miRTarBase - #MIRT051312 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACVR1B   
Synonyms ACTRIB, ACVRLK4, ALK4, SKR2
Description activin A receptor type 1B
Transcript NM_004302   
Other Transcripts NM_020327 , NM_020328   
Expression
Putative miRNA Targets on ACVR1B
3'UTR of ACVR1B
(miRNA target sites are highlighted)
>ACVR1B|NM_004302|3'UTR
   1 CTGCTCCCTCTCTCCACACGGAGCTCCTGGCAGCGAGAACTACGCACAGCTGCCGCGTTGAGCGTACGATGGAGGCCTAC
  81 CTCTCGTTTCTGCCCAGCCCTCTGTGGCCAGGAGCCCTGGCCCGCAAGAGGGACAGAGCCCGGGAGAGACTCGCTCACTC
 161 CCATGTTGGGTTTGAGACAGACACCTTTTCTATTTACCTCCTAATGGCATGGAGACTCTGAGAGCGAATTGTGTGGAGAA
 241 CTCAGTGCCACACCTCGAACTGGTTGTAGTGGGAAGTCCCGCGAAACCCGGTGCATCTGGCACGTGGCCAGGAGCCATGA
 321 CAGGGGCGCTTGGGAGGGGCCGGAGGAACCGAGGTGTTGCCAGTGCTAAGCTGCCCTGAGGGTTTCCTTCGGGGACCAGC
 401 CCACAGCACACCAAGGTGGCCCGGAAGAACCAGAAGTGCAGCCCCTCTCACAGGCAGCTCTGAGCCGCGCTTTCCCCTCC
 481 TCCCTGGGATGGACGCTGCCGGGAGACTGCCAGTGGAGACGGAATCTGCCGCTTTGTCTGTCCAGCCGTGTGTGCATGTG
 561 CCGAGGTGCGTCCCCCGTTGTGCCTGGTTCGTGCCATGCCCTTACACGTGCGTGTGAGTGTGTGTGTGTGTCTGTAGGTG
 641 CGCACTTACCTGCTTGAGCTTTCTGTGCATGTGCAGGTCGGGGGTGTGGTCGTCATGCTGTCCGTGCTTGCTGGTGCCTC
 721 TTTTCAGTAGTGAGCAGCATCTAGTTTCCCTGGTGCCCTTCCCTGGAGGTCTCTCCCTCCCCCAGAGCCCCTCATGCCAC
 801 AGTGGTACTCTGTGTCTGGCAGGCTACTCTGCCCACCCCAGCATCAGCACAGCTCTCCTCCTCCATCTCAGACTGTGGAA
 881 CCAAAGCTGGCCCAGTTGTCCATGACAAAAGAGGCTTTTGGGCCAAAATGTGAGGGTGGTGGGTGGGATGGGCAGGGAAG
 961 GAATCCTGGTGGAAGTCTTGGGTGTTAGTGTCAGCCATGGGAAATGAGCCAGCCCAAGGGCATCATCCTCAGCAGCATCG
1041 AGGAAGGGCCGAGGAATGTGAAGCCAGATCTCGGGACTCAGATTGGAATGTTACATCTGTCTTTCATCTCCCAGATCCTG
1121 GAAACAGCAGTGTATATTTTTGGTGGTGGTGGGTTTGGGGTGGGGAAGGGAAGGGCGGGCAAGGAGTGGGGAGGGAGTCT
1201 GGGGTGGGAGGGAGGCATCTGCATGGGTCTTCTTTTACTGGACTGTCTGATCAGGGTGGAGGGAAGGTGAGAGGTTTGCA
1281 TCCACTTCAGGAGCCCTACTGAAGGGAACAGCCTGAGCCGAACATGTTATTTAACCTGAGTATAGTATTTAACGAAGCCT
1361 AGAAGCACGGCTGTGGGTGGTGATTTGGTCAGCATATCTTAGGTATATAATAACTTTGAAGCCATAACTTTTAACTGGAG
1441 TGGTTTGATTTCTTTTTTTAATTTTATTGGGAGGGTTTGGATTTTAACTTTTTTTAATGTTGTTAAATATTAAGTTTTTG
1521 TAAAAGGAAAACCATCTCTGTGATTACCTCTCAATCTATTTGTTTTTAAAGAAATCCCTAAAAAAAAAAATTATCCAATT
1601 GAACGCACATAGCTCAATCACACTGGAAATGTTTGTCCTTGCACCTGAGCCTGTTCCCACTCAGCAGTGAGAGTTCCTCT
1681 TTGCCCTGAGGCTCAGTCTCTCTCGTATTTTGTCCCCACCCCCAATTCCTTGAGTGGTTTTTGCTCTAGGGCCCTTTCTT
1761 GCACTGTCCAGCTGGTTGTACCCTCTCCAGGCATTTATTCAACAAATGTGGGTGAAGTGCCTGCTGGGTGCCAGGTGCTG
1841 GGAATACATCTGTGGACAAGACATGCTTGGGTCCTACTCCTGGAGCACTGTAAAAAGAGCTGATTCAAGTAAGTAGATGC
1921 CTGTTTTGAGACCAGAAGGTTTCATAATTGGTTCTACGACCCTTTTGAGCCTAGAATTATTGTTCTTATATAAGATCACT
2001 GAAGAAAGAGGAACCCCCACAACCCCCTCCACAAAGAGACCAGGGGCGGGTGATGAGACCTGGGGTTTAGAACCCCAGGT
2081 GAGACCTCAAATCACTGCATTCATTCTGAGCCCCCTTCCTGTCCCCAGGGGAGGTGTATTGTGTATGTAGCCTTAGAGCA
2161 TCTCTGCCTCCAACCCAGCAGTTCTCTGCCAAAGCTTGTGGAGGAGGGAGAGCCCTGTCCCTGCCCTCAGGCTCCCCAGT
2241 GCTCCTGGCCCTTCTATTTATTTGACTGATTATTGCTTCTTTCCTTGCATTAAAGGAGATCTTCCCCTAACCTTTGGGCC
2321 AATTTACTGGCCACTAATTTCGTTTAAATACCATTGTGTCATTGGGGGGACCGTCTTTACCCCTGCTGACCTCCCACCTA
2401 TCCGCCCTGCAGCAGAACCTTGGCGGTTTATAGGTAATGATGGAACTTAGACTCCTCTTCCCAGAGTCACAAGTAGCCTC
2481 TGGGATCTGCCAACACACGTCCACTCCCAAGCCACTAGCCCACTCCCCAGTTGGCCCTTCTGCCCTTACCCCACACACAG
2561 TCCAACTCTTCCACCTCTGGGGAAGATGGAGCAGGTCTTTGGGAAGCTCCCACACCCACCTCTGCCACTCTTAACACTAA
