miRTarBase - #MIRT023400 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SMURF2   
Synonyms -
Description SMAD specific E3 ubiquitin protein ligase 2
Transcript NM_022739   
Expression
Putative miRNA Targets on SMURF2
3'UTR of SMURF2
(miRNA target sites are highlighted)
>SMURF2|NM_022739|3'UTR
   1 CAAGCTTCAAGGATTTACCCAGGACTCTATTTATACAACCCTGACTGACAGCCTCCTTTCAGCAGAGTTTCAAAGAATAT
  81 GCTGAAATACAGGAAAACACTCCCCCCCCCCCCCTTTTTTTTTTTTTTTTTACATTTTAGGACACTGTGAGGGGAAAGGA
 161 CAATTTTGAAATTCCTTTTCAAGGAAAAAAAAGGTCTTTATGCTTTGCCATGAGGCCACATTCAGCTGCTATTTAAACTT
 241 AATATCTTGAACCTAAAGAATGCTGACTTTTCCTACATTTCCAGAGTTAGGCAGTATTCTACACTTAAAGACTACTACTA
 321 TTTTTATAAAAGGTAATCTATTCAAATTTCTTCACAGATTTCAAGTCTCTCAAACATCAAGACAACTTCAGCAGTCGGTA
 401 CAAGTCACATTTCATTTTGATTGAATACATGATCTTGAACAGCTCCTGTACTTGCTCTTTGTAAAAAAAAATAAAATTAT
 481 TTTGAATTATTCTACCTTTGTAAACAATTGGCTAAAAGAATCATCTTTAAGAAATTAAGCCATTTACATGTTTGTGTTTT
 561 TCTATAGCAGAGCATTATATTTTGCATTATATGTTTCAACCTAGTCTAAGTGGGTCTTTTTTACATTTTTCAAGAACGGA
 641 TTTCCTGGAATACAGCGATATAATTTTGGTTGTCAAATTCCTAATGCAACCATTTAGTCTAAACTTAGTCATTTATTTGT
 721 GACAATAAGATGTGTTCAGGGGCTCCCTGTTTTTAAGAGACTCTTTTAAAAAAAAAAAAACCTAATGTTTTTATCTTGAG
 801 TCAATATGATTAGGTATTTTGGATTTACTTTTAATCTTAAAATACTGCATTTTTATAGCTTCTCAGAGCATGTGGATGGG
 881 ATGGGATTTTCGTTATTTTGCTGGGTCAGCTTATCTTTAATATATGGACTATTCCTATAAACCAAAGTCTCTGACAAGTG
 961 CACCTAATTTATATTGTATTTTAACTACAGTGTAAGTTTCCATTAACAAAACCATCCTAAAGCGTTAACTGCTCATAATT
1041 TTAATCAGCTACAGTTATGAAAAAGGAAGAATTTTGCTCTAAAGATTATTAATAAGCTTAGAAAATCCTGCTTTTACCTA
1121 ACAGAATGAAGTGGGGTTGAGGGGCGGTAGTATGAACAGTGATTCTAACTCTATGGCGTAAATTACTTTGAAGAGTTCAT
1201 TTTGGAAGTAAGGGAATCCCGCTTCCCTTGG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||:| ||     ||||||| 
Target 5' gaAATA-CAGGAAAACACTCCc 3'
84 - 104 143.00 -13.82
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :::|| |  ||||||:|:| 
Target 5' tcGGTACAA--GTCACATTTCa 3'
395 - 414 128.00 -15.60
3
miRNA  3' guUUGUGGU--AACAG--UGUGAGGu 5'
            ||::|::  || ||  |||:|:| 
Target 5' agAATGCTGACTTTTCCTACATTTCc 3'
257 - 282 124.00 -7.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28571251 88 COSMIC
COSN28842179 99 COSMIC
COSN1199841 101 COSMIC
COSN27288329 102 COSMIC
COSN19663702 107 COSMIC
COSN13739840 108 COSMIC
COSN28866699 109 COSMIC
COSN28870206 110 COSMIC
COSN28837062 111 COSMIC
COSN28845904 111 COSMIC
COSN18740161 112 COSMIC
COSN20079059 113 COSMIC
COSN2526090 113 COSMIC
COSN19747357 114 COSMIC
COSN6659580 115 COSMIC
COSN15661886 116 COSMIC
COSN26506890 131 COSMIC
COSN31592039 180 COSMIC
