miRTarBase - #MIRT051319 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPP30   
Synonyms TSG15
Description ribonuclease P/MRP subunit p30
Transcript NM_001104546   
Other Transcripts NM_006413   
Expression
Putative miRNA Targets on RPP30
3'UTR of RPP30
(miRNA target sites are highlighted)
>RPP30|NM_001104546|3'UTR
   1 CCCTTCTTTAAAAGAGGATTGTCCTGGGCTGATGAGAGTCACTTTACCTGAAGATACCTGGGAAGTTTTGTCTCCTCTGA
  81 GGTTGGCCCATGGCCAGTGACTGATGCAGGACATTACAGCCTGGCCCACTGGCCTCGGTGGTACAATTTATGCTCCTGAG
 161 CACCCCATGGGATTACGCTGTGTGTGGATTTCTCCTGAAACCACATATTTGCCTCTTCTGCCCTGTTCTGTTTTTTCTCA
 241 TTCCCTTATAGAGGACTCTCAGTAAGTCACTTACACAAGAATCCTAATTTGAAATGCTGCTTCCAGGAGACCTGACTTAG
 321 AAAATTGGACAAATAAAGTTGATTTTTTTAAATGTCCAGTAACATGAAGATGCTGAACTTTCCTAGTCATTTAGGGGGAA
 401 ATCACCACAAATATATCTGGCTGATCAGGTTGAAAGTTAAAAGAAAAAAAGATTTATAAAGTGGGTATTTTCAAGATGGT
 481 GTGGAGGGAGATACAATTTGATGCAAGTCTTATACTTTTGATGTCAATTTATTCTTCAGAAATAACTGGTTAATTATAAA
 561 GGGTGGATGGATAAGGATATTCACTGCAACAATGTCTTAAATGTGAAAATGGAAACAACCTAAATACCCAATAATAACAG
 641 GATTAAATAATTCATTGTACATTAAAAGAATACTGTCTATAAAGATGTCTAGAATAAGTTGTTCAGTTGAAGTTGTAAAG
 721 CTAAATACACAATACCCATAATGTGCACAGAAATAATCAGAATGTCATGAAACCAGGATTATTGGTGATGTGTTGCTTCC
 801 TTTGTTACTCATTTCTGTATTGGCATAATGAGTATTGGGTGTTCAAGAGGAGGGGGAAGGAAGTATGACAGATGTTATGG
 881 GGAAAAAGCAAAGTACAACAGGAAGACACCTTGGGGGAACTAATAGAATCTAAGGACTCAAGGATGGCTTCCTGGAGGAA
 961 ATACAGCTAGAACAAAGGGGAGGAATGAGAAGTGATGTGATGGCGTGGAGTGGGCTGTAGTGGGAAGAAGAGTCTTCCAG
1041 GGAGCTGGCACAGTATGTGAAAACAGTAAAGCAAGTGCCTGGATTTTTTAAGGAACTGAAAATTTAGTTGAGTTGAAATT
1121 TAGAGTTTGGCTAGGAAGGTTATGAGAGATAAGAATAAAGAGTTAACAGCAGCCAGATTTTAAGGATTTTATAAGACATT
1201 TTTAGGAGTTTTTATTTCATCCTGAGAGAAATGTGAAGCCATCGAAGGGTTGAAAGAGGAGAGTGAGTTGATCAGCATTG
1281 CATTTTAGAAAAATCCCTCTATCTGCAACTTGAAAAACATTCTGGAGGTAAGCAAGCCTGGAGGCCAGGAGCCTAGGAGG
1361 GCTATTTGATCCAGATGAGAAGTAATGGTGACCTGAACTAGGGCAGAGGCACCTAGGATTGGAAAACATGGACAGATCAC
1441 AGCACTACTTATGTAGTATACTTGGTAAGACCTGGTTGTTTAAAAGAGAAGGATGAGGGAAAGAAGGTCAAAAACAACTT
1521 CTAGGACTCTCCATTGGCCAGTGTGGTGTGCCCTTCACTGAAGAGCAAACACAAAATGAAAGATTGTGGGCAAAGAGTTG
1601 AGTCAGTGAGAAGGCAAGGAGAGAACCTTATAAAAAAATTGACTATGTGATTAAAAACTTAAAAATTTCCCCCAACGTGT
1681 TTATCTTTTCCATTAGCAGAAATAACTAAGAGTTGTCTTAATTCTAATGGGATTTATTCCATATTGTCTCTCATGCCCTC
1761 TACCTAGTTATTAGTGCAAATATTTATATGTGGCAACATAAAACTTTTTAACTCTTTATTCTCTTCTCTCGTGTACCCTC
1841 CCAGCTCTTTAGGGGAGGTGGATTTGAGGCAGATACCATAAAGAAAAGTTGGTCACATGGTGGTAACACGTTGAAGTTAT
1921 GCCACATGAGACATCAGCACTGGCAAGAGAAATGTCTGTGTTGTAGATGTTTCACTTGGAAGAAATTGAAGGACCCTGAG
2001 CCTTAAAAGTCTGACAAACTTAAGCCAGGACCCCTGTGGGGAAGGTAGAGGGGCCAACAAACAAGATTGGGAGTCAGAGA
2081 GATAACAATGAAATCCCCAATGCCTGTGGGAGGTGGACTCCCTGGATTAGTACTAGACAGAAAAGGTACAAAAATATTTC
2161 AAACCATTCTCACAACTCTATATGTGTCTATGACCAGATAACTGGAAGACCTTCTGGTTATGGACTATGCGTATACACTC
2241 TCCCAGATAGTTAGAGGCATATCTAAGAGGTTAACATATATGATCTTATCCAAAATGGGTCTCTTGGTGCTAGTGTTTTA
2321 CATCAGACTTCACTGGCTTTCATGTATTTCCACAAGTGCCAAACATTTCTCATATCCTTGCTGTATTCCATAGAGCAGTG
2401 TTCCTGCTACCTGGAACACTTGATTCTTGAATAACTCCTGTTTACCTTTCAGACAAACCCTAAAGGTTACCACCTCAAAG
2481 AAGTCTTTATAGAAGCCTCATCATCTTAGACACTCTGTATTGTTTCCTTCATCGTATTTACAACAGACAGATACTGTGCA
2561 CTTACTGCCTCACTTAACGACAGGGATACGTTCTGAAAGGTGCATCATTAGGCGGTTTTGTTGTGTGAACATCACAGAGT
2641 GTTACTTACACAAACCTAAATGATACAGCCTACTAAACACCTAGGCTATATGAGCAATACAGCCTATTGCTCTTAGGCTT
2721 CAAACTTGTACGACATGTCACTGTACTGAATACTGTAGGCAACTATAACACAGTGGTAAGTATATTGTGTATCTAAACAA
2801 ACATAGAAAAGGTAATGCACTGTACTATGATGTTACAACAGCTAGGATGTTGCTATCAATAGAAATTTTTCAGCTTCATT
2881 TTATTTTTATGGGACCACCTTTGTATATGTGGTTCATTGTTGGCCGAAACACCATTCTGTGGCACATGACTATGTATTTA
2961 TTCCTCATTATTCCTTTAATATTCATCTCTTCCAGGAGGGCATGTCATGGACAATCTCTTTTTCTTACCACAGGTCTTAG
3041 GACCTGGCCTAGCACCTGGCCAAGAACTACTGGCATACCTCCTTTTATTGTGCTTCAATTTATTGTGCTTTGCAAATACT
3121 GAATTTTTTACAAGTTGAAGATTTGTGGCACCTCTGTAACCAGCAAGTCTATTGGTGCCATTTTTTCAACATCATGTGCC
3201 TGTTTCCTGTCTCGCTCATGTCACATTTTGGTAATTTTCACAATATTAAAAACTTTTTCATTATTATT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGG--UAAUAC---ACGACGAu 5'
             || ||  ||| ||   ||||||| 
Target 5' aagAATCCTAATT-TGAAATGCTGCTt 3'
277 - 302 152.00 -9.60
2