2641 GTGAGAGTTGGGGAGAAACTGAAGCCGTGTTTTTGGCCCCCCGAGGCTAACCCTGATCCATAGTGCTACCTGCACCTCTG
2721 GATTCTGGATTCACAGACCAAGTCCAAGCCCGTTCTTACGTCGCCATAAAGGCCCCCGAACGGCATTCTCGGTACTTCTG
2801 TTTGTTTTTGTACATTTTATTAGAAAGGACTGTAAAATAGCCACTTAGACACTTTACCTCTTCAGTATGCAAATGTAAAT
2881 AAATTGTAATATAGGAAATCTTTTGTTTTAATATAAGAATGAGCCTGTCCAATTTCTGCTGTACATTATTAAAAGTTTTA
2961 TTCACAGAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGG-UAAUACACGACGAu 5'
              :||: ||||| |||| || 
Target 5' atttGACTGATTAT-TGCTTCTt 3'
2260 - 2281 129.00 -6.80
2
miRNA  3' guGUUUG---GUAAUACAC-GACGAu 5'
            ||||:    :| | ||| ||||| 
Target 5' aaCAAATGTGGGTGAAGTGCCTGCTg 3'
1801 - 1826 124.00 -10.56
3
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             :||||:  | |||:|||  
Target 5' gagGAACCG--AGGTGTTGCca 3'
343 - 362 123.00 -14.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM8996639 1 COSMIC
COSN17387932 6 COSMIC
COSN30104468 7 COSMIC
COSN30458210 8 COSMIC
COSN26965016 21 COSMIC
COSN24312834 22 COSMIC
COSN26965012 29 COSMIC
COSN31506014 34 COSMIC
COSN30110783 44 COSMIC
COSN13401439 45 COSMIC
COSN30107838 50 COSMIC
COSN30478783 55 COSMIC
COSN20041952 58 COSMIC
COSN26965014 64 COSMIC
COSN30134243 67 COSMIC
COSN30110569 68 COSMIC
COSN31593312 76 COSMIC
COSN31518758 120 COSMIC
COSN30535219 135 COSMIC
COSN25266460 254 COSMIC
COSN31595631 258 COSMIC
COSN29314018 279 COSMIC
COSN31607688 305 COSMIC
COSN7373564 370 COSMIC
COSN26576572 393 COSMIC
COSN31531445 454 COSMIC
COSN26576842 468 COSMIC
COSN1149167 530 COSMIC
COSN20109580 618 COSMIC
COSN29725449 631 COSMIC
COSN28260352 756 COSMIC
COSN30159399 934 COSMIC
COSN26633862 998 COSMIC
COSN16997285 1068 COSMIC
COSN32070985 1199 COSMIC
COSN32071835 1200 COSMIC
COSN26342908 1281 COSMIC
COSN28716293 1368 COSMIC
COSN5323909 1421 COSMIC
COSN19663552 1460 COSMIC
COSN29463386 1470 COSMIC
COSN20109581 1591 COSMIC
COSN30539300 1602 COSMIC
COSN26566319 1706 COSMIC
COSN30539292 1733 COSMIC
COSN31522202 1834 COSMIC
COSN22583367 1874 COSMIC
COSN1576077 1924 COSMIC
COSN31484629 2211 COSMIC
COSN26507658 2249 COSMIC
COSN28795156 2681 COSMIC
COSN31592648 2709 COSMIC
COSN26603572 2779 COSMIC
COSN20092574 2783 COSMIC
COSN26633526 2793 COSMIC
COSN30539284 2801 COSMIC
COSN30539294 2895 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1447924392 6 dbSNP
rs747117488 7 dbSNP
rs771391622 9 dbSNP
rs777163939 11 dbSNP
rs1419438971 15 dbSNP
rs771113125 16 dbSNP
rs1332526838 18 dbSNP
rs554675689 20 dbSNP
rs759798095 21 dbSNP
rs770254158 25 dbSNP
rs775002160 26 dbSNP
rs768456229 28 dbSNP
rs1296493115 29 dbSNP
rs1230139446 31 dbSNP
rs1310611579 33 dbSNP
rs762607630 35 dbSNP
rs763673866 36 dbSNP
rs1276175565 37 dbSNP
rs1441793006 38 dbSNP
rs922698808 39 dbSNP
rs751074293 44 dbSNP
rs761448708 45 dbSNP
rs767536009 49 dbSNP
rs374207385 50 dbSNP
rs1325284457 55 dbSNP
rs1042612134 58 dbSNP
rs1384417623 59 dbSNP
rs911763049 61 dbSNP
rs944774994 64 dbSNP
rs117590601 65 dbSNP
rs900472761 68 dbSNP
rs994846237 69 dbSNP
rs1296363750 76 dbSNP
rs1258058659 79 dbSNP
rs1049303263 80 dbSNP
rs886688170 86 dbSNP
rs1005169530 87 dbSNP
rs939109979 88 dbSNP
rs571355915 94 dbSNP
rs1270896146 96 dbSNP
