGGAGAAATGAGGGGTTATAACGTCATGGGACCTTCATCTACAAAGACTGGAGAAATACCACCTTTCCTGCTCAAAAAC
  81 CAGCAAAATTAGTGTTTTCATCAAAAGGAAAGATCTCAAATTCAAGAGACTCATGGACAACAAGGATTATACTCCACAGG
 161 AAAGAATGGGACCTTGTCAATGCAACAAAACACTCTTCTGTCCTTTTTAATGTAAACAGAGTTACAAAAACCACTCCAAA
 241 GTGAAGGCTCCCATCCTACACACAGATATTTGCTTACTGTGTGGGCCGATAGCTGTGAACTATGTAAGGTTTTTTAAACA
 321 ATAGTTTAAATTTTTAGACTTTAAAGACACTAACCATATAACTTTTATGTTTCTTCCAGTTTCTCTCCCTCCCCCCGCAT
 401 TTTGCTGCATATGCCTTTAAAATCAATGCAGTATTACCATTAAAACATGGGACTCTAACTAAAGCCACTTAGGAGCAGAC
 481 AGCAGCGTTGTTAGGTACTGAAGGGTTCTTCCTCCCTACTGTTACCATTGAAGCTGCTAGTCATTGGCAATCATTTTAAA
 561 CCAAAAAGCTGCTGGATAACATTTGTCATTCATATTCTTTGCAAGCATTACTTTAGCATTTTAGCATGTTTGGGGTCATA
 641 AACAGAGGAAGTATCAGTTATTGATATCTACTTCTATTGGAGTCCATGTTGCATTTCTTGTGAACTATAAATGGTGCTTC
 721 TCATTTTCTGATAATTTTTCTCTTGCTAAATAAATGTATTAAAAGATATTTTCATAATGCCAACCAACATGGTGGTTCAG
 801 TGACGATGAGAAAAAGTGAAGCAGTTTTAAGCTTGAATATAGTTTGGGCCCTCCAAGGCACTGCAGCATGAGTATAAATG
 881 CTATAAACCTTTAAAAAACATGATTTGAAAGTTTTTTGTTTTGTTTTGTTTGTTTTTAAAGAGATGGGGGTCTTACTGCG
 961 TTGTCCAGGCTGGAGTGCAGTGGCTTTTCACAGGTGCAATCATTGTGCACTCACTGCAGCCTAGAACTTCCTGGTCTCAA
1041 GCCATCCTCTAGCCTCAGCCACACAAGTAGCTGGGACTACAAGTGCAACTGGCACCTGTCTCCTGAATATTAAGCTTTTA
1121 ATTTTTTGTTTCGGTCACTCTTGATAGCAGACATTGACTGAAACAAAAAATTAAAAGCTTTATATTCAAAATTTGCAAAA
1201 TGAAGCTGGGTGTGGTGGTGCACGCCTATAGTCCCAGCTACTTGGGAGGCTGAGGCTGGAGGATTGCTTGAGGTCAAGTA
1281 TTGGAGGCTGCAGTGTACCATGATGGTGCCTATAGGAATAGCTACTACACTCCAACCTGGACAACGTTATCAAGACCCCA
1361 TCTCTTAGAAAAATGCAAAATTAAATGCAAAAGAAATGGGCTGGGCATAGTGATTCATGCCTGTAATCTCAGTACCCTGG
1441 GAGGCTGAGGTGGAAGGATTGCTTGAGTGCAGGAGTTCAAGACCAGTCTAGGCAACATAGTGAGACCCTGCCTGTAAAAA
1521 AAAATAATAAAAATAGTTGGATATGGTGGCATGTGTCTGTAGTCCCAGCCACTCTGGAGGCTAAGGTGGGAGGATCAGTA
1601 GAGCCCAGGAGGTCAAGGCTGCAGTGGGCCATGATCATGTCACTGCTCTCCAACCTGGGCGACATCCAGACCCTGTCTCA
1681 AAGAAAAAAGCAGAAGAAAAATGTTCAGACAAGGTTTTGTAAAGGTTTGTAGCATTTATATTTCTACAAGTATCAAAGCT
1761 TAAAATTACACTGAACTTTTGGAATACCTTGTATCTCCATAAAATGCCCTCTTTTTAAAAGTAGTTACCCGCAGAGCTGT
1841 GCTCTATATGCTTTGATTACCGCAGTTTCTTTAAAGGAAGATTTTGAAGAGCAGTGTTAATTAACATGTAATAAAAGGAA
1921 TTGGACCCTAATTATAGAAGGTGATATGAACAGCTGTTTTATCATCCTACATGCTACCAAGCTGTAGGTGTCCCATTAAG
2001 TCCTGCTATTTAAGAAATACTTACATAACCCTTAGGAACTCTTCAGGCTTTAAAAGGCAAGGAGCAAATAATTTTAGGAG
2081 ACCGATAATGTCACCTAAATTTGAAATACTAAGAAGAGGTTAGTGTTCTCAACTATGTGAAATCTGTTTCTCCTACTTTC
2161 TCAAATCTAATCCTAGGAATCTTGCTTATAAACAAAGCATTTCTGGGACAGGAGTACTTCCTCTATTATAGCAATGCTTC
2241 ACATCATATTGTGCTGCAGTTTCCATCATTTTTAAAGGACAGAGACATAAATGATAAATAATGGTATACAAATATTACAA