miRNA  3' guGU-UUGGUAA----UACACGACGAu 5'
            || :|::|||    |||||:|||| 
Target 5' acCAGGATTATTGGTGATGTGTTGCTt 3'
772 - 798 150.00 -16.30
3
miRNA  3' guguUUGGUAAUAC-ACGACGAu 5'
              ||| : || | ||:|||| 
Target 5' ttacAACAGCTAGGATGTTGCTa 3'
2833 - 2855 138.00 -11.40
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs202243531 2 dbSNP
rs1434843861 3 dbSNP
rs377405188 13 dbSNP
rs773490685 15 dbSNP
rs763496502 16 dbSNP
rs761721558 18 dbSNP
rs369055870 20 dbSNP
rs759549729 21 dbSNP
rs1189984227 30 dbSNP
rs1464937791 32 dbSNP
rs560702761 35 dbSNP
rs767600980 39 dbSNP
rs752864320 40 dbSNP
rs1196529469 42 dbSNP
rs373941046 50 dbSNP
rs763916273 51 dbSNP
rs529468862 58 dbSNP
rs944764460 68 dbSNP
rs1357248179 70 dbSNP
rs1435422579 72 dbSNP
rs149177463 74 dbSNP
rs900501372 79 dbSNP
rs1010614805 87 dbSNP
rs770523901 88 dbSNP
rs7089472 90 dbSNP
rs1214087658 91 dbSNP
rs530436692 93 dbSNP
rs1004713566 96 dbSNP
rs1465498200 99 dbSNP
rs1190782834 102 dbSNP
rs1251142972 111 dbSNP
rs1169806239 113 dbSNP
rs550505293 114 dbSNP
rs1477745961 116 dbSNP
rs1024087579 117 dbSNP
rs186650487 122 dbSNP
rs1425777168 130 dbSNP
rs1434877201 142 dbSNP
rs1034492144 147 dbSNP
rs1221537040 153 dbSNP
rs757441640 163 dbSNP
rs778932276 167 dbSNP
rs552824188 168 dbSNP
rs566373871 169 dbSNP
rs535626703 185 dbSNP
rs1012560436 189 dbSNP
rs1306791706 192 dbSNP
rs192628190 193 dbSNP
rs1221011898 195 dbSNP
rs1368622084 198 dbSNP
rs1016847152 203 dbSNP
rs1322141647 210 dbSNP
rs564476514 211 dbSNP
rs1022568406 213 dbSNP
rs1435114019 217 dbSNP
rs772202762 221 dbSNP
rs1370325341 224 dbSNP
rs1167782646 238 dbSNP
rs373449791 243 dbSNP
rs1415666130 254 dbSNP
rs77894161 258 dbSNP
rs1288066018 259 dbSNP
rs912070387 267 dbSNP
rs1210756207 268 dbSNP
rs1271488622 274 dbSNP
rs944815066 283 dbSNP
rs1480307088 287 dbSNP
rs974872311 292 dbSNP
rs1451314926 295 dbSNP
rs763335333 297 dbSNP
rs919306347 298 dbSNP
rs746054496 302 dbSNP
rs537873325 303 dbSNP
rs1478939720 305 dbSNP
rs1179962763 312 dbSNP
rs921980988 316 dbSNP
rs1472803824 318 dbSNP
rs756515721 319 dbSNP
rs912032001 320 dbSNP
rs780380795 328 dbSNP
rs1449351082 341 dbSNP
rs543924384 344 dbSNP
rs1404441380 345 dbSNP
rs1049529806 346 dbSNP
rs373732196 355 dbSNP
rs915529241 364 dbSNP
rs1159614895 366 dbSNP
rs1418264898 367 dbSNP
rs946330257 372 dbSNP
rs1248093261 384 dbSNP
rs866125185 389 dbSNP
rs907833369 403 dbSNP
rs79724785 406 dbSNP
rs1045584598 407 dbSNP
rs540955437 408 dbSNP
rs1315200534 414 dbSNP
rs1397140220 415 dbSNP
rs1382680769 418 dbSNP
rs1001746299 419 dbSNP
rs1449794687 421 dbSNP
rs1390447207 424 dbSNP
rs1289109168 431 dbSNP
rs560766072 437 dbSNP
rs1452553208 441 dbSNP
rs1361853648 443 dbSNP
rs1307971280 444 dbSNP
rs1055578380 457 dbSNP
rs1003692009 478 dbSNP
rs574193821 491 dbSNP
rs1384525449 493 dbSNP
rs1230614504 498 dbSNP
rs894970816 507 dbSNP
rs1282830591 517 dbSNP
rs1012070810 520 dbSNP
rs1229121901 523 dbSNP
rs1484984625 524 dbSNP
rs1292064460 527 dbSNP
rs11186356 528 dbSNP
rs1011279939 542 dbSNP
rs561633078 560 dbSNP
rs1313531408 561 dbSNP
rs530602609 567 dbSNP
rs550180125 576 dbSNP
rs1366386660 584 dbSNP
rs563764747 591 dbSNP
rs1295590818 593 dbSNP
rs1381313904 599 dbSNP
rs1382306423 604 dbSNP
rs1295135899 610 dbSNP
rs1019953604 611 dbSNP
rs994776282 613 dbSNP
rs529470947 614 dbSNP
rs1451186119 620 dbSNP
rs999780371 632 dbSNP
rs1192548331 640 dbSNP
rs1427031319 646 dbSNP
rs78186729 646 dbSNP
rs1483380540 648 dbSNP
rs1269702068 652 dbSNP
rs1223753536 655 dbSNP
rs1019183269 660 dbSNP
rs1289993776 668 dbSNP
rs1207925829 681 dbSNP
rs1340604336 688 dbSNP
rs966212470 689 dbSNP
rs772623635 705 dbSNP
rs1226050500 712 dbSNP
rs975301188 714 dbSNP
rs532760203 719 dbSNP
rs546529087 720 dbSNP
rs952221307 722 dbSNP
rs370709141 733 dbSNP
rs1397121807 734 dbSNP
rs1460509805 735 dbSNP
rs1379394988 748 dbSNP
rs1163517779 751 dbSNP
rs1480193789 756 dbSNP
rs1184766778 757 dbSNP
rs1267227790 757 dbSNP
rs535293078 759 dbSNP
rs1415257498 764 dbSNP
rs1427241641 769 dbSNP
rs549131470 772 dbSNP
rs974913863 775 dbSNP
rs569267383 776 dbSNP