rs892302728 99 dbSNP
rs576547999 101 dbSNP
rs1003679016 102 dbSNP
rs1429301734 103 dbSNP
rs2641529 109 dbSNP
rs1325898863 110 dbSNP
rs1022162206 115 dbSNP
rs556901003 116 dbSNP
rs768213198 117 dbSNP
rs1476990203 124 dbSNP
rs1392486080 133 dbSNP
rs367752259 142 dbSNP
rs989111267 143 dbSNP
rs866100961 144 dbSNP
rs1460726077 146 dbSNP
rs371160781 153 dbSNP
rs966591158 154 dbSNP
rs1164910825 157 dbSNP
rs1030097522 160 dbSNP
rs746106939 164 dbSNP
rs911696979 182 dbSNP
rs536725405 185 dbSNP
rs975198174 188 dbSNP
rs552923431 193 dbSNP
rs930753944 201 dbSNP
rs761540438 210 dbSNP
rs1335877341 219 dbSNP
rs1292518080 222 dbSNP
rs886465806 226 dbSNP
rs572984682 227 dbSNP
rs112670198 231 dbSNP
rs142051576 235 dbSNP
rs747373867 237 dbSNP
rs907337486 238 dbSNP
rs980435075 239 dbSNP
rs1325461565 241 dbSNP
rs1441985779 243 dbSNP
rs372651451 246 dbSNP
rs1216127265 247 dbSNP
rs1325239719 250 dbSNP
rs140847018 257 dbSNP
rs575567583 258 dbSNP
rs1392771856 262 dbSNP
rs1358666755 263 dbSNP
rs1223287291 266 dbSNP
rs1468610678 268 dbSNP
rs894897872 281 dbSNP
rs187097896 282 dbSNP
rs560840449 283 dbSNP
rs1345787962 284 dbSNP
rs1021904051 290 dbSNP
rs529779440 291 dbSNP
rs978391424 295 dbSNP
rs1018869949 302 dbSNP
rs543738672 304 dbSNP
rs966230848 305 dbSNP
rs1161860110 308 dbSNP
rs891116074 316 dbSNP
rs1373591259 322 dbSNP
rs1431591529 322 dbSNP
rs539244444 322 dbSNP
rs1433278368 323 dbSNP
rs116085211 328 dbSNP
rs1175189885 332 dbSNP
rs368256797 341 dbSNP
rs1469935556 342 dbSNP
rs1253050666 343 dbSNP
rs1207886824 344 dbSNP
rs962809810 351 dbSNP
rs974213567 352 dbSNP
rs1211620505 353 dbSNP
rs1314084290 357 dbSNP
rs1282405894 359 dbSNP
rs1366972037 362 dbSNP
rs921795750 363 dbSNP
rs1417472805 366 dbSNP
rs1372300161 368 dbSNP
rs1288704350 376 dbSNP
rs1023151736 377 dbSNP
rs970300740 379 dbSNP
rs982103688 383 dbSNP
rs1466101537 389 dbSNP
rs559739264 391 dbSNP
rs1432574182 392 dbSNP
rs1282258385 393 dbSNP
rs928943146 399 dbSNP
rs753819486 401 dbSNP
rs1399795542 410 dbSNP
rs939008675 412 dbSNP
rs1184731198 413 dbSNP
rs1474440336 415 dbSNP
rs987796718 416 dbSNP
rs1183009040 417 dbSNP
rs754938248 423 dbSNP
rs907850761 424 dbSNP
rs940713163 445 dbSNP
rs1215190919 448 dbSNP
rs796615390 448 dbSNP
rs1330031925 450 dbSNP
rs764222114 456 dbSNP
rs1046372640 458 dbSNP
rs907456745 461 dbSNP
rs1229930777 465 dbSNP
rs751688943 467 dbSNP
rs528685035 468 dbSNP
rs551637947 469 dbSNP
rs946489846 470 dbSNP
rs1286573298 481 dbSNP
rs1212269841 483 dbSNP
rs1285167191 485 dbSNP
rs1043514379 487 dbSNP
rs1185842091 490 dbSNP
rs921097471 494 dbSNP
rs1242963121 495 dbSNP
rs1426029346 496 dbSNP
rs893334583 499 dbSNP
rs932537747 501 dbSNP
rs1010594235 502 dbSNP
rs1465403517 503 dbSNP
rs891072646 505 dbSNP
rs1250128260 507 dbSNP
rs1212120220 511 dbSNP
rs1445760465 512 dbSNP
rs1022019829 514 dbSNP
rs902152601 519 dbSNP
rs1245284637 521 dbSNP
rs1379020250 522 dbSNP
rs1293371607 523 dbSNP
rs999201783 531 dbSNP
rs1019065639 532 dbSNP
rs995598009 535 dbSNP
rs571618446 537 dbSNP
rs975092715 539 dbSNP
rs1028810049 548 dbSNP
rs1294433112 549 dbSNP
rs1385194135 554 dbSNP
rs1459780755 556 dbSNP
rs1371778774 557 dbSNP
rs147606273 558 dbSNP
rs1450151365 563 dbSNP