2321 TCTACCACCTCAAAAAAACAAATATTGTTTATGGAATTCAGAGTTTGGAGATTCAAGTATTGATTGCAGTTTTATTTTGA
2401 AAAGAATGCTACAATTTATGTGGTTTTTATTTCTCATGTTTATATTAAAAGCTAATAAACTCTATTTTAATTAAAAAAAA
2481 AAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            || |:|||  ||||||||  
Target 5' ttCACATCATATTGTGCTGCag 3'
2238 - 2259 152.00 -17.00
2
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||||| || ||||| 
Target 5' ggtgtcCCATTAAGTCCTGCTa 3'
1987 - 2008 140.00 -14.80
3
miRNA  3' guGUUUGGUA-AUA-CACGACGAu 5'
            ::|||:||  || ||||| || 
Target 5' tgTGAACTATAAATGGTGCTTCTc 3'
699 - 722 132.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN32052978 5 COSMIC
COSN24823454 74 COSMIC
COSN31579906 89 COSMIC
COSN31570553 99 COSMIC
COSN1820773 112 COSMIC
COSN31554691 172 COSMIC
COSN31579898 303 COSMIC
COSN31606994 364 COSMIC
COSN30177109 456 COSMIC
COSN20097762 525 COSMIC
COSN29441444 526 COSMIC
COSN31524587 541 COSMIC
COSN6165863 662 COSMIC
COSN28597152 1041 COSMIC
COSN28595932 1051 COSMIC
COSN28565450 1058 COSMIC
COSN24972813 1064 COSMIC
COSN28593297 1070 COSMIC
COSN28602480 1110 COSMIC
COSN29340958 1564 COSMIC
COSN29807433 2099 COSMIC
COSN19039538 2145 COSMIC
COSN15687303 2222 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1284397084 3 dbSNP
rs745769862 11 dbSNP
rs1217686501 12 dbSNP
rs1170392200 14 dbSNP
rs1270490247 23 dbSNP
rs768330386 24 dbSNP
rs373189981 25 dbSNP
rs761631615 26 dbSNP
rs376566029 27 dbSNP
rs772104404 28 dbSNP
rs1429786255 32 dbSNP
rs772664449 35 dbSNP
rs760195716 39 dbSNP
rs374519249 41 dbSNP
rs753488385 43 dbSNP
rs1216632148 47 dbSNP
rs781125922 50 dbSNP
rs952391863 57 dbSNP
rs551537346 58 dbSNP
rs779932982 61 dbSNP
rs1005136274 69 dbSNP
rs1200059319 70 dbSNP
rs1349135726 73 dbSNP
rs1406893617 82 dbSNP
rs1226571952 85 dbSNP
rs1015474599 93 dbSNP
rs1271242010 108 dbSNP
rs966252175 116 dbSNP
rs1346428063 128 dbSNP
rs1332732065 131 dbSNP
rs1340257170 132 dbSNP
rs1375619208 133 dbSNP
rs1240277336 134 dbSNP
rs796502812 142 dbSNP
rs1447395740 143 dbSNP
rs375237596 150 dbSNP
rs1187016579 154 dbSNP
rs1476455561 168 dbSNP
rs1235802553 169 dbSNP
rs921664330 171 dbSNP
rs953137277 177 dbSNP
rs1266962911 181 dbSNP
rs532972977 183 dbSNP
rs563286395 186 dbSNP
rs1461345555 188 dbSNP
rs1203489648 193 dbSNP
rs1341834284 196 dbSNP
rs1386745283 197 dbSNP
rs979085740 208 dbSNP
rs1216796963 212 dbSNP
rs549992520 213 dbSNP
rs1363536224 218 dbSNP
rs1253920903 231 dbSNP
rs145755506 244 dbSNP