rs940672903 780 dbSNP
rs1045637880 792 dbSNP
rs1264391984 812 dbSNP
rs1340280843 820 dbSNP
rs1448944628 821 dbSNP
rs776472203 844 dbSNP
rs928543361 848 dbSNP
rs1281222196 849 dbSNP
rs937213150 851 dbSNP
rs1286188388 852 dbSNP
rs915457195 856 dbSNP
rs1336330472 862 dbSNP
rs946970689 876 dbSNP
rs1340376999 883 dbSNP
rs1389565822 886 dbSNP
rs1404447890 892 dbSNP
rs1177170696 895 dbSNP
rs1227761288 897 dbSNP
rs1275495485 900 dbSNP
rs892920215 908 dbSNP
rs1042046644 918 dbSNP
rs538370495 934 dbSNP
rs1342760854 937 dbSNP
rs185504683 950 dbSNP
rs1197509359 954 dbSNP
rs1253775501 957 dbSNP
rs1011749457 964 dbSNP
rs923584923 969 dbSNP
rs939070862 978 dbSNP
rs1041446209 980 dbSNP
rs1244509883 987 dbSNP
rs1188063720 1003 dbSNP
rs1203750665 1007 dbSNP
rs578104914 1024 dbSNP
rs759250452 1028 dbSNP
rs767729760 1032 dbSNP
rs1278666929 1048 dbSNP
rs1236806220 1050 dbSNP
rs966695124 1051 dbSNP
rs1187361575 1056 dbSNP
rs894904573 1057 dbSNP
rs947852673 1058 dbSNP
rs1322829532 1069 dbSNP
rs765192500 1073 dbSNP
rs1171340576 1074 dbSNP
rs1401460711 1074 dbSNP
rs1401870151 1085 dbSNP
rs1415390545 1089 dbSNP
rs1157181609 1091 dbSNP
rs1336633909 1092 dbSNP
rs1029585196 1097 dbSNP
rs370412615 1104 dbSNP
rs554516090 1110 dbSNP
rs1183722298 1118 dbSNP
rs117880789 1136 dbSNP
rs190505103 1146 dbSNP
rs563068049 1155 dbSNP
rs576547437 1156 dbSNP
rs549347583 1161 dbSNP
rs928594405 1162 dbSNP
rs1315613936 1176 dbSNP
rs192949301 1177 dbSNP
rs1380711450 1183 dbSNP
rs991386726 1188 dbSNP
rs757783365 1192 dbSNP
rs1344831780 1194 dbSNP
rs1316736985 1196 dbSNP
rs764043096 1203 dbSNP
rs1207720426 1208 dbSNP
rs1163545291 1210 dbSNP
rs1443252291 1220 dbSNP
rs1382866876 1223 dbSNP
rs947215278 1230 dbSNP
rs974884088 1262 dbSNP
rs563825825 1268 dbSNP
rs1022483759 1273 dbSNP
rs968236372 1274 dbSNP
rs1292177839 1278 dbSNP
rs978336423 1280 dbSNP
rs1221656414 1281 dbSNP
rs1196192798 1287 dbSNP
rs1357179439 1290 dbSNP
rs902920243 1291 dbSNP
rs1215210489 1294 dbSNP
rs1478680853 1299 dbSNP
rs751622210 1300 dbSNP
rs924252010 1301 dbSNP
rs938982652 1317 dbSNP
rs1346546236 1326 dbSNP
rs532772331 1326 dbSNP
rs899465926 1327 dbSNP
rs1171953334 1328 dbSNP
rs1410017631 1329 dbSNP
rs757394813 1331 dbSNP
rs996836289 1332 dbSNP
rs1029225374 1340 dbSNP
rs887956377 1353 dbSNP
rs1006333363 1354 dbSNP
rs916294590 1363 dbSNP
rs546139841 1368 dbSNP
rs1234513977 1370 dbSNP
rs560208767 1371 dbSNP
rs767469407 1381 dbSNP
rs1038115444 1385 dbSNP
rs898313029 1389 dbSNP
rs929848187 1390 dbSNP
rs1047412268 1391 dbSNP
rs1270891340 1393 dbSNP
rs962098458 1396 dbSNP
rs1324520038 1403 dbSNP
rs981441039 1405 dbSNP
rs891051389 1410 dbSNP
rs1403457681 1412 dbSNP
rs1036107850 1417 dbSNP
rs185098574 1420 dbSNP
rs1299260413 1421 dbSNP
rs1442057631 1422 dbSNP
rs750698606 1424 dbSNP
rs1201725191 1427 dbSNP
rs529151970 1431 dbSNP
rs1470791880 1433 dbSNP
rs756321633 1443 dbSNP
rs548990493 1444 dbSNP
rs1409838849 1455 dbSNP
rs1233900090 1460 dbSNP
rs1177716541 1463 dbSNP
rs146467760 1471 dbSNP
rs1231310587 1475 dbSNP
rs528782303 1476 dbSNP
rs947235421 1477 dbSNP
rs1227345929 1478 dbSNP
rs1247723345 1481 dbSNP
rs779518333 1484 dbSNP
rs1319134837 1486 dbSNP
rs1268345029 1502 dbSNP
rs1223725841 1503 dbSNP
rs1371792272 1504 dbSNP
rs1486665236 1505 dbSNP
rs780077494 1506 dbSNP
rs924391912 1511 dbSNP
rs1266125870 1522 dbSNP
rs978292933 1527 dbSNP
rs1452631839 1529 dbSNP
rs1031632995 1530 dbSNP
rs1418498895 1534 dbSNP
rs1378370588 1537 dbSNP
rs1185551738 1539 dbSNP
rs550918885 1547 dbSNP
rs1486936931 1549 dbSNP
rs899515419 1549 dbSNP
rs1215482206 1553 dbSNP
rs111666375 1559 dbSNP
rs1317807700 1562 dbSNP
rs1472479695 1568 dbSNP
rs551946071 1571 dbSNP
rs796694768 1577 dbSNP
rs571730593 1579 dbSNP
rs1414466159 1580 dbSNP
rs1456639123 1583 dbSNP
rs1393986114 1586 dbSNP
rs1386680617 1589 dbSNP
rs973788208 1590 dbSNP
rs919708638 1595 dbSNP
rs534188863 1615 dbSNP
rs117840137 1616 dbSNP
rs1046894353 1621 dbSNP
rs1387240037 1625 dbSNP
rs1015036983 1633 dbSNP
rs912444329 1637 dbSNP
rs943981922 1638 dbSNP
rs1430586054 1641 dbSNP
rs1262670916 1652 dbSNP