rs191146993 564 dbSNP
rs1405152762 567 dbSNP
rs768644044 568 dbSNP
rs1191953476 569 dbSNP
rs1468173498 570 dbSNP
rs1268349881 571 dbSNP
rs866045360 576 dbSNP
rs140531594 577 dbSNP
rs532331827 578 dbSNP
rs1374612453 584 dbSNP
rs962316828 585 dbSNP
rs1204404043 587 dbSNP
rs1036340980 589 dbSNP
rs981466511 591 dbSNP
rs1238356572 592 dbSNP
rs928663520 598 dbSNP
rs1330087713 605 dbSNP
rs1280264675 606 dbSNP
rs937596054 608 dbSNP
rs879717619 609 dbSNP
rs1298084950 610 dbSNP
rs182770711 612 dbSNP
rs967739177 612 dbSNP
rs947571334 613 dbSNP
rs1453889035 614 dbSNP
rs780305832 614 dbSNP
rs140145955 618 dbSNP
rs749342386 618 dbSNP
rs757109100 618 dbSNP
rs921053920 618 dbSNP
rs932462410 618 dbSNP
rs1043415986 620 dbSNP
rs553429265 627 dbSNP
rs1276701932 639 dbSNP
rs999716502 642 dbSNP
rs1256210126 643 dbSNP
rs1040026181 671 dbSNP
rs1462003198 672 dbSNP
rs1205976273 673 dbSNP
rs1235020873 677 dbSNP
rs142195918 680 dbSNP
rs1288073477 681 dbSNP
rs996068891 683 dbSNP
rs1236847452 685 dbSNP
rs912444406 686 dbSNP
rs1028926181 690 dbSNP
rs951824234 700 dbSNP
rs939931746 701 dbSNP
rs151225207 703 dbSNP
rs1434183573 704 dbSNP
rs1403079043 705 dbSNP
rs1014806669 711 dbSNP
rs962146812 720 dbSNP
rs1044867006 721 dbSNP
rs981962803 723 dbSNP
rs558749022 726 dbSNP
rs1035882983 727 dbSNP
rs575632901 728 dbSNP
rs1256297720 733 dbSNP
rs1201707720 737 dbSNP
rs1267119381 738 dbSNP
rs1229326514 755 dbSNP
rs761356852 759 dbSNP
rs1010454855 764 dbSNP
rs1021869785 769 dbSNP
rs756514606 780 dbSNP
rs544497523 782 dbSNP
rs764688093 784 dbSNP
rs1336191069 785 dbSNP
rs1380614928 790 dbSNP
rs772731383 802 dbSNP
rs1388093382 803 dbSNP
rs1160265590 804 dbSNP
rs1457559287 806 dbSNP
rs914827830 808 dbSNP
rs979093800 811 dbSNP
rs947679505 817 dbSNP
rs1472403525 831 dbSNP
rs1369010132 832 dbSNP
rs1188953896 839 dbSNP
rs560901399 841 dbSNP
rs920992857 851 dbSNP
rs1209035290 855 dbSNP
rs953837920 856 dbSNP
rs1228126801 858 dbSNP
rs574365023 864 dbSNP
rs935074374 866 dbSNP
rs1225326901 870 dbSNP
rs1364617526 881 dbSNP
rs1040544106 883 dbSNP
rs901479355 890 dbSNP
rs1437597146 895 dbSNP
rs780355069 898 dbSNP
rs1050297238 903 dbSNP
rs540004129 907 dbSNP
rs1006178551 909 dbSNP
rs1404566921 916 dbSNP
rs1414356605 917 dbSNP
rs1337673263 934 dbSNP
rs1231182782 935 dbSNP
rs919875798 945 dbSNP
rs762528963 952 dbSNP
rs1282814833 959 dbSNP
rs765992029 960 dbSNP
rs1188773295 966 dbSNP
rs962210088 973 dbSNP
rs1254402597 980 dbSNP
rs1225684840 981 dbSNP
rs2854464 998 dbSNP
rs1480587175 1000 dbSNP
rs1036198510 1004 dbSNP
rs905921092 1009 dbSNP
rs1196941297 1018 dbSNP
rs1194636628 1019 dbSNP
rs1341508709 1020 dbSNP
rs1253299374 1024 dbSNP
rs1438974665 1025 dbSNP
rs958700443 1028 dbSNP
rs1298371996 1032 dbSNP
rs140080208 1036 dbSNP
rs1267672386 1041 dbSNP
rs1057475683 1051 dbSNP
rs1435496594 1052 dbSNP
rs1178287035 1064 dbSNP
rs891969659 1068 dbSNP
rs372932639 1073 dbSNP
rs1010392716 1074 dbSNP
rs1021817002 1076 dbSNP
rs1461410889 1077 dbSNP
rs150310204 1089 dbSNP
rs1190327503 1091 dbSNP
rs1478547412 1100 dbSNP
rs532902360 1109 dbSNP
rs1180146695 1123 dbSNP
rs531140203 1132 dbSNP
rs550849512 1136 dbSNP
rs1302660124 1141 dbSNP
rs1000914474 1146 dbSNP
rs924778329 1149 dbSNP