rs1355734326 248 dbSNP
rs148992674 250 dbSNP
rs749556312 253 dbSNP
rs530488098 256 dbSNP
rs1171135257 258 dbSNP
rs1411578229 259 dbSNP
rs1471761805 264 dbSNP
rs548878493 280 dbSNP
rs1411462143 288 dbSNP
rs191888255 289 dbSNP
rs1475552661 293 dbSNP
rs1259898629 301 dbSNP
rs774624406 303 dbSNP
rs1480531667 313 dbSNP
rs1430113440 316 dbSNP
rs988087288 317 dbSNP
rs1320451869 331 dbSNP
rs917718064 332 dbSNP
rs1232178096 333 dbSNP
rs1467593922 343 dbSNP
rs949203181 349 dbSNP
rs1402198139 351 dbSNP
rs114285153 357 dbSNP
rs1444022943 359 dbSNP
rs753925297 359 dbSNP
rs1348082139 366 dbSNP
rs905946800 366 dbSNP
rs1164068325 371 dbSNP
rs772698723 374 dbSNP
rs1420071899 382 dbSNP
rs937464252 385 dbSNP
rs1418703999 386 dbSNP
rs1287245328 388 dbSNP
rs1049010574 392 dbSNP
rs1234855924 397 dbSNP
rs1252981567 398 dbSNP
rs1253736679 407 dbSNP
rs1468586906 412 dbSNP
rs557531406 414 dbSNP
rs147075629 415 dbSNP
rs1225979692 419 dbSNP
rs1005518355 427 dbSNP
rs1015196241 433 dbSNP
rs1225277214 441 dbSNP
rs1365194347 449 dbSNP
rs1325182626 451 dbSNP
rs1441533331 452 dbSNP
rs1396850637 455 dbSNP
rs1318631368 456 dbSNP
rs902119371 460 dbSNP
rs1364624566 463 dbSNP
rs997674171 467 dbSNP
rs1253737080 474 dbSNP
rs542749325 478 dbSNP
rs1394855482 480 dbSNP
rs1181738076 484 dbSNP
rs1455979181 486 dbSNP
rs1246655255 487 dbSNP
rs1269803825 488 dbSNP
rs1435118506 489 dbSNP
rs1174090742 494 dbSNP
rs557616076 494 dbSNP
rs1202887919 501 dbSNP
rs953106548 504 dbSNP
rs979179299 505 dbSNP
rs1217452585 513 dbSNP
rs79149159 523 dbSNP
rs199865790 524 dbSNP
rs3215182 524 dbSNP
rs397805403 524 dbSNP
rs80287879 525 dbSNP
rs76853528 526 dbSNP
rs1302392497 527 dbSNP
rs1234673981 528 dbSNP
rs1462961966 529 dbSNP
rs956416598 530 dbSNP
rs988234940 533 dbSNP
rs917828229 536 dbSNP
rs1385725501 543 dbSNP
rs1290926422 551 dbSNP
rs11550459 553 dbSNP
rs1464723487 558 dbSNP
rs62189214 561 dbSNP
rs1174661884 562 dbSNP
rs1455825202 563 dbSNP
rs1170986486 564 dbSNP
rs528166690 565 dbSNP
rs949337767 580 dbSNP
rs766656994 581 dbSNP
rs1369098485 588 dbSNP
rs1279119153 590 dbSNP
rs1429449453 614 dbSNP
rs574372866 615 dbSNP
rs1304116857 617 dbSNP
rs1367951119 628 dbSNP
rs1388119209 636 dbSNP
rs1298623897 640 dbSNP
rs1327161158 644 dbSNP
rs980567419 644 dbSNP
rs74909259 646 dbSNP
rs1229098515 652 dbSNP
rs1276609905 665 dbSNP
rs182587278 668 dbSNP
rs150825491 671 dbSNP
rs1313660489 673 dbSNP
rs865776157 675 dbSNP
rs1049159974 677 dbSNP
rs75294302 682 dbSNP
rs887753317 683 dbSNP
rs1489614735 684 dbSNP