rs776277255 1654 dbSNP
rs1040054790 1655 dbSNP
rs1294317125 1657 dbSNP
rs548783864 1657 dbSNP
rs900484904 1658 dbSNP
rs530469745 1659 dbSNP
rs1318338032 1661 dbSNP
rs1290491242 1662 dbSNP
rs1043799586 1663 dbSNP
rs1327880366 1669 dbSNP
rs991492314 1673 dbSNP
rs1381265138 1676 dbSNP
rs769512172 1678 dbSNP
rs1338146904 1689 dbSNP
rs1000079898 1691 dbSNP
rs1425281192 1692 dbSNP
rs1158145701 1700 dbSNP
rs1031184263 1701 dbSNP
rs1463613886 1706 dbSNP
rs1373682156 1722 dbSNP
rs746787437 1727 dbSNP
rs1356472639 1737 dbSNP
rs368334108 1742 dbSNP
rs1013816923 1749 dbSNP
rs188716950 1766 dbSNP
rs1265855614 1775 dbSNP
rs1021091373 1778 dbSNP
rs1483035882 1780 dbSNP
rs1340900219 1782 dbSNP
rs965184851 1783 dbSNP
rs976921447 1788 dbSNP
rs1023883060 1789 dbSNP
rs1422218419 1792 dbSNP
rs921012681 1792 dbSNP
rs1164389694 1793 dbSNP
rs1321543413 1798 dbSNP
rs932334779 1806 dbSNP
rs775446637 1817 dbSNP
rs969020842 1818 dbSNP
rs1297668188 1820 dbSNP
rs1464324781 1822 dbSNP
rs1431679737 1827 dbSNP
rs1426604233 1840 dbSNP
rs973719483 1844 dbSNP
rs1376240860 1849 dbSNP
rs112384435 1861 dbSNP
rs951182264 1866 dbSNP
rs1438835810 1867 dbSNP
rs1250682146 1868 dbSNP
rs1197450146 1875 dbSNP
rs982994586 1883 dbSNP
rs181243090 1884 dbSNP
rs1264645139 1889 dbSNP
rs557432815 1894 dbSNP
rs1344043072 1905 dbSNP
rs1039634015 1907 dbSNP
rs1002968138 1909 dbSNP
rs1241169920 1909 dbSNP
rs1336275763 1909 dbSNP
rs1444630317 1914 dbSNP
rs1393887769 1916 dbSNP
rs1337672857 1920 dbSNP
rs7082814 1921 dbSNP
rs894541427 1921 dbSNP
rs1160639987 1931 dbSNP
rs1311595152 1933 dbSNP
rs112357536 1936 dbSNP
rs1043764274 1937 dbSNP
rs560128373 1939 dbSNP
rs1437316245 1942 dbSNP
rs145013767 1945 dbSNP
rs377320310 1945 dbSNP
rs998791752 1952 dbSNP
rs999601090 1953 dbSNP
rs1206645649 1956 dbSNP
rs34683182 1960 dbSNP
rs1351376048 1964 dbSNP
rs1308471662 1969 dbSNP
rs1052970771 1985 dbSNP
rs528861812 1987 dbSNP
rs1315744299 1994 dbSNP
rs1181691208 2002 dbSNP
rs976597105 2005 dbSNP
rs1320736245 2013 dbSNP
rs1014207859 2014 dbSNP
rs185496151 2015 dbSNP
rs1446743744 2019 dbSNP
rs921054849 2031 dbSNP
rs1407021937 2040 dbSNP
rs1384652513 2041 dbSNP
rs1157390895 2043 dbSNP
rs562631896 2064 dbSNP
rs1386618710 2066 dbSNP
rs1183669524 2068 dbSNP
rs1186740414 2069 dbSNP
rs77974269 2075 dbSNP
rs1447392972 2076 dbSNP
rs995111529 2083 dbSNP
rs1214372161 2085 dbSNP
rs1361482609 2089 dbSNP
rs984241395 2090 dbSNP
rs1026622602 2091 dbSNP
rs551555117 2103 dbSNP
rs1272166384 2106 dbSNP
rs571792281 2109 dbSNP
rs1379435020 2133 dbSNP
rs567283092 2134 dbSNP
rs1294687363 2138 dbSNP
rs1366705319 2142 dbSNP
rs1363871498 2146 dbSNP
rs912340096 2149 dbSNP
rs1410935757 2155 dbSNP
rs1229730431 2162 dbSNP
rs139047311 2163 dbSNP
rs1475502474 2166 dbSNP
rs1262271411 2171 dbSNP
rs547560383 2172 dbSNP
rs567682262 2175 dbSNP
rs1323967292 2176 dbSNP
rs1490831560 2179 dbSNP
rs975246222 2190 dbSNP
rs921157660 2191 dbSNP
rs947298099 2194 dbSNP
rs1057296652 2202 dbSNP
rs78655026 2203 dbSNP
rs1215439693 2206 dbSNP
rs1013007473 2231 dbSNP
rs766551932 2233 dbSNP
rs1225714579 2239 dbSNP
rs1346493644 2244 dbSNP
rs1293494299 2245 dbSNP
rs904537953 2247 dbSNP
rs1247449546 2255 dbSNP
rs1450190197 2256 dbSNP
rs1330291942 2262 dbSNP
rs1188405814 2273 dbSNP
rs1465874298 2286 dbSNP
rs556822073 2287 dbSNP
rs1168333212 2294 dbSNP
rs998842806 2300 dbSNP
rs1429680940 2301 dbSNP
rs1190566051 2317 dbSNP
rs1031618884 2319 dbSNP
rs935367322 2331 dbSNP
rs1052526180 2333 dbSNP
rs1457526151 2348 dbSNP
rs1256428085 2350 dbSNP
rs754032591 2354 dbSNP
rs949542333 2359 dbSNP
rs1300945915 2362 dbSNP
rs1218037892 2364 dbSNP
rs1376157104 2374 dbSNP
rs776476286 2376 dbSNP
rs905425474 2380 dbSNP
rs995702805 2386 dbSNP
rs983903162 2390 dbSNP
rs569966643 2397 dbSNP
rs1359587838 2401 dbSNP
rs1016606956 2405 dbSNP
rs1219172698 2411 dbSNP
rs1410046534 2414 dbSNP
rs1302334989 2417 dbSNP
rs1439200423 2439 dbSNP
rs1236364891 2446 dbSNP
rs1461928518 2453 dbSNP
rs1438236307 2464 dbSNP
rs1208417242 2466 dbSNP
rs1285600634 2469 dbSNP
rs1326137928 2469 dbSNP
rs961057513 2472 dbSNP
rs1226745910 2474 dbSNP