rs1345903502 1150 dbSNP
rs1028001406 1157 dbSNP
rs1407061713 1161 dbSNP
rs1220085449 1162 dbSNP
rs953893090 1163 dbSNP
rs1276356366 1166 dbSNP
rs567600189 1171 dbSNP
rs1349721104 1180 dbSNP
rs1307217506 1183 dbSNP
rs1295715049 1186 dbSNP
rs900181081 1188 dbSNP
rs146448253 1189 dbSNP
rs995834030 1193 dbSNP
rs1267606729 1197 dbSNP
rs1490410285 1201 dbSNP
rs1201209647 1205 dbSNP
rs1259250957 1206 dbSNP
rs1427637527 1210 dbSNP
rs1426854555 1219 dbSNP
rs1157322755 1225 dbSNP
rs1019822547 1226 dbSNP
rs1374680689 1232 dbSNP
rs562506254 1233 dbSNP
rs1253162490 1234 dbSNP
rs1422725256 1241 dbSNP
rs1185050204 1246 dbSNP
rs975821674 1249 dbSNP
rs1482306460 1250 dbSNP
rs961192400 1252 dbSNP
rs923014576 1257 dbSNP
rs1163000237 1258 dbSNP
rs931760201 1262 dbSNP
rs1314101327 1270 dbSNP
rs1282425093 1274 dbSNP
rs1264061952 1275 dbSNP
rs1226339647 1294 dbSNP
rs1050081962 1297 dbSNP
rs1328286708 1299 dbSNP
rs764746940 1301 dbSNP
rs887473142 1309 dbSNP
rs1411625088 1310 dbSNP
rs1376924336 1313 dbSNP
rs1301699738 1319 dbSNP
rs1425492892 1320 dbSNP
rs941910729 1321 dbSNP
rs1296504058 1325 dbSNP
rs931238229 1330 dbSNP
rs1383078500 1333 dbSNP
rs1413225363 1349 dbSNP
rs1298250940 1354 dbSNP
rs1161968540 1355 dbSNP
rs867872931 1362 dbSNP
rs1422544169 1366 dbSNP
rs1036707446 1369 dbSNP
rs897630125 1378 dbSNP
rs2714 1391 dbSNP
rs938727933 1397 dbSNP
rs1208398325 1398 dbSNP
rs566971087 1404 dbSNP
rs1268482952 1405 dbSNP
rs1230027103 1406 dbSNP
rs1057207374 1414 dbSNP
rs1035566834 1417 dbSNP
rs538732203 1419 dbSNP
rs1228391924 1429 dbSNP
rs1380785083 1429 dbSNP
rs1359466210 1436 dbSNP
rs946198694 1445 dbSNP
rs1433961553 1449 dbSNP
rs1043223225 1450 dbSNP
rs1349802037 1462 dbSNP
rs1012982399 1468 dbSNP
rs1166180599 1472 dbSNP
rs1021562610 1474 dbSNP
rs1388440502 1478 dbSNP
rs1188039430 1494 dbSNP
rs1450271110 1496 dbSNP
rs1250149324 1501 dbSNP
rs1206606253 1515 dbSNP
rs1224078120 1516 dbSNP
rs904754606 1518 dbSNP
rs1222280153 1527 dbSNP
rs773015483 1533 dbSNP
rs1485354808 1534 dbSNP
rs1294721704 1537 dbSNP
rs996449268 1540 dbSNP
rs1365405006 1549 dbSNP
rs977671174 1555 dbSNP
rs1367400874 1563 dbSNP
rs1294597658 1579 dbSNP
rs397947585 1580 dbSNP
rs58658295 1580 dbSNP
rs879205074 1580 dbSNP
rs889456720 1581 dbSNP
rs1392242042 1583 dbSNP
rs1008343592 1585 dbSNP
rs542978756 1588 dbSNP
rs1263638126 1599 dbSNP
rs961141112 1604 dbSNP
rs1191577644 1605 dbSNP
rs1490807803 1606 dbSNP
rs1272390184 1610 dbSNP
rs1442681424 1614 dbSNP
rs1032345615 1616 dbSNP
rs1342344982 1616 dbSNP
rs1230672295 1618 dbSNP
rs140942303 1620 dbSNP
rs965533643 1630 dbSNP
rs1026834729 1638 dbSNP
rs1349110398 1646 dbSNP
rs952705175 1647 dbSNP
rs1385788308 1652 dbSNP
rs1372530621 1668 dbSNP
rs980048258 1677 dbSNP
rs1157038642 1680 dbSNP
rs977323630 1686 dbSNP
rs1378457379 1694 dbSNP
rs921478906 1701 dbSNP
rs1176431399 1705 dbSNP
rs79245486 1706 dbSNP
rs1454538726 1708 dbSNP
rs372388093 1714 dbSNP
rs908854626 1722 dbSNP
rs1251990787 1726 dbSNP
rs569056861 1727 dbSNP
rs941690633 1730 dbSNP
rs1036249677 1733 dbSNP
rs1343767256 1745 dbSNP
rs1256240631 1747 dbSNP
rs1225720803 1749 dbSNP
rs374698697 1750 dbSNP
rs1452389964 1752 dbSNP
rs1316267217 1754 dbSNP