COSN22846114 184 COSMIC
COSN4770089 298 COSMIC
COSN31539687 371 COSMIC
COSN28288067 451 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782539208 1 dbSNP
rs782305703 5 dbSNP
rs372354133 6 dbSNP
rs1301992271 11 dbSNP
rs782123947 12 dbSNP
rs781827893 29 dbSNP
rs782686086 33 dbSNP
rs1343187652 35 dbSNP
rs374703435 37 dbSNP
rs782460309 40 dbSNP
rs371434148 45 dbSNP
rs782804196 47 dbSNP
rs1480264552 52 dbSNP
rs1191708222 55 dbSNP
rs1268767519 60 dbSNP
rs1452066695 63 dbSNP
rs1172520563 65 dbSNP
rs1390381270 68 dbSNP
rs1431313826 72 dbSNP
rs1172988027 75 dbSNP
rs1461874357 98 dbSNP
rs1369764618 99 dbSNP
rs373136752 99 dbSNP
rs3210656 101 dbSNP
rs1302829691 102 dbSNP
rs371337667 102 dbSNP
rs1270539453 103 dbSNP
rs376762501 103 dbSNP
rs1306720092 104 dbSNP
rs575307694 106 dbSNP
rs868922045 107 dbSNP
rs541009938 108 dbSNP
rs11547445 109 dbSNP
rs1389472404 110 dbSNP
rs797039184 110 dbSNP
rs1361576268 111 dbSNP
rs1332585102 112 dbSNP
rs1465882528 113 dbSNP
rs1491212191 114 dbSNP
rs2872314 114 dbSNP
rs1182788650 115 dbSNP
rs1472948255 115 dbSNP
rs1491451912 115 dbSNP
rs532484053 115 dbSNP
rs59188589 115 dbSNP
rs869202695 115 dbSNP
rs879970686 115 dbSNP
rs1316377762 116 dbSNP
rs1344819055 116 dbSNP
rs1491522988 116 dbSNP
rs1314414739 117 dbSNP
rs1353347402 117 dbSNP
rs1211802496 132 dbSNP
rs1232557173 132 dbSNP
rs1288949640 132 dbSNP
rs1331186992 132 dbSNP
rs1442636108 132 dbSNP
rs1259976336 133 dbSNP
rs1187809527 139 dbSNP
rs1484908059 139 dbSNP
rs782368327 150 dbSNP
rs555968913 151 dbSNP
rs1471475111 152 dbSNP
rs539243663 154 dbSNP
rs1407357499 161 dbSNP
rs781949556 176 dbSNP
rs1415201084 185 dbSNP
rs1175786160 186 dbSNP
rs979120354 187 dbSNP
rs1308457090 193 dbSNP
rs1413913551 193 dbSNP
rs570768879 194 dbSNP
rs1440013613 210 dbSNP
rs967772936 212 dbSNP
rs1345125236 220 dbSNP
rs1021142909 235 dbSNP
rs1277785843 265 dbSNP
rs987963292 272 dbSNP
rs1210599707 281 dbSNP
rs1253073458 288 dbSNP
rs1439996470 302 dbSNP
rs955393261 303 dbSNP
rs1180306976 305 dbSNP
rs1232328734 308 dbSNP
rs1478417177 310 dbSNP
rs1195625425 313 dbSNP
rs531561327 318 dbSNP
rs572259546 320 dbSNP
rs1168981692 321 dbSNP
rs1434395472 321 dbSNP
rs1398368373 332 dbSNP
rs1408082573 337 dbSNP
rs1328124325 339 dbSNP
rs1442425586 340 dbSNP
rs1300702312 355 dbSNP
rs34034490 359 dbSNP
rs370211104 364 dbSNP
rs547374105 378 dbSNP
rs899796088 384 dbSNP
rs1341940917 393 dbSNP
rs1194547351 395 dbSNP
rs150557469 397 dbSNP
rs1006194511 399 dbSNP
rs1215617211 402 dbSNP
rs1251288152 410 dbSNP
rs191811428 418 dbSNP
rs548179086 422 dbSNP