rs1027218589 2480 dbSNP
rs1267714370 2485 dbSNP
rs1306441950 2507 dbSNP
rs1465544484 2520 dbSNP
rs1218028611 2522 dbSNP
rs1302097892 2523 dbSNP
rs972353337 2535 dbSNP
rs1245112377 2541 dbSNP
rs1487428538 2546 dbSNP
rs886774783 2551 dbSNP
rs1346708003 2552 dbSNP
rs1190582721 2566 dbSNP
rs1333004421 2577 dbSNP
rs1378607829 2581 dbSNP
rs866368925 2589 dbSNP
rs755423697 2596 dbSNP
rs1429675121 2600 dbSNP
rs1481283609 2601 dbSNP
rs1180286850 2605 dbSNP
rs1156736306 2607 dbSNP
rs965520555 2611 dbSNP
rs538866462 2612 dbSNP
rs1352146813 2627 dbSNP
rs993450125 2633 dbSNP
rs1028146176 2643 dbSNP
rs968561657 2644 dbSNP
rs558691074 2653 dbSNP
rs1311615804 2657 dbSNP
rs779884427 2661 dbSNP
rs1363836030 2663 dbSNP
rs779132625 2669 dbSNP
rs572288410 2671 dbSNP
rs753315554 2673 dbSNP
rs1399397344 2674 dbSNP
rs1347616640 2704 dbSNP
rs1358506992 2710 dbSNP
rs924554825 2710 dbSNP
rs1436338558 2715 dbSNP
rs1304302497 2722 dbSNP
rs904591903 2731 dbSNP
rs188197599 2751 dbSNP
rs935314487 2758 dbSNP
rs17102188 2765 dbSNP
rs553582277 2779 dbSNP
rs917987008 2780 dbSNP
rs1288186588 2788 dbSNP
rs1264433511 2800 dbSNP
rs570914490 2804 dbSNP
rs573622825 2808 dbSNP
rs1487622675 2813 dbSNP
rs41286918 2819 dbSNP
rs1287769969 2825 dbSNP
rs1488526756 2826 dbSNP
rs998114744 2829 dbSNP
rs905351989 2830 dbSNP
rs182523481 2836 dbSNP
rs1048633325 2841 dbSNP
rs889638428 2842 dbSNP
rs745321969 2843 dbSNP
rs1016662785 2844 dbSNP
rs1338088750 2850 dbSNP
rs1003858392 2851 dbSNP
rs187235552 2853 dbSNP
rs961109087 2858 dbSNP
rs545241246 2860 dbSNP
rs1291856182 2866 dbSNP
rs972406842 2867 dbSNP
rs1424579178 2878 dbSNP
rs1034655769 2880 dbSNP
rs1477066376 2881 dbSNP
rs1019709950 2884 dbSNP
rs900863191 2888 dbSNP
rs1200219943 2892 dbSNP
rs996578136 2893 dbSNP
rs960628707 2899 dbSNP
rs566713362 2900 dbSNP
rs1207518789 2904 dbSNP
rs74775976 2908 dbSNP
rs1258326376 2916 dbSNP
rs948938285 2917 dbSNP
rs1276333414 2919 dbSNP
rs769600769 2923 dbSNP
rs1233951401 2926 dbSNP
rs968529008 2931 dbSNP
rs978925580 2937 dbSNP
rs192164281 2940 dbSNP
rs1159970228 2942 dbSNP
rs770019313 2943 dbSNP
rs1410925658 2952 dbSNP
rs1330943779 2961 dbSNP
rs1464216019 2968 dbSNP
rs934742827 2969 dbSNP
rs1404217908 2973 dbSNP
rs76854523 2975 dbSNP
rs1478009324 2977 dbSNP
rs901191371 3006 dbSNP
rs1441035301 3008 dbSNP
rs183432621 3010 dbSNP
rs1238182406 3013 dbSNP
rs1177638004 3015 dbSNP
rs956171178 3023 dbSNP
rs988131473 3026 dbSNP
rs372591054 3030 dbSNP
rs796317291 3031 dbSNP
rs970726867 3032 dbSNP
rs980820757 3037 dbSNP
rs1254210192 3040 dbSNP
rs1242151798 3044 dbSNP
rs926743761 3056 dbSNP
rs1005379836 3057 dbSNP
rs1038159065 3073 dbSNP
rs1282623928 3078 dbSNP
rs748865895 3079 dbSNP
rs142964944 3081 dbSNP
rs896958476 3082 dbSNP
rs1378776492 3092 dbSNP
rs1335328968 3094 dbSNP
rs1246800550 3097 dbSNP
rs1049057160 3119 dbSNP
rs147120261 3121 dbSNP
rs538980720 3123 dbSNP
rs1380437915 3130 dbSNP
rs1157523339 3131 dbSNP
rs552431227 3154 dbSNP
rs1238865833 3159 dbSNP
rs1012307947 3160 dbSNP
rs1441639001 3162 dbSNP
rs1253751805 3165 dbSNP
rs1361434878 3176 dbSNP
rs1202941505 3181 dbSNP
rs908764074 3188 dbSNP
rs115605292 3196 dbSNP
rs1183781752 3205 dbSNP
rs1285034836 3211 dbSNP
rs1447487703 3217 dbSNP
rs1235349782 3227 dbSNP
rs534896952 3230 dbSNP
rs1300422279 3234 dbSNP
rs1041321141 3239 dbSNP
rs1183648893 3243 dbSNP
rs1157331377 3247 dbSNP
rs577929835 3249 dbSNP
rs900834763 3257 dbSNP
rs996546853 3269 dbSNP
rs762474737 3270 dbSNP
rs988906425 3271 dbSNP
rs1195540337 3275 dbSNP
rs904278605 3278 dbSNP
rs71479064 3284 dbSNP
rs1168539230 3287 dbSNP
rs1488602637 3289 dbSNP
rs1397898017 3299 dbSNP
rs1000009013 3311 dbSNP
rs1214305336 3320 dbSNP
rs1453403723 3325 dbSNP
rs1290610766 3327 dbSNP
rs774009622 3333 dbSNP
rs1228018786 3338 dbSNP
rs761811295 3339 dbSNP
rs955929501 3342 dbSNP
rs1219657482 3343 dbSNP
rs1340249963 3345 dbSNP
rs934029160 3351 dbSNP
rs1439154526 3353 dbSNP
rs1014570342 3363 dbSNP
rs185694483 3365 dbSNP
rs911175791 3367 dbSNP
rs1391809395 3369 dbSNP
rs1172307655 3371 dbSNP
rs1478041431 3373 dbSNP