rs940685449 687 dbSNP
rs1266795977 701 dbSNP
rs1171907096 706 dbSNP
rs1036802146 707 dbSNP
rs1256431147 711 dbSNP
rs902089144 717 dbSNP
rs776939451 718 dbSNP
rs1429127086 719 dbSNP
rs532694623 721 dbSNP
rs1339999392 730 dbSNP
rs762613623 734 dbSNP
rs767108245 743 dbSNP
rs1231551957 745 dbSNP
rs553705299 746 dbSNP
rs1029127876 748 dbSNP
rs889296561 764 dbSNP
rs1164656161 770 dbSNP
rs186055266 773 dbSNP
rs1328615615 781 dbSNP
rs1000592763 784 dbSNP
rs1161957448 787 dbSNP
rs763713356 794 dbSNP
rs1459144300 796 dbSNP
rs548019381 797 dbSNP
rs545173526 805 dbSNP
rs559669380 806 dbSNP
rs1025098451 808 dbSNP
rs565230829 812 dbSNP
rs980662182 814 dbSNP
rs1227540933 815 dbSNP
rs531060205 817 dbSNP
rs773724519 818 dbSNP
rs1468144472 821 dbSNP
rs543195400 825 dbSNP
rs563107571 829 dbSNP
rs1235146696 836 dbSNP
rs1323241856 839 dbSNP
rs529073832 847 dbSNP
rs1240274135 852 dbSNP
rs533716212 852 dbSNP
rs1219651207 853 dbSNP
rs1324554115 862 dbSNP
rs756041990 883 dbSNP
rs1265023292 884 dbSNP
rs1395783991 887 dbSNP
rs984386845 889 dbSNP
rs1406562855 896 dbSNP
rs1340284629 910 dbSNP
rs758666504 914 dbSNP
rs909287707 914 dbSNP
rs1470411908 916 dbSNP
rs1365320643 923 dbSNP
rs761041046 925 dbSNP
rs923270195 925 dbSNP
rs1253471694 933 dbSNP
rs1215665264 935 dbSNP
rs780021195 944 dbSNP
rs200685932 946 dbSNP
rs1050679855 948 dbSNP
rs1353367996 949 dbSNP
rs569738379 960 dbSNP
rs565976331 961 dbSNP
rs1372403618 962 dbSNP
rs1184701640 963 dbSNP
rs1054397094 964 dbSNP
rs1306211223 966 dbSNP
rs1438047091 967 dbSNP
rs775975365 971 dbSNP
rs73060879 975 dbSNP
rs1317281441 978 dbSNP
rs1422366814 979 dbSNP
rs1009731445 980 dbSNP
rs1361998044 982 dbSNP
rs1162275822 992 dbSNP
rs1367594694 996 dbSNP
rs1395634297 998 dbSNP
rs373543462 1000 dbSNP
rs1474507691 1003 dbSNP
rs1241586310 1005 dbSNP
rs1348864626 1011 dbSNP
rs1448962091 1013 dbSNP
rs970378742 1017 dbSNP
rs1210646822 1019 dbSNP
rs1349022275 1020 dbSNP
rs1283134558 1025 dbSNP
rs1322024202 1032 dbSNP
rs1385738696 1041 dbSNP
rs1269091606 1042 dbSNP
rs1430733355 1046 dbSNP
rs1342021071 1048 dbSNP
rs1310641781 1057 dbSNP
rs1452751693 1063 dbSNP
rs1413986919 1070 dbSNP
rs1375836625 1078 dbSNP
rs1178222775 1079 dbSNP
rs754702959 1089 dbSNP
rs1386650322 1093 dbSNP
rs1168601894 1104 dbSNP
rs952661366 1106 dbSNP
rs1187453694 1110 dbSNP
rs983965217 1121 dbSNP
rs1437551433 1122 dbSNP
rs190673341 1132 dbSNP
rs749072659 1133 dbSNP
rs138558471 1134 dbSNP
rs1315398659 1136 dbSNP
rs1322885146 1139 dbSNP