rs1385665967 1758 dbSNP
rs913294046 1759 dbSNP
rs946146457 1759 dbSNP
rs1043170668 1763 dbSNP
rs1395527418 1764 dbSNP
rs926125039 1767 dbSNP
rs56228628 1769 dbSNP
rs1304885146 1772 dbSNP
rs1315934106 1800 dbSNP
rs1409548948 1808 dbSNP
rs1158180549 1809 dbSNP
rs1472855502 1810 dbSNP
rs1365470718 1815 dbSNP
rs1050691886 1818 dbSNP
rs1239387537 1822 dbSNP
rs187695305 1824 dbSNP
rs1256415891 1855 dbSNP
rs548125524 1859 dbSNP
rs1463806034 1860 dbSNP
rs1202829092 1861 dbSNP
rs894336491 1863 dbSNP
rs554902190 1874 dbSNP
rs1209778963 1877 dbSNP
rs1021674809 1883 dbSNP
rs1353383451 1885 dbSNP
rs904497293 1894 dbSNP
rs1244137270 1914 dbSNP
rs999263399 1918 dbSNP
rs1031709280 1924 dbSNP
rs966008074 1933 dbSNP
rs1388222142 1935 dbSNP
rs1175523144 1939 dbSNP
rs998477590 1940 dbSNP
rs1401090990 1952 dbSNP
rs1161458151 1954 dbSNP
rs1407434340 1958 dbSNP
rs867445121 1959 dbSNP
rs1184923946 1962 dbSNP
rs1447241195 1963 dbSNP
rs1247035594 1971 dbSNP
rs766193204 1974 dbSNP
rs1161482768 1977 dbSNP
rs1449151298 1977 dbSNP
rs1288340225 1986 dbSNP
rs896880968 1990 dbSNP
rs1357705964 1991 dbSNP
rs1293995712 1996 dbSNP
rs1226283950 1997 dbSNP
rs993927334 2016 dbSNP
rs985849804 2019 dbSNP
rs908970957 2020 dbSNP
rs952575432 2026 dbSNP
rs1001800251 2027 dbSNP
rs1328022353 2028 dbSNP
rs778880023 2032 dbSNP
rs1469576475 2036 dbSNP
rs1034249560 2037 dbSNP
rs373159772 2042 dbSNP
rs1366145649 2043 dbSNP
rs1408916433 2044 dbSNP
rs963038109 2048 dbSNP
rs569299257 2049 dbSNP
rs1295945039 2066 dbSNP
rs1371908514 2071 dbSNP
rs745901141 2076 dbSNP
rs1223853041 2085 dbSNP
rs1289787383 2086 dbSNP
rs1245300224 2089 dbSNP
rs1320996198 2094 dbSNP
rs34570151 2100 dbSNP
rs1368523560 2104 dbSNP
rs1263573314 2106 dbSNP
rs967395151 2108 dbSNP
rs1203096788 2111 dbSNP
rs780315005 2112 dbSNP
rs1341629398 2115 dbSNP
rs144690977 2120 dbSNP
rs978812621 2122 dbSNP
rs1272814504 2123 dbSNP
rs374389862 2125 dbSNP
rs1051056875 2126 dbSNP
rs116684033 2128 dbSNP
rs1407444251 2137 dbSNP
rs368524788 2140 dbSNP
rs944967191 2144 dbSNP
rs113737357 2146 dbSNP
rs545475108 2152 dbSNP
rs565176670 2153 dbSNP
rs1179059897 2158 dbSNP
rs896828777 2165 dbSNP
rs1043082371 2168 dbSNP
rs1266982604 2169 dbSNP
rs1293452614 2177 dbSNP
rs193251441 2182 dbSNP
rs1180699704 2201 dbSNP
rs1480262464 2207 dbSNP
rs1252569160 2209 dbSNP
rs1177566660 2220 dbSNP
rs1206751058 2221 dbSNP
rs1440842127 2223 dbSNP
rs1431994243 2228 dbSNP
rs1408582279 2233 dbSNP
rs1170277594 2234 dbSNP
rs904612051 2235 dbSNP
rs1048167293 2250 dbSNP
rs998984640 2252 dbSNP
rs1285078172 2255 dbSNP
rs1226449562 2258 dbSNP
rs1355655034 2263 dbSNP
rs1349832501 2270 dbSNP
rs373409727 2279 dbSNP
rs1442233726 2284 dbSNP
rs1309368466 2285 dbSNP
rs1053518529 2288 dbSNP
rs901199654 2290 dbSNP
rs571640748 2295 dbSNP
rs998823478 2296 dbSNP
rs1357060498 2305 dbSNP
rs1028592994 2310 dbSNP
rs544352501 2324 dbSNP
rs1431965555 2326 dbSNP
rs954162318 2329 dbSNP
rs1005728445 2332 dbSNP
rs1283669629 2333 dbSNP
rs1017154904 2334 dbSNP
rs963444009 2342 dbSNP
rs1212592550 2343 dbSNP
rs138940486 2353 dbSNP
rs1237112494 2361 dbSNP
rs1204588363 2364 dbSNP
rs1014127121 2365 dbSNP
rs1264731792 2365 dbSNP
rs918892435 2366 dbSNP
rs1307691318 2370 dbSNP