rs1374532353 423 dbSNP
rs1474321147 429 dbSNP
rs531459935 430 dbSNP
rs1391336531 432 dbSNP
rs1463010383 441 dbSNP
rs1323229819 445 dbSNP
rs1393118341 447 dbSNP
rs549492455 449 dbSNP
rs896643478 450 dbSNP
rs1435305541 451 dbSNP
rs1297318460 455 dbSNP
rs9906078 458 dbSNP
rs74527211 461 dbSNP
rs76818441 462 dbSNP
rs79804110 463 dbSNP
rs1225668120 468 dbSNP
rs938229984 469 dbSNP
rs1336106749 472 dbSNP
rs777670879 472 dbSNP
rs1271291141 473 dbSNP
rs1468110546 476 dbSNP
rs782350262 480 dbSNP
rs1205902245 491 dbSNP
rs1264087010 494 dbSNP
rs1445545127 506 dbSNP
rs78534786 511 dbSNP
rs1368834688 517 dbSNP
rs1476112751 523 dbSNP
rs1043389694 529 dbSNP
rs1162729981 532 dbSNP
rs1416471504 541 dbSNP
rs782577863 542 dbSNP
rs1457279465 547 dbSNP
rs1290164268 556 dbSNP
rs1382304786 587 dbSNP
rs946389476 588 dbSNP
rs1356523230 591 dbSNP
rs186500739 592 dbSNP
rs988298832 599 dbSNP
rs955192781 603 dbSNP
rs35750148 604 dbSNP
rs1348726367 613 dbSNP
rs1204786023 614 dbSNP
rs1257905073 617 dbSNP
rs1185577716 623 dbSNP
rs1486546559 623 dbSNP
rs782256003 631 dbSNP
rs374936062 637 dbSNP
rs532593357 638 dbSNP
rs975247088 639 dbSNP
rs963912794 656 dbSNP
rs9303474 657 dbSNP
rs1006142215 673 dbSNP
rs952142123 674 dbSNP
rs1416978160 676 dbSNP
rs1311495501 678 dbSNP
rs1355371007 679 dbSNP
rs1392483523 680 dbSNP
rs1309161891 681 dbSNP
rs1334079417 690 dbSNP
rs1238548840 691 dbSNP
rs370443718 705 dbSNP
rs1350382530 706 dbSNP
rs1208441294 715 dbSNP
rs1279421587 716 dbSNP
rs1480882570 720 dbSNP
rs1178895916 723 dbSNP
rs1247749583 725 dbSNP
rs1418036349 729 dbSNP
rs1193765247 740 dbSNP
rs1396488130 742 dbSNP
rs1432544098 746 dbSNP
rs1172158887 761 dbSNP
rs1375236015 761 dbSNP
rs79646218 764 dbSNP
rs1462900796 765 dbSNP
rs57118874 767 dbSNP
rs1304326842 768 dbSNP
rs1371857576 768 dbSNP
rs201996624 768 dbSNP
rs202102759 768 dbSNP
rs1232382955 771 dbSNP
rs1302346341 777 dbSNP
rs1307884721 778 dbSNP
rs1206493906 779 dbSNP
rs1249515533 780 dbSNP
rs1480297212 781 dbSNP
rs544178746 781 dbSNP
rs879961832 781 dbSNP
rs1424848881 783 dbSNP
rs1429449176 800 dbSNP
rs1002392694 804 dbSNP
rs905416487 809 dbSNP
rs1353252950 812 dbSNP
rs1465619098 815 dbSNP
rs1326579805 831 dbSNP
rs1396807593 834 dbSNP
rs369118964 840 dbSNP
rs1325520447 846 dbSNP
rs946364320 847 dbSNP
rs1216087973 855 dbSNP
rs1293250716 864 dbSNP
rs1306843402 867 dbSNP
rs779480970 869 dbSNP
rs1233829392 871 dbSNP
rs1274452058 882 dbSNP
rs1466774985 885 dbSNP
rs1212565976 886 dbSNP
rs575370305 891 dbSNP
rs1052144163 892 dbSNP
rs1188649169 909 dbSNP