rs1291131532 1141 dbSNP
rs759283000 1141 dbSNP
rs1266641524 1146 dbSNP
rs1355638786 1147 dbSNP
rs1465923994 1153 dbSNP
rs774403671 1165 dbSNP
rs1439703424 1168 dbSNP
rs1242213792 1175 dbSNP
rs1481978201 1178 dbSNP
rs779269630 1184 dbSNP
rs1329431809 1185 dbSNP
rs1467285911 1190 dbSNP
rs1415761877 1202 dbSNP
rs933288569 1209 dbSNP
rs748315122 1214 dbSNP
rs144067776 1219 dbSNP
rs1480481234 1221 dbSNP
rs1234015710 1224 dbSNP
rs557109991 1225 dbSNP
rs1457623310 1227 dbSNP
rs1127039 1229 dbSNP
rs1302097895 1237 dbSNP
rs1053916690 1239 dbSNP
rs1127041 1254 dbSNP
rs1232085743 1261 dbSNP
rs1335110641 1265 dbSNP
rs892633871 1271 dbSNP
rs1221911640 1272 dbSNP
rs1372307887 1273 dbSNP
rs1350831148 1275 dbSNP
rs1448884554 1278 dbSNP
rs1411935970 1290 dbSNP
rs146898844 1291 dbSNP
rs1328603307 1296 dbSNP
rs1046148830 1299 dbSNP
rs547396214 1300 dbSNP
rs1461990200 1311 dbSNP
rs1351854993 1315 dbSNP
rs1127042 1321 dbSNP
rs777027202 1323 dbSNP
rs1001814363 1325 dbSNP
rs1409160505 1327 dbSNP
rs1180841782 1328 dbSNP
rs1033342540 1332 dbSNP
rs888370238 1333 dbSNP
rs1209965362 1337 dbSNP
rs1005884833 1341 dbSNP
rs148203580 1346 dbSNP
rs1183911464 1347 dbSNP
rs1015394066 1351 dbSNP
rs553692820 1359 dbSNP
rs1249237289 1361 dbSNP
rs1284706967 1369 dbSNP
rs573528231 1383 dbSNP
rs1241963910 1386 dbSNP
rs1302521002 1390 dbSNP
rs1368739722 1390 dbSNP
rs545051567 1391 dbSNP
rs1441794629 1394 dbSNP
rs1369776862 1400 dbSNP
rs1287399431 1401 dbSNP
rs961518438 1402 dbSNP
rs1345945684 1404 dbSNP
rs1426636735 1407 dbSNP
rs972151504 1411 dbSNP
rs1433193308 1413 dbSNP
rs1395064242 1417 dbSNP
rs1412710375 1424 dbSNP
rs1175224080 1426 dbSNP
rs1184197201 1431 dbSNP
rs1250495486 1433 dbSNP
rs868863274 1434 dbSNP
rs1279568919 1438 dbSNP
rs558941492 1438 dbSNP
rs1305942223 1440 dbSNP
rs1030406380 1458 dbSNP
rs1313827609 1460 dbSNP
rs1293534703 1462 dbSNP
rs1381681290 1480 dbSNP
rs182574357 1484 dbSNP
rs1300253330 1485 dbSNP
rs1413366862 1486 dbSNP
rs544268840 1488 dbSNP
rs759862426 1491 dbSNP
rs1437423028 1493 dbSNP
rs986125310 1496 dbSNP
rs763795361 1497 dbSNP
rs910555932 1498 dbSNP
rs1427359211 1499 dbSNP
rs1263511505 1502 dbSNP
rs1195352952 1508 dbSNP
rs1365522732 1514 dbSNP
rs201188485 1516 dbSNP
rs1275899775 1520 dbSNP
rs1200753612 1525 dbSNP
rs1484213584 1525 dbSNP
rs561052361 1526 dbSNP
rs1203533163 1529 dbSNP
rs1318666571 1531 dbSNP
rs13424708 1538 dbSNP
rs373118325 1542 dbSNP
rs1280410521 1546 dbSNP
rs990152453 1551 dbSNP
rs1354991586 1562 dbSNP
