miRTarBase - #MIRT023385 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATP7A   
Synonyms DSMAX, MK, MNK, SMAX3
Description ATPase copper transporting alpha
Transcript NM_000052   
Expression
Putative miRNA Targets on ATP7A
3'UTR of ATP7A
(miRNA target sites are highlighted)
>ATP7A|NM_000052|3'UTR
   1 AAGGCCATGGAGAGTGCTGCCAGTTTAACTTGTCATGCACTGACACAGCATTCATGATGTTACCTTCACTTTTCAAAATA
  81 TTGTAGAAGGATTTTTCTCATGCTCTTATATTAGGGATTCTATTTGAGTTGCGTTTATCTGTTGGCAAAAATATCTTTTT
 161 CAAGGCATCAGCTCTGAACCTAGCTTTATTTAAACTGAATTTCCAGTATATTTTTGTTTTCACTAACAACAGATAAGGTA
 241 GAGCAGTGAGGTTTACAACAAGCCCTACAATTAGAGATTGCTGAACTGCTGCTAAAGTGATTTTTTTTTTATTTGACCAA
 321 AAAAAAAAAGGCCCAAGAAGAAGAAAATGAAAAATTTGAAGATTTGAGAGCATGAAGATATTCATGCTTTTGAACTCAAA
 401 ATATTGAAGATACTCTCAAGCCTGTATCCCTGCCCCACTGGGGAGCAATGACTTTCAAAGCACTGTGTATAAAACATCTA
 481 GTTTTAGAAGGGAAACAGTTGAAACTGTTTAAAAATAGATGTGCCTTATTTATTGCAGGCTTTCTTTCCCCCATTCTCCC
 561 TGCATCCTTGTCCTTGCAGGTGCTTTTTTAGATGCTCCAATATGTCTTCTTTTGTTATTTTCTTTCGAGCTAACCAAGTT
 641 TAGGTGGTTTTTCATTGATTAAAAATAACTGACAACTGTTCTAATATTTTGCTCCTTTTTAAATTTTGTAGCTCAAAAGA
 721 CCTTAAAGGTCTGTAGGGTTCCCTGCCTCCCATCTTTCCACTGTTGTAAAAAGTATATCAAATTATTCCTTCAAGTTTCC
 801 TAGCTCTGTGCTCAGTTTCAGTTCACTCCTGCCAAGTTGGACTCTAAGTTATTCTTCATGTAGTCTGCTGATCTCAGTCT
 881 GGAAACTTAACATTATGAGCCTTTTCTGCTCAAAAAATTTTCAAAGATTAAAACTATTATACATATACAGGTCATATAAA
 961 ATTACCTGGATTCACTAAATTTGTTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGAGACAGAGTCTTGTTTTGCAGCC
1041 CAGGCTGGAGTGCAGTGGCACCATCTTGGCTCACTGCAACCTCTGCCTACCGGATTCAAGGAATTCTCCCTGCCTCAGCC
1121 TCCTGAGTAGCTAGGATTACAGGTGCCTGCCACCACACCCGGCTAATTTTCATATTTTTCAGTAGAGACGGGGTTTCGCC
1201 ATGTTGGCTAGCCTGGTCTTAAACTCCTAACCTCAGGTGATCCACCCGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGT
1281 GTGAGCCTCCATGCCCAGCCTAAATTTGTATTTTTTGAATTGAGTATAATCACTTTGCTAGTATATATAATTTAATAGAT
1361 TTTATTTATCTTTTAGTGTTTCAGATAACCTCTCAAAAAGACTTTAAAATAATGCTATTACACAAAGCTGCATTTACCAA
1441 AAAATACAGTAAAATCATAATACAGAAACTAAAATTTCCCTAGGTTATGACGCTTTTTAGCTAAATATATACTCTTCTCT
1521 AGTTTAAAACATTTGAACTTGCCTAGTTAGTGTGGTTGGCAAATTTAGGAGCTTGTTCCCATTGCCAAATGGATTTAGAA
1601 ATTCCCTTGTGAGTGCCTGGTAGCTAATACACTGGTCAGAGATCTGGTACTTGTAAGACTATTTAAATTTCTTTGTTAGT
1681 TGCAAGATGGATTTCATATGCAGAATATGTAAATGAAGAGGACTCATAAGTAAATTCCTAACATTTTGTTCCCATTACCA
1761 GAAGCAAAGCTGCTGCTAACCCAACATCTGGCACATAGGATTTGTACTCGGTAAATGTTAGTTCTTTTCTCCCCTTGAGG
1841 TCAGTAATAAATACAAAAAAATCATTTTTCTAGAGCAGAGTCTTAAAATCAGGTGGGGGTAGGGGATGGAGTTCTTCCTT
1921 TCCTACCCCTTTTCTCTTTTATCCTTTCATATATACACATGCAAAGTTTACAACCTTATTCCATGCTGTCTTTCAGATTT