rs181170077 912 dbSNP
rs1477749782 913 dbSNP
rs1166319916 923 dbSNP
rs781840618 928 dbSNP
rs1459915144 929 dbSNP
rs546028311 931 dbSNP
rs1346000887 934 dbSNP
rs576969520 939 dbSNP
rs922381350 944 dbSNP
rs1286835972 959 dbSNP
rs1339618946 961 dbSNP
rs1415280822 973 dbSNP
rs975186334 978 dbSNP
rs1295016968 991 dbSNP
rs1332647799 997 dbSNP
rs1232134783 1000 dbSNP
rs1284424131 1023 dbSNP
rs553896239 1024 dbSNP
rs1213226144 1030 dbSNP
rs1240677235 1033 dbSNP
rs909761608 1043 dbSNP
rs1488188462 1044 dbSNP
rs1189148553 1046 dbSNP
rs984439421 1051 dbSNP
rs1474546701 1052 dbSNP
rs1162736301 1054 dbSNP
rs1408814243 1054 dbSNP
rs533863527 1055 dbSNP
rs1402609413 1058 dbSNP
rs782582058 1059 dbSNP
rs1360176112 1069 dbSNP
rs189225656 1070 dbSNP
rs1314554146 1082 dbSNP
rs1353477585 1084 dbSNP
rs112664485 1089 dbSNP
rs755392386 1092 dbSNP
rs1447201768 1099 dbSNP
rs1279569907 1113 dbSNP
rs1374913646 1115 dbSNP
rs559567114 1117 dbSNP
rs1283084041 1134 dbSNP
rs142599609 1141 dbSNP
rs1212028134 1144 dbSNP
rs1282997879 1145 dbSNP
rs1484939129 1153 dbSNP
rs1187477971 1157 dbSNP
rs1233485379 1160 dbSNP
rs1035116650 1177 dbSNP
rs569020203 1178 dbSNP
rs1379903146 1185 dbSNP
rs551989075 1198 dbSNP
rs782811185 1211 dbSNP
rs905363936 1214 dbSNP
rs532350380 1220 dbSNP
rs184910474 1221 dbSNP
rs1329499394 1225 dbSNP
rs1356254169 1227 dbSNP
rs532191478 1239 dbSNP
rs1439371387 1248 dbSNP
rs1043958111 1260 dbSNP
rs1236050394 1262 dbSNP
rs17651039 1276 dbSNP
rs892749806 1284 dbSNP
rs78084623 1285 dbSNP
rs148461963 1289 dbSNP
rs1202519863 1301 dbSNP
rs900895021 1311 dbSNP
rs1454828783 1320 dbSNP
rs181876901 1323 dbSNP
rs1392998813 1324 dbSNP
rs1477559084 1326 dbSNP
rs544243405 1330 dbSNP
rs942490515 1335 dbSNP
rs782093683 1340 dbSNP
rs60864952 1342 dbSNP
rs530813566 1352 dbSNP
rs1330013326 1354 dbSNP
rs1394597943 1357 dbSNP
rs782318678 1368 dbSNP
rs1442588410 1378 dbSNP
rs1323439335 1390 dbSNP
rs1330201934 1392 dbSNP
rs1271205129 1394 dbSNP
rs1257445960 1395 dbSNP
rs929863173 1395 dbSNP
rs797040345 1397 dbSNP
rs1251356106 1404 dbSNP
rs1468986992 1404 dbSNP
rs3840064 1404 dbSNP
rs796195884 1404 dbSNP
rs782142653 1406 dbSNP
rs1451310722 1417 dbSNP
rs1193631548 1425 dbSNP
rs1374589687 1435 dbSNP
rs1474353811 1436 dbSNP
rs782548712 1439 dbSNP
rs1417901745 1442 dbSNP
rs1462538131 1443 dbSNP
rs1162242016 1445 dbSNP
rs781995759 1446 dbSNP
rs1382440071 1448 dbSNP
rs918528810 1454 dbSNP
rs972445599 1461 dbSNP
rs1398648118 1462 dbSNP
rs1278086015 1487 dbSNP
rs565238489 1490 dbSNP
rs960706156 1505 dbSNP