rs1034036978 1564 dbSNP
rs1313872955 1565 dbSNP
rs1398109718 1566 dbSNP
rs914049100 1567 dbSNP
rs945519386 1575 dbSNP
rs1461079876 1582 dbSNP
rs1423713887 1593 dbSNP
rs1221784602 1594 dbSNP
rs1247982922 1610 dbSNP
rs774008022 1612 dbSNP
rs1476718224 1617 dbSNP
rs1474024811 1628 dbSNP
rs1192949098 1632 dbSNP
rs1416664043 1635 dbSNP
rs1188026640 1636 dbSNP
rs1390775005 1637 dbSNP
rs1451252871 1640 dbSNP
rs376522157 1648 dbSNP
rs1046577824 1649 dbSNP
rs529014982 1650 dbSNP
rs937801574 1653 dbSNP
rs1334475863 1656 dbSNP
rs1054681184 1659 dbSNP
rs74821577 1661 dbSNP
rs1005441048 1662 dbSNP
rs1306994398 1666 dbSNP
rs1448150432 1671 dbSNP
rs1403010554 1680 dbSNP
rs1332830199 1681 dbSNP
rs1459371231 1686 dbSNP
rs1393338264 1690 dbSNP
rs1348216612 1701 dbSNP
rs559386235 1718 dbSNP
rs1473696185 1720 dbSNP
rs1043068 1722 dbSNP
rs1015946672 1726 dbSNP
rs897098052 1739 dbSNP
rs185764562 1742 dbSNP
rs1298415179 1745 dbSNP
rs1205489424 1748 dbSNP
rs998009220 1748 dbSNP
rs1029538694 1751 dbSNP
rs1211855036 1759 dbSNP
rs771753993 1769 dbSNP
rs1349054974 1775 dbSNP
rs202013133 1777 dbSNP
rs756723286 1777 dbSNP
rs1241279081 1783 dbSNP
rs879345422 1785 dbSNP
rs986221841 1795 dbSNP
rs1226807722 1808 dbSNP
rs1297352747 1809 dbSNP
rs1438131884 1813 dbSNP
rs1330002041 1815 dbSNP
rs1357447720 1820 dbSNP
rs190385405 1831 dbSNP
rs551073829 1832 dbSNP
rs1406756002 1837 dbSNP
rs1449502935 1843 dbSNP
rs571189225 1844 dbSNP
rs989518786 1845 dbSNP
rs914127791 1847 dbSNP
rs1382145983 1848 dbSNP
rs761463529 1849 dbSNP
rs766970805 1850 dbSNP
rs945683321 1856 dbSNP
rs1201016144 1862 dbSNP
rs182475686 1863 dbSNP
rs1186547814 1864 dbSNP
rs1372289476 1871 dbSNP
rs188045893 1895 dbSNP
rs1356259037 1897 dbSNP
rs1278901413 1899 dbSNP
rs1164764123 1903 dbSNP
rs1346260471 1911 dbSNP
rs150757773 1915 dbSNP
rs1461089051 1916 dbSNP
rs1437936000 1920 dbSNP
rs1321359262 1927 dbSNP
rs1324341692 1938 dbSNP
rs1297173263 1940 dbSNP
rs567791581 1947 dbSNP
rs762845065 1952 dbSNP
rs1390864549 1962 dbSNP
rs1433566247 1966 dbSNP
rs1413851400 1967 dbSNP
rs1320392164 1969 dbSNP
rs567408200 1972 dbSNP
rs536835313 1973 dbSNP
rs193078882 1985 dbSNP
rs567035177 1989 dbSNP
rs763921244 1998 dbSNP
rs1247519430 2017 dbSNP
rs1194650741 2018 dbSNP
rs760748174 2018 dbSNP
rs796472896 2019 dbSNP
rs1210535126 2021 dbSNP
rs1423003858 2025 dbSNP
rs1443532791 2026 dbSNP
rs1281281099 2032 dbSNP
rs1220498606 2033 dbSNP
rs1336841753 2079 dbSNP
rs1277247737 2082 dbSNP
rs1054816530 2084 dbSNP