2001 AGAAAAGATCTAATTTCTGTCTCAGCTGTCTTAAAGAGAGAACTGAAGCTTTTGATGAAGGTGCTATTAATCTAGAAAGG
2081 CAAACCCATTTCACTGAAATATCAATGGGTTTGCATATCTAGGCCCTTTTTTTAGACCAATGCCTATGCCATCCTCCATG
2161 CTTTCAGTTTGAGTTTTATTATTTATTATTTTAATTCCAGTGGCCCATCTTATAATACAACTTGTTTCTTCTAGAAGACA
2241 GAGCTGATAGGGTAAATGTTGAAAAAAGAAGCATGCCTCCTTCTCCCTCCCACCCACCTCAAGCAGTTGAACACAGCCAG
2321 TTATTCTTCCATTATTATGTGTACCTTGGAGTCATCCTCTTGGTCTTGTATTCATATTGTGGGACAGTGGGAATAGCAGC
2401 TTGTAGTATTGAAATAATCAAAGAGATAATTTCAGCTCTTACAACAAGAACAGAAAACATGCTAATTAGAAAAAGTCCTG
2481 CTTTAAGTAATATGTAGCCACATTTGAATCCTCTACCACAAGTCTTTTTTGCAATCTTGAACTTTCATTAGCTTCAAAGA
2561 GAAGCTGTATTTACAGGAGAAAGAGGTGATTATGGAGGGAATCAAAAATACTGCTTTCAGTTAGTAGCTAGCTTTAAGTC
2641 AGGAGTTAGTAATGAGAAATTTTATAAATGTGTATTTCTGTGTATTCACATACATATATATATACACACATATATATGTA
2721 CATACACATACATACATATTACCATACTGAAGGGAAATGGATTTATATTTGAATTTGATATTTGAATATTTGAAGTTCTC
2801 TATTTATATTTCATTTATCACTCTTCTGTATTCACTCAGCAACCATGCCCTTAGTCTGAAGATAACAAGGATACTTTAAT
2881 ATCCAGTGCCGGTTCAGACTCACCTATGTGGCACCTTAAACTTAAATATCCAAAGATGCCTTTTGAATTTCAAAGATTAA
2961 AACACAGCTAGAGTAGTAGTATTGTAGTCTCAAGATGTATGGTGTGTCATTTGTGAAAATAGAAACGTTATTTTTCCTAG
3041 TTTAGTATCAACATTTTAGAATGTCAAATTTGATGCCTTGTGAACAAGTAATTTTATATTGTGCTTTAATTTTTTAAAAA
3121 GTATTCTTTATTCATATGTATAGAATGCTTAAAATAGCACTGTAGACAAGATGTTTCCAAAACTTTAAGTGCGCATATCT
3201 TTTCTGTATACAGCTTAAAATCAAAAATGTATGTTAAGAGAATTTTTTCTATTACTTATGGATCATGCTTTAAAATGATT
3281 TTTCTTGATATTTATTTTACTCCATTTTGTTTTTTTCTCTGGGTGAGGCATCTGGTTACTGGTTATTTTAAAAAGAATAA
3361 AGACATTCCTGGAATCACTCCTTTTGGGTTTTTGTTTGTTTTGTTTCTTTTCTACATTTTTAAGTATTATTTTACAAAAT
3441 AGAAAAAATATAGATTCATGCCAAATTATTACCTATTTTTACACTAACTTTCTGCAGTCCCTCCATCTGGTATGAGTAAC
3521 CAGATAGAGCACAAAGCATGAGTTCTTGTTCTTCAGTTAAAAGAGCTTCTTTCACAGTGTTGATAACAAATGCCTTTTGT
3601 AGCCAAAACCAGGCGTCTCAACCTTACGTTTTTAGTTAAAGAAATGTTTAGCTAAACGTTGTTGAACATTGATTGTTTGG
3681 TACCGAAAACAGCAGTGGACGATGTTGTGCAATATCCATCTACTGTAGTTAAGATATTCAGTAGTTTGTTTTTCATAAGC
3761 ATGTAATTGATCATATTTCTGCCAAGGATGTGCCTTCAACTTTATAATTATAGTGTTGTAAAATAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGG-UAACAGUGUGAggu 5'
            | :||| ||| |:|||||   
Target 5' ttATTACCTATTTTTACACTaac 3'
3466 - 3488 128.00 -10.62
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |  ||    |||:||| 
Target 5' taAAAAGAATAAAGACATTCCt 3'
3349 - 3370 128.00 -8.00
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:| |:: | |:| ||||| 
Target 5' ctAGC-CTGGTCTTAAACTCCt 3'
1208 - 1228 123.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1201711 41 ClinVar
1195484 301 ClinVar