rs1336177310 1524 dbSNP
rs545182462 1526 dbSNP
rs782400192 1529 dbSNP
rs1263830782 1534 dbSNP
rs189508962 1540 dbSNP
rs111710693 1544 dbSNP
rs1487204860 1557 dbSNP
rs1022874027 1564 dbSNP
rs1192730970 1574 dbSNP
rs1258120392 1576 dbSNP
rs1476184589 1577 dbSNP
rs184669022 1577 dbSNP
rs1367392149 1590 dbSNP
rs892689598 1591 dbSNP
rs1031257714 1593 dbSNP
rs575718051 1594 dbSNP
rs1382372354 1599 dbSNP
rs1418231953 1600 dbSNP
rs1298037981 1627 dbSNP
rs1356659798 1629 dbSNP
rs1417169416 1635 dbSNP
rs1310593694 1643 dbSNP
rs1339968689 1647 dbSNP
rs1239983315 1649 dbSNP
rs900842765 1651 dbSNP
rs564524229 1653 dbSNP
rs1215618819 1663 dbSNP
rs1280788600 1665 dbSNP
rs1039376645 1680 dbSNP
rs574824136 1681 dbSNP
rs1198680694 1683 dbSNP
rs1254814656 1684 dbSNP
rs1419117040 1686 dbSNP
rs1183415859 1688 dbSNP
rs1378087509 1696 dbSNP
rs1438773912 1702 dbSNP
rs782629417 1709 dbSNP
rs888219233 1722 dbSNP
rs560589586 1724 dbSNP
rs143920114 1725 dbSNP
rs538090315 1736 dbSNP
rs1402171975 1744 dbSNP
rs1392022172 1751 dbSNP
rs751112221 1751 dbSNP
rs929839014 1752 dbSNP
rs568878310 1763 dbSNP
rs1374863566 1771 dbSNP
rs1239711229 1772 dbSNP
rs1303806102 1774 dbSNP
rs1349819093 1776 dbSNP
rs1207801099 1777 dbSNP
rs1255315024 1780 dbSNP
rs558492762 1781 dbSNP
rs918465655 1784 dbSNP
rs782636191 1785 dbSNP
rs1457000959 1790 dbSNP
rs992762026 1792 dbSNP
rs938621066 1794 dbSNP
rs1193902498 1796 dbSNP
rs1396027415 1821 dbSNP
rs1435248974 1830 dbSNP
rs1174460402 1835 dbSNP
rs373537265 1837 dbSNP
rs927943426 1843 dbSNP
rs1462947007 1844 dbSNP
rs980799086 1852 dbSNP
rs138287240 1866 dbSNP
rs969444207 1868 dbSNP
rs1022399712 1871 dbSNP
rs1446266211 1893 dbSNP
rs990028257 1894 dbSNP
rs1373526228 1901 dbSNP
rs192969679 1909 dbSNP
rs1217249251 1913 dbSNP
rs1300416308 1917 dbSNP
rs1307940879 1925 dbSNP
rs797023304 1925 dbSNP
rs1255547875 1927 dbSNP
rs1316789912 1951 dbSNP
rs956895444 1960 dbSNP
rs1213817051 1972 dbSNP
rs1487338596 1978 dbSNP
rs1031623347 1997 dbSNP
rs1267123122 2000 dbSNP
rs998383795 2008 dbSNP
rs1173488866 2012 dbSNP
rs1422152230 2018 dbSNP
rs901460465 2029 dbSNP
rs1465146974 2031 dbSNP
rs1165818691 2039 dbSNP
rs1351833652 2041 dbSNP
rs1017876938 2047 dbSNP
rs1292676699 2048 dbSNP
rs1362430546 2050 dbSNP
rs546912552 2050 dbSNP
rs1276191065 2055 dbSNP
rs190148065 2064 dbSNP
rs1233349742 2079 dbSNP
rs565010032 2095 dbSNP
rs555770592 2098 dbSNP
rs371707276 2100 dbSNP
rs1274510400 2102 dbSNP
rs1319490797 2120 dbSNP
rs1220401316 2123 dbSNP
rs1265186447 2137 dbSNP
rs567668462 2140 dbSNP
rs888166647 2144 dbSNP