rs751535645 2085 dbSNP
rs534783362 2091 dbSNP
rs553167427 2095 dbSNP
rs941007422 2096 dbSNP
rs1359723594 2109 dbSNP
rs1336059051 2112 dbSNP
rs1408348790 2119 dbSNP
rs1422997739 2119 dbSNP
rs539281901 2125 dbSNP
rs1478929323 2128 dbSNP
rs1036732482 2130 dbSNP
rs1181659527 2136 dbSNP
rs1473316427 2137 dbSNP
rs1239759849 2140 dbSNP
rs897059305 2148 dbSNP
rs184074680 2152 dbSNP
rs575546203 2157 dbSNP
rs1256883904 2159 dbSNP
rs537860682 2165 dbSNP
rs1050879998 2167 dbSNP
rs889637133 2168 dbSNP
rs1442928670 2173 dbSNP
rs1189407043 2174 dbSNP
rs187192287 2180 dbSNP
rs1439955218 2188 dbSNP
rs1399374328 2189 dbSNP
rs139068327 2195 dbSNP
rs757099217 2199 dbSNP
rs1467208513 2204 dbSNP
rs958175974 2214 dbSNP
rs1011317960 2216 dbSNP
rs1416390077 2217 dbSNP
rs1020994459 2220 dbSNP
rs114161911 2226 dbSNP
rs982340615 2228 dbSNP
rs766391204 2230 dbSNP
rs73060880 2235 dbSNP
rs1270959211 2242 dbSNP
rs1220359276 2265 dbSNP
rs1321891016 2269 dbSNP
rs1403627602 2274 dbSNP
rs1398275591 2275 dbSNP
rs1221822969 2281 dbSNP
rs1376097585 2285 dbSNP
rs1309858001 2286 dbSNP
rs1332668222 2286 dbSNP
rs959551738 2295 dbSNP
rs1437473284 2306 dbSNP
rs990972472 2308 dbSNP
rs1157413094 2310 dbSNP
rs142572332 2316 dbSNP
rs1381520490 2321 dbSNP
rs941156934 2325 dbSNP
rs1264670564 2332 dbSNP
rs1288520677 2336 dbSNP
rs1488623599 2343 dbSNP
rs1248048883 2345 dbSNP
rs1214245762 2346 dbSNP
rs1351931760 2348 dbSNP
rs1037063433 2350 dbSNP
rs1242205746 2364 dbSNP
rs545262308 2368 dbSNP
rs1300682522 2369 dbSNP
rs1226108541 2373 dbSNP
rs1259594808 2374 dbSNP
rs918264032 2378 dbSNP
rs577728924 2390 dbSNP
rs1399856054 2402 dbSNP
rs565037741 2402 dbSNP
rs1361558839 2403 dbSNP
rs10177235 2405 dbSNP
rs1051026147 2406 dbSNP
rs1377525733 2407 dbSNP
rs1276281759 2408 dbSNP
rs754804739 2419 dbSNP
rs1485184465 2426 dbSNP
rs367922906 2426 dbSNP
rs1433243558 2429 dbSNP
rs1426875940 2431 dbSNP
rs1191053007 2432 dbSNP
rs1487870763 2432 dbSNP
rs1218433396 2434 dbSNP
rs1263643541 2434 dbSNP
rs1482253655 2445 dbSNP
rs889730396 2453 dbSNP
rs1006713927 2454 dbSNP
rs1314020045 2455 dbSNP
rs1254303854 2460 dbSNP
rs1218266499 2463 dbSNP
rs1471714850 2463 dbSNP
rs1280528342 2465 dbSNP
rs1413275879 2469 dbSNP
rs1054330605 2471 dbSNP
rs778788981 2473 dbSNP
rs1378261003 2474 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.327 4.5e-4 -0.337 3.0e-4 100 Click to see details
GSE28260 Renal cortex and medulla -0.64 9.2e-3 -0.687 4.7e-3 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.489 1.4e-2 -0.505 1.2e-2 20 Click to see details