rs573609984 3381 dbSNP
rs1358790045 3387 dbSNP
rs1024265453 3389 dbSNP
rs536267513 3390 dbSNP
rs555853523 3397 dbSNP
rs1247432941 3400 dbSNP
rs926686485 3405 dbSNP
rs1363154369 3411 dbSNP
rs576093368 3414 dbSNP
rs1449889340 3427 dbSNP
rs1260271269 3445 dbSNP
rs1199435085 3478 dbSNP
rs1269496405 3491 dbSNP
rs1317704625 3500 dbSNP
rs545352076 3501 dbSNP
rs1221500715 3504 dbSNP
rs993949810 3508 dbSNP
rs1056240505 3512 dbSNP
rs1197327371 3517 dbSNP
rs1276311489 3519 dbSNP
rs771951652 3529 dbSNP
rs201961176 3530 dbSNP
rs1332953340 3547 dbSNP
rs896222744 3549 dbSNP
rs908684699 3553 dbSNP
rs1011950467 3567 dbSNP
rs1168054323 3576 dbSNP
rs773313936 3579 dbSNP
rs1023732599 3585 dbSNP
rs940240847 3593 dbSNP
rs967701849 3598 dbSNP
rs1041683497 3609 dbSNP
rs190302347 3610 dbSNP
rs1203905356 3615 dbSNP
rs1240043353 3621 dbSNP
rs1244396658 3623 dbSNP
rs572276467 3624 dbSNP
rs1447113898 3627 dbSNP
rs1256606616 3630 dbSNP
rs932268869 3631 dbSNP
rs1049443486 3655 dbSNP
rs1187434695 3657 dbSNP
rs922749531 3658 dbSNP
rs113803383 3664 dbSNP
rs4522081 3665 dbSNP
rs553074396 3669 dbSNP
rs1000341638 3671 dbSNP
rs1447149481 3671 dbSNP
rs1052898107 3675 dbSNP
rs1424911537 3676 dbSNP
rs911215021 3686 dbSNP
rs1470401776 3693 dbSNP
rs1449993118 3694 dbSNP
rs1359457971 3695 dbSNP
rs182461598 3697 dbSNP
rs941337378 3698 dbSNP
rs891621446 3701 dbSNP
rs186781442 3702 dbSNP
rs918485828 3703 dbSNP
rs1439375625 3705 dbSNP
rs1248715868 3706 dbSNP
rs754147690 3709 dbSNP
rs1319136678 3716 dbSNP
rs1483783371 3718 dbSNP
rs969966098 3724 dbSNP
rs1237202465 3726 dbSNP
rs1208710442 3731 dbSNP
rs1002131797 3736 dbSNP
rs1056695599 3740 dbSNP
rs1229532959 3751 dbSNP
rs578069609 3755 dbSNP
rs896288164 3759 dbSNP
rs192389905 3766 dbSNP
rs1379694859 3769 dbSNP
rs536473770 3773 dbSNP
rs1322584495 3775 dbSNP
rs952738048 3780 dbSNP
rs1362359243 3781 dbSNP
rs984607787 3786 dbSNP
rs765640093 3792 dbSNP
rs1044798101 3803 dbSNP
rs1015711337 3806 dbSNP
rs961807307 3811 dbSNP
rs1413606120 3824 dbSNP
rs1223945339 3840 dbSNP
rs1489584091 3849 dbSNP
rs976947297 3856 dbSNP
rs922827356 3857 dbSNP
rs563368877 3859 dbSNP
rs1033283070 3863 dbSNP
rs1485267908 3865 dbSNP
rs1204021979 3866 dbSNP
rs762097942 3867 dbSNP
rs543867717 3876 dbSNP
rs985740343 3877 dbSNP
rs1311807568 3879 dbSNP
rs1197413448 3881 dbSNP
rs778382558 3886 dbSNP
rs1231256058 3889 dbSNP
rs552492986 3897 dbSNP
rs1480954290 3904 dbSNP
rs1399255316 3915 dbSNP
rs1295355960 3922 dbSNP
rs1382953960 3922 dbSNP
rs1030251424 3923 dbSNP
rs1349493310 3925 dbSNP
rs935720133 3933 dbSNP
rs182709117 3934 dbSNP
rs1162993594 3935 dbSNP
rs1479025050 3936 dbSNP
rs1179083946 3946 dbSNP
rs148175022 3948 dbSNP
rs891552044 3952 dbSNP
rs949884470 3963 dbSNP
rs1045554046 3965 dbSNP
rs1259106418 3966 dbSNP
rs1211087975 3971 dbSNP
rs548466683 3972 dbSNP
rs368952200 3973 dbSNP
rs1211367671 3981 dbSNP
rs1027566447 3983 dbSNP
rs1258447241 3989 dbSNP
rs888435951 4002 dbSNP
rs188790331 4003 dbSNP
rs1324582923 4008 dbSNP
rs974041873 4014 dbSNP
rs1016053079 4020 dbSNP
rs918538351 4021 dbSNP
rs1366947957 4022 dbSNP
rs929905319 4036 dbSNP
rs760863980 4041 dbSNP
rs556275373 4043 dbSNP
rs1170375272 4047 dbSNP
rs1344852299 4052 dbSNP
rs1460963242 4054 dbSNP
rs576156484 4069 dbSNP
rs947885856 4071 dbSNP
rs1029824812 4076 dbSNP
rs1251767259 4085 dbSNP
rs1191418930 4086 dbSNP
rs779694006 4087 dbSNP
rs985707749 4093 dbSNP
rs1194988949 4096 dbSNP
rs926228068 4100 dbSNP
rs935632423 4106 dbSNP
rs1233798467 4109 dbSNP
rs193213861 4109 dbSNP
rs574068084 4113 dbSNP
rs554749242 4114 dbSNP
rs936358273 4116 dbSNP
rs1377901437 4117 dbSNP
rs1207600793 4121 dbSNP
rs912943370 4122 dbSNP
rs558891853 4126 dbSNP
rs892102313 4139 dbSNP
rs1010906786 4140 dbSNP
rs1490675414 4147 dbSNP
rs572217512 4152 dbSNP
rs1045479186 4153 dbSNP
rs11186358 4157 dbSNP
rs755014935 4159 dbSNP
rs891318511 4160 dbSNP
rs1435871012 4164 dbSNP
rs937207568 4165 dbSNP
rs1007041817 4168 dbSNP
rs1201033924 4175 dbSNP
rs1473730492 4176 dbSNP
rs1048930719 4188 dbSNP
rs1485287255 4192 dbSNP
rs1018353849 4194 dbSNP
rs1242436047 4199 dbSNP