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781830233 24 dbSNP
rs376584633 28 dbSNP
rs782484486 37 dbSNP
rs148698322 41 dbSNP
rs1167780637 48 dbSNP
rs781863371 49 dbSNP
rs782530804 53 dbSNP
rs1461482232 55 dbSNP
rs1412509548 81 dbSNP
rs1161083135 85 dbSNP
rs782331879 106 dbSNP
rs888847599 109 dbSNP
rs1007280542 117 dbSNP
rs1476228153 123 dbSNP
rs1242344559 125 dbSNP
rs1187641955 128 dbSNP
rs183290795 133 dbSNP
rs1214296367 134 dbSNP
rs1322388877 135 dbSNP
rs1289325796 136 dbSNP
rs1226681966 147 dbSNP
rs957661938 148 dbSNP
rs188690370 156 dbSNP
rs1271017876 165 dbSNP
rs782381531 177 dbSNP
rs1228079756 180 dbSNP
rs781857588 193 dbSNP
rs1328494823 198 dbSNP
rs1442360863 204 dbSNP
rs142059968 209 dbSNP
rs1320938618 211 dbSNP
rs782687104 211 dbSNP
rs967543861 230 dbSNP
rs1411168641 231 dbSNP
rs782095034 236 dbSNP
rs1419739249 245 dbSNP
rs982005160 252 dbSNP
rs1167617367 266 dbSNP
rs151132335 268 dbSNP
rs1396719310 271 dbSNP
rs1194180240 285 dbSNP
rs1488077514 289 dbSNP
rs1244919063 301 dbSNP
rs200579535 301 dbSNP
rs1439669392 303 dbSNP
rs1275586517 316 dbSNP
rs1306179705 318 dbSNP
rs1340465383 318 dbSNP
rs1235485865 319 dbSNP
rs200387829 319 dbSNP
rs781799897 319 dbSNP
rs879971048 319 dbSNP
rs782046661 330 dbSNP
rs1307011649 334 dbSNP
rs1427494232 345 dbSNP
rs782807424 356 dbSNP
rs1173966896 362 dbSNP
rs991552492 371 dbSNP
rs781889827 378 dbSNP
rs1422930162 381 dbSNP
rs782666195 394 dbSNP
rs868939297 412 dbSNP
rs1178922494 414 dbSNP
rs193004222 417 dbSNP
rs1471189864 431 dbSNP
rs1252709511 443 dbSNP
rs1204697575 506 dbSNP
rs1482158827 522 dbSNP
rs1282757742 528 dbSNP
rs942005473 530 dbSNP
rs1312017471 535 dbSNP
rs1277092098 540 dbSNP
rs1036322115 541 dbSNP
rs1226035666 543 dbSNP
rs782536057 549 dbSNP
rs1407465654 550 dbSNP
rs933167344 553 dbSNP
rs1052044331 565 dbSNP
rs560014715 571 dbSNP
rs888930297 573 dbSNP
rs184032859 581 dbSNP
rs1053505871 585 dbSNP
rs1313141838 605 dbSNP
rs1465335202 605 dbSNP
rs1357268685 614 dbSNP
rs1161189612 627 dbSNP
rs1401283057 627 dbSNP
rs1411154138 628 dbSNP
rs893507795 639 dbSNP
rs187911855 649 dbSNP
rs1009185665 653 dbSNP
rs1259835929 664 dbSNP
rs1182710849 665 dbSNP
rs1483121177 679 dbSNP
rs1020523629 701 dbSNP
rs967617805 727 dbSNP
rs1218385445 730 dbSNP
rs782183219 734 dbSNP
rs1330350615 738 dbSNP
rs1268075182 739 dbSNP
rs1225995239 742 dbSNP
rs1003104518 775 dbSNP
rs1036272256 778 dbSNP
rs1312963065 784 dbSNP
rs1395157227 790 dbSNP
rs958870496 803 dbSNP
rs782477095 811 dbSNP
rs782619791 824 dbSNP
rs1431217764 827 dbSNP
rs1387757209 830 dbSNP