GSE19783 ER- ER- breast cancer -0.246 1.4e-2 -0.250 1.3e-2 79 Click to see details
GSE21032 Prostate cancer 0.236 1.6e-2 0.191 4.2e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.233 1.3e-1 0.346 4.5e-2 25 Click to see details
GSE21687 Ependynoma primary tumors -0.14 1.3e-1 -0.116 1.8e-1 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.24 1.4e-1 -0.240 1.4e-1 23 Click to see details
GSE38226 Liver fibrosis -0.214 1.8e-1 -0.235 1.5e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.26 2.1e-1 -0.308 1.7e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.183 2.2e-1 0.325 8.1e-2 20 Click to see details
GSE17306 Multiple myeloma -0.103 2.4e-1 -0.113 2.2e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.074 2.4e-1 -0.092 1.9e-1 90 Click to see details
GSE28544 Breast cancer 0.146 2.5e-1 0.041 4.2e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.111 3.0e-1 0.168 2.2e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.087 3.7e-1 0.171 2.6e-1 16 Click to see details
GSE32688 Pancreatic cancer -0.037 4.2e-1 -0.035 4.2e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.019 4.6e-1 -0.108 3.0e-1 25 Click to see details
GSE21849 B cell lymphoma 0.012 4.8e-1 0.097 3.1e-1 29 Click to see details
GSE21849 B cell lymphoma 0.012 4.8e-1 0.097 3.1e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.225 0.02 0.262 0.01 84 Click to see details
LUAD 0.447 0.07 0.280 0.19 12 Click to see details
STAD 0.243 0.09 0.299 0.05 32 Click to see details
KIRP -0.2 0.14 -0.237 0.1 32 Click to see details
CHOL -0.326 0.2 -0.550 0.06 9 Click to see details
HNSC 0.128 0.21 0.126 0.21 42 Click to see details
KICH 0.134 0.26 0.041 0.42 25 Click to see details
PCPG -0.656 0.27 -0.500 0.33 3 Click to see details
LIHC -0.072 0.31 0.000 0.5 49 Click to see details
UCEC 0.097 0.35 0.018 0.47 19 Click to see details
COAD 0.162 0.35 0.048 0.46 8 Click to see details
PRAD -0.054 0.35 -0.020 0.45 50 Click to see details
KIRC -0.044 0.36 -0.063 0.3 68 Click to see details
THCA 0.044 0.37 0.004 0.49 59 Click to see details
CESC -0.362 0.38 -0.500 0.33 3 Click to see details
BLCA 0.037 0.44 0.022 0.47 18 Click to see details
ESCA 0.039 0.45 -0.064 0.43 11 Click to see details
LUSC 0.018 0.46 -0.046 0.39 38 Click to see details
PAAD 0.04 0.48 0.200 0.4 4 Click to see details
PAAD 0.04 0.48 0.200 0.4 4 Click to see details
PAAD 0.04 0.48 0.200 0.4 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*