rs1182835403 4203 dbSNP
rs768123961 4204 dbSNP
rs1237087839 4206 dbSNP
rs1342692194 4207 dbSNP
rs887701486 4223 dbSNP
rs559705205 4228 dbSNP
rs1162814409 4241 dbSNP
rs1025605200 4246 dbSNP
rs185330785 4250 dbSNP
rs574551237 4251 dbSNP
rs1468278863 4256 dbSNP
rs543447900 4256 dbSNP
rs998253820 4257 dbSNP
rs1304662059 4259 dbSNP
rs947903723 4260 dbSNP
rs1485193455 4266 dbSNP
rs1255355837 4267 dbSNP
rs77532055 4269 dbSNP
rs1283628200 4273 dbSNP
rs367752216 4273 dbSNP
rs925055778 4284 dbSNP
rs936413613 4288 dbSNP
rs189059378 4299 dbSNP
rs1307234430 4300 dbSNP
rs1337201318 4301 dbSNP
rs771824999 4302 dbSNP
rs1007072325 4305 dbSNP
rs1052144826 4306 dbSNP
rs757189970 4315 dbSNP
rs1280657328 4327 dbSNP
rs76265731 4339 dbSNP
rs957663241 4342 dbSNP
rs1345328261 4358 dbSNP
rs11186359 4369 dbSNP
rs1398642509 4370 dbSNP
rs1392456694 4377 dbSNP
rs61857745 4378 dbSNP
rs971508849 4380 dbSNP
rs981147801 4387 dbSNP
rs191869856 4388 dbSNP
rs769594712 4397 dbSNP
rs937135470 4397 dbSNP
rs35410684 4401 dbSNP
rs779814698 4403 dbSNP
rs909095939 4406 dbSNP
rs1196787686 4407 dbSNP
rs865835289 4414 dbSNP
rs530409618 4416 dbSNP
rs995570621 4417 dbSNP
rs1025656085 4421 dbSNP
rs951491172 4429 dbSNP
rs1422349565 4430 dbSNP
rs1361840789 4435 dbSNP
rs1268882227 4436 dbSNP
rs1183005987 4438 dbSNP
rs1332252187 4441 dbSNP
rs1013567664 4444 dbSNP
rs568591152 4445 dbSNP
rs1036713941 4449 dbSNP
rs1445126586 4462 dbSNP
rs1172520014 4469 dbSNP
rs1410515878 4479 dbSNP
rs11186360 4484 dbSNP
rs998221169 4497 dbSNP
rs567325722 4499 dbSNP
rs1247307205 4510 dbSNP
rs1193303951 4511 dbSNP
rs375716365 4518 dbSNP
rs1467308332 4526 dbSNP
rs980648588 4528 dbSNP
rs1199686728 4545 dbSNP
rs889877251 4547 dbSNP
rs1307237206 4548 dbSNP
rs549945437 4557 dbSNP
rs569718791 4559 dbSNP
rs957795157 4560 dbSNP
rs1010483793 4561 dbSNP
rs1439764107 4572 dbSNP
rs1020989189 4575 dbSNP
rs971001889 4579 dbSNP
rs987901536 4586 dbSNP
rs538657422 4590 dbSNP
rs913636179 4591 dbSNP
rs1442703541 4596 dbSNP
rs529756666 4597 dbSNP
rs1298601569 4599 dbSNP
rs765330400 4604 dbSNP
rs1393937926 4605 dbSNP
rs927019489 4610 dbSNP
rs1173063666 4614 dbSNP
rs775952288 4615 dbSNP
rs373675207 4616 dbSNP
rs910176508 4618 dbSNP
rs1179418457 4622 dbSNP
rs1480517309 4625 dbSNP
rs1299688858 4626 dbSNP
rs942970148 4627 dbSNP
rs1212935972 4630 dbSNP
rs1443463013 4639 dbSNP
rs546734650 4640 dbSNP
rs1232962632 4645 dbSNP
rs184102248 4649 dbSNP
rs868357089 4658 dbSNP
rs1223940837 4661 dbSNP
rs940560204 4665 dbSNP
rs1036275959 4671 dbSNP
rs1296237980 4679 dbSNP
rs1450175744 4684 dbSNP
rs548760244 4698 dbSNP
rs1312156060 4704 dbSNP
rs1047155121 4706 dbSNP
rs1362472347 4712 dbSNP
rs1160179224 4715 dbSNP
rs1307492683 4723 dbSNP
rs1205651386 4726 dbSNP
rs887194883 4727 dbSNP
rs1183944610 4732 dbSNP
rs1253465652 4736 dbSNP
rs1475713852 4739 dbSNP
rs1014036262 4740 dbSNP
rs933942045 4754 dbSNP
rs1051114920 4756 dbSNP
rs1243774725 4757 dbSNP
rs889846259 4758 dbSNP
rs764527935 4759 dbSNP
rs1315930344 4760 dbSNP
rs1304350936 4764 dbSNP
rs1462694892 4764 dbSNP
rs1186798076 4766 dbSNP
rs1229852438 4766 dbSNP
rs566540090 4767 dbSNP
rs1006960999 4771 dbSNP
rs1292612301 4772 dbSNP
rs534638333 4773 dbSNP
rs1002139098 4779 dbSNP
rs1427909132 4781 dbSNP
rs1054986615 4787 dbSNP
rs893296509 4788 dbSNP
rs7903584 4789 dbSNP
rs1020493850 4791 dbSNP
rs954494150 4792 dbSNP
rs1479087365 4800 dbSNP
rs1263273212 4802 dbSNP
rs1186571943 4806 dbSNP
rs1485236424 4812 dbSNP
rs987587144 4816 dbSNP
rs1223235051 4820 dbSNP
rs1335299171 4828 dbSNP
rs1272310833 4829 dbSNP
rs1231416552 4834 dbSNP
rs1342265652 4851 dbSNP
rs757834145 4853 dbSNP
rs943011015 4858 dbSNP
rs368227381 4872 dbSNP
rs1318026501 4875 dbSNP
rs1361806255 4880 dbSNP
rs1295520992 4881 dbSNP
rs975667649 4885 dbSNP
rs574586150 4899 dbSNP
rs1394295256 4902 dbSNP
rs920161771 4903 dbSNP
rs1215675103 4925 dbSNP
rs1298134633 4931 dbSNP
rs1002463892 4951 dbSNP
rs931519060 4952 dbSNP
rs1467689586 4965 dbSNP
rs1047208210 4967 dbSNP
rs1263957198 4972 dbSNP
rs1427421061 4982 dbSNP
rs1033965766 4990 dbSNP
rs773587588 4996 dbSNP