rs536243058 2145 dbSNP
rs550867642 2146 dbSNP
rs782196226 2164 dbSNP
rs1048151400 2166 dbSNP
rs1188668399 2169 dbSNP
rs1416072753 2182 dbSNP
rs1403770638 2184 dbSNP
rs1164388030 2191 dbSNP
rs782527158 2205 dbSNP
rs184868171 2211 dbSNP
rs896985356 2219 dbSNP
rs1339677363 2220 dbSNP
rs1057392041 2228 dbSNP
rs565155757 2230 dbSNP
rs1294540936 2231 dbSNP
rs927220502 2255 dbSNP
rs1227278836 2269 dbSNP
rs192846602 2276 dbSNP
rs1045065972 2292 dbSNP
rs1318412412 2294 dbSNP
rs948051375 2295 dbSNP
rs915270565 2297 dbSNP
rs1284333850 2298 dbSNP
rs1488218696 2300 dbSNP
rs368296138 2302 dbSNP
rs186826509 2304 dbSNP
rs957039631 2305 dbSNP
rs924118015 2310 dbSNP
rs540478721 2315 dbSNP
rs1471833850 2317 dbSNP
rs1181408164 2322 dbSNP
rs1408968436 2323 dbSNP
rs1441851095 2325 dbSNP
rs1156547508 2330 dbSNP
rs1359686491 2331 dbSNP
rs976911934 2332 dbSNP
rs574687484 2336 dbSNP
rs965575820 2344 dbSNP
rs1357403316 2347 dbSNP
rs1446630065 2348 dbSNP
rs1378568832 2354 dbSNP
rs1018494946 2355 dbSNP
rs1307470827 2366 dbSNP
rs1235533193 2368 dbSNP
rs1353480404 2368 dbSNP
rs561024080 2372 dbSNP
rs1441253656 2373 dbSNP
rs1006477512 2377 dbSNP
rs1209503968 2386 dbSNP
rs1233535408 2388 dbSNP
rs544532406 2393 dbSNP
rs1459219970 2412 dbSNP
rs952415195 2413 dbSNP
rs147469869 2414 dbSNP
rs1454530881 2421 dbSNP
rs1174160052 2425 dbSNP
rs558298187 2426 dbSNP
rs538612999 2428 dbSNP
rs1328883645 2435 dbSNP
rs896926782 2442 dbSNP
rs1444074260 2443 dbSNP
rs1056969511 2444 dbSNP
rs1371342697 2450 dbSNP
rs1437615275 2451 dbSNP
rs35795380 2452 dbSNP
rs572892903 2453 dbSNP
rs1002726731 2460 dbSNP
rs1343409042 2464 dbSNP
rs1219179953 2472 dbSNP
rs1258747238 2473 dbSNP
rs1320052887 2474 dbSNP
rs782552440 2479 dbSNP
rs1469123591 2481 dbSNP
rs1200647523 2487 dbSNP
rs1244776481 2491 dbSNP
rs1477630378 2504 dbSNP
rs1044345355 2505 dbSNP
rs947324051 2507 dbSNP
rs915235598 2510 dbSNP
rs1054224943 2511 dbSNP
rs781858078 2517 dbSNP
rs542311877 2534 dbSNP
rs935409285 2535 dbSNP
rs1329742146 2540 dbSNP
rs200621597 2540 dbSNP
rs1436256022 2551 dbSNP
rs1279363605 2552 dbSNP
rs1342993684 2554 dbSNP
rs1216866203 2557 dbSNP
rs1257506660 2558 dbSNP
rs62073209 2559 dbSNP
rs1357247421 2561 dbSNP
rs1211883087 2562 dbSNP
rs924038336 2562 dbSNP
rs976858653 2563 dbSNP
rs965526159 2571 dbSNP
rs1192220144 2578 dbSNP
rs1193698860 2578 dbSNP
rs1265230828 2578 dbSNP
rs1405123152 2578 dbSNP
rs1476839149 2578 dbSNP
rs199675881 2578 dbSNP
rs376543871 2578 dbSNP
rs1398708465 2579 dbSNP
rs370031707 2579 dbSNP
rs1277588639 2580 dbSNP