rs1224963398 2371 dbSNP
rs959744284 2373 dbSNP
rs768412818 2374 dbSNP
rs530295281 2388 dbSNP
rs948677917 2391 dbSNP
rs549648107 2399 dbSNP
rs1042862107 2401 dbSNP
rs11169974 2403 dbSNP
rs1271320633 2404 dbSNP
rs953606085 2405 dbSNP
rs185587553 2407 dbSNP
rs532688908 2412 dbSNP
rs1474606507 2419 dbSNP
rs552694991 2425 dbSNP
rs769716694 2426 dbSNP
rs1420817068 2430 dbSNP
rs944902633 2433 dbSNP
rs1053228079 2434 dbSNP
rs1413223928 2438 dbSNP
rs972308815 2441 dbSNP
rs1446604572 2448 dbSNP
rs1412169134 2451 dbSNP
rs901141015 2455 dbSNP
rs998207478 2462 dbSNP
rs1217928151 2474 dbSNP
rs1319879803 2476 dbSNP
rs1288477451 2484 dbSNP
rs1246079935 2487 dbSNP
rs1169932790 2494 dbSNP
rs1049967712 2496 dbSNP
rs890040867 2499 dbSNP
rs1005834475 2500 dbSNP
rs11831802 2503 dbSNP
rs1005088581 2504 dbSNP
rs897338203 2506 dbSNP
rs1291117841 2527 dbSNP
rs188880255 2532 dbSNP
rs1026072111 2537 dbSNP
rs554430650 2542 dbSNP
rs1332494422 2551 dbSNP
rs1349819115 2554 dbSNP
rs750647462 2559 dbSNP
rs1269430794 2575 dbSNP
rs1388546843 2587 dbSNP
rs992450697 2592 dbSNP
rs1427679195 2594 dbSNP
rs1262106549 2598 dbSNP
rs1022619345 2602 dbSNP
rs1362538707 2604 dbSNP
rs1487426622 2604 dbSNP
rs756353664 2614 dbSNP
rs969936639 2617 dbSNP
rs762521781 2627 dbSNP
rs1272000823 2631 dbSNP
rs1226295698 2638 dbSNP
rs1312999844 2643 dbSNP
rs1358732102 2647 dbSNP
rs534870855 2660 dbSNP
rs1298102667 2664 dbSNP
rs925755019 2667 dbSNP
rs780449785 2668 dbSNP
rs1367504158 2670 dbSNP
rs754201220 2674 dbSNP
rs1304355066 2677 dbSNP
rs989270473 2679 dbSNP
rs73102793 2681 dbSNP
rs934104600 2683 dbSNP
rs1049751048 2684 dbSNP
rs192248348 2691 dbSNP
rs895635856 2693 dbSNP
rs1014076123 2696 dbSNP
rs778486676 2710 dbSNP
rs1200105825 2714 dbSNP
rs1490689762 2716 dbSNP
rs1248919905 2719 dbSNP
rs766005934 2723 dbSNP
rs1194762086 2727 dbSNP
rs1182222392 2749 dbSNP
rs796375594 2751 dbSNP
rs184028514 2752 dbSNP
rs867425479 2753 dbSNP
rs1443438269 2760 dbSNP
rs1163693944 2761 dbSNP
rs756190967 2763 dbSNP
rs1392407251 2764 dbSNP
rs1000129374 2774 dbSNP
rs1033440556 2778 dbSNP
rs1398891574 2782 dbSNP
rs994349085 2783 dbSNP
rs986627275 2784 dbSNP
rs1019061203 2785 dbSNP
rs576750874 2790 dbSNP
rs972247021 2791 dbSNP
rs919483436 2792 dbSNP
rs930902443 2794 dbSNP
rs761796970 2799 dbSNP
rs895558547 2800 dbSNP
rs1252197166 2804 dbSNP
rs1198423049 2808 dbSNP
rs1013986458 2811 dbSNP
rs1264102815 2814 dbSNP
rs909548527 2815 dbSNP
rs937058220 2820 dbSNP
rs1022569275 2821 dbSNP
rs1239854515 2822 dbSNP
rs774125122 2824 dbSNP
rs969714265 2828 dbSNP
rs188604828 2833 dbSNP
rs1437031548 2839 dbSNP
rs978621185 2840 dbSNP
rs1032936554 2843 dbSNP
rs1337068482 2847 dbSNP
rs1470868829 2851 dbSNP
rs1041546167 2852 dbSNP
rs1157971393 2856 dbSNP
rs1246773232 2859 dbSNP
rs1364979531 2861 dbSNP
rs555842479 2864 dbSNP
rs1443563198 2868 dbSNP
rs1243389235 2883 dbSNP
rs956029878 2885 dbSNP
rs988661400 2890 dbSNP
rs773036891 2891 dbSNP
rs1284143438 2892 dbSNP
rs1206288110 2901 dbSNP
rs1353491057 2903 dbSNP
rs922463593 2908 dbSNP
rs1286067426 2909 dbSNP
rs536339449 2913 dbSNP
rs889105985 2914 dbSNP
rs934043627 2933 dbSNP
rs1007596074 2939 dbSNP
rs1019426172 2942 dbSNP
rs1324522497 2945 dbSNP