rs1468615769 4999 dbSNP
rs958390786 5008 dbSNP
rs4933621 5011 dbSNP
rs557038211 5013 dbSNP
rs1341166623 5019 dbSNP
rs1251826851 5022 dbSNP
rs1485462850 5024 dbSNP
rs1226535159 5033 dbSNP
rs139876029 5037 dbSNP
rs972310907 5038 dbSNP
rs1479319658 5046 dbSNP
rs923160692 5054 dbSNP
rs1441970821 5055 dbSNP
rs1175527024 5057 dbSNP
rs1032300506 5058 dbSNP
rs1429543057 5060 dbSNP
rs1470761816 5061 dbSNP
rs1298161926 5067 dbSNP
rs933239341 5072 dbSNP
rs986069433 5074 dbSNP
rs1370880934 5077 dbSNP
rs1344122881 5092 dbSNP
rs1174945477 5097 dbSNP
rs911222234 5112 dbSNP
rs942711613 5113 dbSNP
rs1394137598 5117 dbSNP
rs1191295291 5119 dbSNP
rs1439358949 5126 dbSNP
rs1054510898 5128 dbSNP
rs893210794 5129 dbSNP
rs1195229815 5138 dbSNP
rs371932291 5147 dbSNP
rs1020790022 5156 dbSNP
rs1344216531 5161 dbSNP
rs537410756 5166 dbSNP
rs946210709 5171 dbSNP
rs774484035 5187 dbSNP
rs141639075 5197 dbSNP
rs1325857023 5222 dbSNP
rs987253517 5222 dbSNP
rs188535791 5231 dbSNP
rs747815689 5232 dbSNP
rs964372161 5236 dbSNP
rs973037745 5239 dbSNP
rs78674077 5240 dbSNP
rs931571679 5244 dbSNP
rs768063369 5247 dbSNP
rs1171431338 5251 dbSNP
rs11186361 5256 dbSNP
rs1364207639 5280 dbSNP
rs1180797635 5283 dbSNP
rs1417033783 5286 dbSNP
rs1259569908 5292 dbSNP
rs1211435025 5293 dbSNP
rs1485419001 5295 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.707 3.4e-3 -0.731 2.3e-3 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.485 1.5e-2 0.747 7.7e-5 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.353 4.9e-2 -0.367 4.2e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.098 1.8e-1 -0.046 3.3e-1 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.209 1.9e-1 -0.212 1.8e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.154 2.0e-1 0.177 1.7e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.218 2.5e-1 0.056 4.3e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.077 2.5e-1 0.072 2.6e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.138 2.6e-1 0.027 4.5e-1 25 Click to see details
GSE21032 Prostate cancer 0.048 3.3e-1 0.038 3.7e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.086 3.4e-1 0.031 4.4e-1 25 Click to see details
GSE28544 Breast cancer 0.082 3.5e-1 0.387 3.1e-2 24 Click to see details
GSE19536 Breast cancer 0.036 3.6e-1 0.035 3.6e-1 100 Click to see details
GSE21849 B cell lymphoma 0.06 3.8e-1 0.140 2.3e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.034 3.9e-1 0.088 2.4e-1 64 Click to see details
GSE17306 Multiple myeloma 0.038 4.0e-1 0.076 3.0e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.049 4.1e-1 0.020 4.6e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.024 4.6e-1 0.056 4.2e-1 16 Click to see details
GSE17498 Multiple myeloma -0.014 4.7e-1 -0.085 3.0e-1 40 Click to see details
GSE38226 Liver fibrosis 0.002 5.0e-1 0.042 4.3e-1 21 Click to see details
GSE38226 Liver fibrosis 0.002 5.0e-1 0.042 4.3e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.5 0 -0.552 0 32 Click to see details
KIRP 0.266 0.07 0.312 0.04 32 Click to see details
PAAD 0.854 0.07 0.800 0.1 4 Click to see details
PRAD -0.161 0.13 -0.049 0.37 50 Click to see details
PCPG -0.914 0.13 -0.500 0.33 3 Click to see details
KICH -0.22 0.15 -0.265 0.1 25 Click to see details
ESCA -0.342 0.15 -0.318 0.17 11 Click to see details
COAD -0.345 0.2 -0.690 0.03 8 Click to see details
LUSC -0.134 0.21 -0.156 0.17 38 Click to see details
BLCA -0.187 0.23 -0.226 0.18 18 Click to see details
CHOL 0.266 0.24 0.167 0.33 9 Click to see details
KIRC -0.081 0.26 -0.167 0.09 68 Click to see details
HNSC -0.083 0.3 0.028 0.43 42 Click to see details
THCA 0.059 0.33 0.041 0.38 59 Click to see details
LUAD 0.132 0.34 0.091 0.39 12 Click to see details
UCEC 0.096 0.35 0.151 0.27 19 Click to see details
CESC 0.387 0.37 0.500 0.33 3 Click to see details
LIHC 0.027 0.43 0.054 0.36 49 Click to see details
BRCA -0.011 0.46 -0.016 0.44 84 Click to see details
BRCA -0.011 0.46 -0.016 0.44 84 Click to see details
BRCA -0.011 0.46 -0.016 0.44 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1