rs1341179817 2581 dbSNP
rs1247136035 2582 dbSNP
rs911436061 2583 dbSNP
rs985674475 2591 dbSNP
rs953112592 2599 dbSNP
rs553032641 2601 dbSNP
rs1287904589 2603 dbSNP
rs1487236474 2603 dbSNP
rs1026638415 2604 dbSNP
rs1256823645 2606 dbSNP
rs994264605 2607 dbSNP
rs1425015102 2612 dbSNP
rs763004734 2614 dbSNP
rs961132375 2619 dbSNP
rs1184848736 2620 dbSNP
rs1367526425 2622 dbSNP
rs1470310901 2626 dbSNP
rs1159566076 2632 dbSNP
rs1382575632 2653 dbSNP
rs183610756 2654 dbSNP
rs1418368139 2659 dbSNP
rs1298093974 2661 dbSNP
rs191426621 2662 dbSNP
rs905689709 2681 dbSNP
rs868942798 2685 dbSNP
rs1011477545 2687 dbSNP
rs1340030134 2688 dbSNP
rs188063084 2691 dbSNP
rs1311122879 2697 dbSNP
rs1351189859 2698 dbSNP
rs1239216327 2699 dbSNP
rs1256499067 2700 dbSNP
rs1484230876 2714 dbSNP
rs1198160197 2716 dbSNP
rs1254887256 2727 dbSNP
rs113867341 2728 dbSNP
rs1457893945 2730 dbSNP
rs184003708 2731 dbSNP
rs1180155924 2748 dbSNP
rs1378143259 2759 dbSNP
rs1438199088 2762 dbSNP
rs1158912233 2766 dbSNP
rs1378714795 2772 dbSNP
rs1170838937 2794 dbSNP
rs9898315 2794 dbSNP
rs1401616396 2799 dbSNP
rs1447660970 2802 dbSNP
rs1333589026 2803 dbSNP
rs1375027119 2807 dbSNP
rs1445764575 2812 dbSNP
rs1313823746 2816 dbSNP
rs782437194 2816 dbSNP
rs1231003533 2818 dbSNP
rs935341405 2819 dbSNP
rs1317961574 2820 dbSNP
rs1200038085 2821 dbSNP
rs191709164 2828 dbSNP
rs1268515889 2832 dbSNP
rs188517932 2843 dbSNP
rs1197413745 2844 dbSNP
rs1429258998 2846 dbSNP
rs1041113455 2858 dbSNP
rs1398291265 2884 dbSNP
rs782798869 2884 dbSNP
rs1465313562 2891 dbSNP
rs944166283 2893 dbSNP
rs1369500153 2898 dbSNP
rs1384900040 2902 dbSNP
rs911383211 2906 dbSNP
rs1300479327 2940 dbSNP
rs1341121665 2950 dbSNP
rs1219932597 2953 dbSNP
rs1255613484 2960 dbSNP
rs1221883069 2963 dbSNP
rs1316861935 2963 dbSNP
rs1266365425 2964 dbSNP
rs1489654944 2970 dbSNP
rs183034322 2974 dbSNP
rs1189895810 2975 dbSNP
rs1268789331 2976 dbSNP
rs111245866 2979 dbSNP
rs782110512 2997 dbSNP
rs1421602907 2999 dbSNP
rs985623690 3008 dbSNP
rs931563876 3011 dbSNP
rs538830036 3014 dbSNP
rs1456188069 3016 dbSNP
rs1302388368 3018 dbSNP
rs972399911 3020 dbSNP
rs559439906 3022 dbSNP
rs549508703 3027 dbSNP
rs1401786449 3031 dbSNP
rs1275707543 3032 dbSNP
rs1339316872 3037 dbSNP
rs1228439278 3040 dbSNP
rs578127279 3043 dbSNP
rs1319619850 3045 dbSNP
rs1035402392 3056 dbSNP
rs561086766 3057 dbSNP
rs1488875084 3068 dbSNP
rs1219473849 3072 dbSNP
rs1261703761 3073 dbSNP
rs1485570905 3073 dbSNP
rs1182581314 3085 dbSNP
rs1422289594 3086 dbSNP
rs782700802 3087 dbSNP