rs1317404920 2946 dbSNP
rs1382672961 2948 dbSNP
rs747607302 2953 dbSNP
rs985558850 2969 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUACACGAcgau 5'
             ||::| ||: |||:|    
Target 5' tggAAGTC-TTGGGTGTTagtg 3'
1 - 21
2
miRNA  3' guguUUGGUA----AUACACGacgau 5'
              |:||||     ||| ||     
Target 5' tgtcAGCCATGGGAAATGAGCcag-- 3'
20 - 43
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.617 1.9e-3 -0.741 9.3e-5 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.448 1.2e-2 -0.333 5.2e-2 25 Click to see details
GSE21032 Prostate cancer 0.214 2.6e-2 0.238 1.5e-2 83 Click to see details
GSE21687 Ependynoma primary tumors -0.144 1.3e-1 -0.064 3.1e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.321 1.4e-1 -0.214 2.4e-1 13 Click to see details
GSE28544 Breast cancer -0.226 1.4e-1 -0.589 1.2e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.224 1.5e-1 -0.139 2.6e-1 23 Click to see details
GSE21849 B cell lymphoma 0.19 1.6e-1 0.063 3.7e-1 29 Click to see details
GSE19350 CNS germ cell tumors -0.264 2.0e-1 -0.580 2.4e-2 12 Click to see details
GSE17306 Multiple myeloma 0.113 2.2e-1 0.200 8.4e-2 49 Click to see details
GSE14794 Lymphoblastoid cells 0.081 2.2e-1 0.126 1.2e-1 90 Click to see details
GSE19783 ER- ER- breast cancer 0.08 2.4e-1 0.090 2.2e-1 79 Click to see details
GSE32688 Pancreatic cancer -0.095 3.0e-1 -0.084 3.2e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.103 3.1e-1 0.108 3.0e-1 25 Click to see details
GSE19536 Breast cancer 0.047 3.2e-1 0.032 3.8e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells -0.086 3.4e-1 -0.030 4.4e-1 24 Click to see details
GSE17498 Multiple myeloma -0.042 4.0e-1 -0.059 3.6e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer -0.034 4.4e-1 -0.041 4.3e-1 20 Click to see details
GSE27834 Pluripotent stem cells 0.027 4.6e-1 -0.006 4.9e-1 16 Click to see details
GSE27834 Pluripotent stem cells 0.027 4.6e-1 -0.006 4.9e-1 16 Click to see details
GSE38226 Liver fibrosis 0 5.0e-1 -0.051 4.1e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.535 0 0.518 0 32 Click to see details
LUSC 0.396 0.01 0.354 0.01 38 Click to see details
KIRC -0.256 0.02 -0.273 0.01 68 Click to see details
CHOL -0.693 0.02 -0.567 0.06 9 Click to see details
HNSC -0.293 0.03 -0.246 0.06 42 Click to see details
LUAD 0.434 0.08 0.476 0.06 12 Click to see details
ESCA -0.388 0.12 -0.482 0.07 11 Click to see details
KICH -0.225 0.14 -0.354 0.04 25 Click to see details
KIRP -0.191 0.15 -0.239 0.09 32 Click to see details
BLCA 0.244 0.16 0.148 0.28 18 Click to see details
THCA -0.126 0.17 -0.179 0.09 59 Click to see details
PRAD 0.136 0.17 0.032 0.41 50 Click to see details
PAAD -0.599 0.2 -0.200 0.4 4 Click to see details
LIHC 0.098 0.25 0.041 0.39 49 Click to see details
PCPG -0.576 0.3 -0.500 0.33 3 Click to see details
BRCA -0.054 0.31 -0.063 0.28 84 Click to see details
CESC -0.484 0.34 -0.500 0.33 3 Click to see details
COAD 0.099 0.41 0.595 0.06 8 Click to see details
UCEC 0.011 0.48 0.153 0.27 19 Click to see details
UCEC 0.011 0.48 0.153 0.27 19 Click to see details
UCEC 0.011 0.48 0.153 0.27 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*