rs969821406 3095 dbSNP
rs782056302 3096 dbSNP
rs1344589207 3097 dbSNP
rs1011841176 3102 dbSNP
rs893023481 3106 dbSNP
rs1376443425 3108 dbSNP
rs1032014028 3112 dbSNP
rs759337347 3128 dbSNP
rs1354823126 3131 dbSNP
rs1242828425 3136 dbSNP
rs1284489693 3147 dbSNP
rs1447004511 3160 dbSNP
rs1210826376 3161 dbSNP
rs1239300524 3162 dbSNP
rs999493158 3168 dbSNP
rs373833190 3175 dbSNP
rs544398640 3184 dbSNP
rs1482373842 3186 dbSNP
rs556539315 3189 dbSNP
rs1239062872 3191 dbSNP
rs575485490 3201 dbSNP
rs1441295650 3210 dbSNP
rs189913687 3216 dbSNP
rs1407073136 3219 dbSNP
rs1356961575 3221 dbSNP
rs1414981019 3221 dbSNP
rs1451331036 3224 dbSNP
rs1331581110 3226 dbSNP
rs112228595 3227 dbSNP
rs781879280 3231 dbSNP
rs1449462704 3237 dbSNP
rs544725575 3238 dbSNP
rs889892380 3243 dbSNP
rs1220338809 3252 dbSNP
rs1280781821 3255 dbSNP
rs572802426 3269 dbSNP
rs1203169710 3270 dbSNP
rs1258940117 3272 dbSNP
rs931487884 3277 dbSNP
rs1176482131 3281 dbSNP
rs552513402 3284 dbSNP
rs1232110684 3290 dbSNP
rs1478292060 3295 dbSNP
rs1192817072 3297 dbSNP
rs1423032887 3299 dbSNP
rs1468820028 3313 dbSNP
rs535960546 3318 dbSNP
rs573378129 3322 dbSNP
rs1170854971 3328 dbSNP
rs1401945064 3331 dbSNP
rs1463747339 3333 dbSNP
rs868962203 3335 dbSNP
rs1437684509 3338 dbSNP
rs143294218 3340 dbSNP
rs1277099705 3341 dbSNP
rs940317136 3344 dbSNP
rs928270473 3351 dbSNP
rs1222906842 3355 dbSNP
rs981126701 3356 dbSNP
rs1320203561 3357 dbSNP
rs1194322642 3358 dbSNP
rs1272612157 3360 dbSNP
rs537639020 3367 dbSNP
rs1451944956 3370 dbSNP
rs9916 3383 dbSNP
rs1223566028 3386 dbSNP
rs782100605 3390 dbSNP
rs538570691 3393 dbSNP
rs969770570 3395 dbSNP
rs1193685950 3396 dbSNP
rs1425178125 3399 dbSNP
rs1476613771 3403 dbSNP
rs1166931573 3421 dbSNP
rs1391069663 3429 dbSNP
rs776358293 3432 dbSNP
rs1326027927 3433 dbSNP
rs1364186041 3434 dbSNP
rs140466402 3437 dbSNP
rs1278874584 3440 dbSNP
rs989964866 3442 dbSNP
rs1225398904 3446 dbSNP
rs1269811614 3459 dbSNP
rs1357401921 3460 dbSNP
rs957434974 3464 dbSNP
rs782140595 3466 dbSNP
rs1031542378 3470 dbSNP
rs1289341662 3491 dbSNP
rs185447148 3495 dbSNP
rs1217287548 3500 dbSNP
rs1265300877 3504 dbSNP
rs1487010969 3507 dbSNP
rs372289243 3513 dbSNP
rs868910784 3518 dbSNP
rs1473580812 3522 dbSNP
rs1165311066 3524 dbSNP
rs1383809152 3526 dbSNP
rs1424468334 3527 dbSNP
rs1299320596 3540 dbSNP
rs1363068670 3545 dbSNP
rs180999548 3548 dbSNP
rs1317730157 3554 dbSNP
rs138967961 3555 dbSNP
rs189651598 3556 dbSNP
rs782277520 3561 dbSNP
rs1358425866 3567 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*