rs1156897352 841 dbSNP
rs1455688695 843 dbSNP
rs1420183484 844 dbSNP
rs1165745446 845 dbSNP
rs1423395498 849 dbSNP
rs1254348788 860 dbSNP
rs1188600781 880 dbSNP
rs191219027 902 dbSNP
rs909296182 922 dbSNP
rs963393920 929 dbSNP
rs141129604 935 dbSNP
rs782341391 938 dbSNP
rs919229499 944 dbSNP
rs1265590199 951 dbSNP
rs933242551 953 dbSNP
rs1243439406 954 dbSNP
rs1319493395 958 dbSNP
rs1297306708 980 dbSNP
rs1294125457 985 dbSNP
rs1391368056 985 dbSNP
rs1457485010 985 dbSNP
rs781931232 985 dbSNP
rs782032877 985 dbSNP
rs782586832 985 dbSNP
rs1366894466 988 dbSNP
rs1172854489 997 dbSNP
rs1450457568 1008 dbSNP
rs1390012074 1024 dbSNP
rs1187228406 1036 dbSNP
rs1051647723 1040 dbSNP
rs910384215 1050 dbSNP
rs1208676865 1053 dbSNP
rs1487238475 1055 dbSNP
rs943209129 1078 dbSNP
rs527400576 1090 dbSNP
rs782557178 1092 dbSNP
rs1341188154 1095 dbSNP
rs1295044291 1100 dbSNP
rs782646352 1102 dbSNP
rs372906169 1109 dbSNP
rs1300540890 1136 dbSNP
rs782605448 1141 dbSNP
rs1388724731 1157 dbSNP
rs35738515 1161 dbSNP
rs782238439 1161 dbSNP
rs1370194929 1163 dbSNP
rs1167038928 1164 dbSNP
rs1479222119 1172 dbSNP
rs1378679237 1180 dbSNP
rs1009243161 1189 dbSNP
rs373679741 1190 dbSNP
rs1430935285 1191 dbSNP
rs1252127766 1198 dbSNP
rs906171391 1199 dbSNP
rs868985083 1219 dbSNP
rs1003546488 1227 dbSNP
rs1482490544 1243 dbSNP
rs1272064785 1248 dbSNP
rs1035941229 1249 dbSNP
rs1212698972 1262 dbSNP
rs1345497929 1263 dbSNP
rs1255316081 1267 dbSNP
rs1231056688 1268 dbSNP
rs959170758 1271 dbSNP
rs1290223426 1272 dbSNP
rs1410535086 1290 dbSNP
rs1350052706 1296 dbSNP
rs1306435906 1300 dbSNP
rs1416490531 1320 dbSNP
rs1403418092 1322 dbSNP
rs1172498914 1323 dbSNP
rs1464924252 1332 dbSNP
rs1414855865 1333 dbSNP
rs1159196086 1348 dbSNP
rs782356805 1359 dbSNP
rs1471993920 1377 dbSNP
rs1249119000 1390 dbSNP
rs1189685164 1443 dbSNP
rs1442772693 1448 dbSNP
rs1013070173 1463 dbSNP
rs1255297006 1464 dbSNP
rs146949688 1481 dbSNP
rs782027503 1492 dbSNP
rs1229042140 1494 dbSNP
rs1328632699 1508 dbSNP
rs972117739 1512 dbSNP
rs1026319474 1515 dbSNP
rs868960730 1522 dbSNP
rs1341299979 1556 dbSNP
rs1333855759 1559 dbSNP
rs1394676644 1568 dbSNP
rs371941038 1572 dbSNP
rs1160601576 1573 dbSNP
rs987827558 1581 dbSNP
rs910466764 1582 dbSNP
rs1164635233 1589 dbSNP
rs1472886034 1612 dbSNP
rs1367548911 1625 dbSNP
rs943220954 1631 dbSNP
rs1185087505 1649 dbSNP
rs782306079 1658 dbSNP
rs1466112925 1680 dbSNP
rs1248536168 1700 dbSNP
rs1208083391 1708 dbSNP
rs1464490605 1709 dbSNP
rs1266242886 1714 dbSNP
rs1230112820 1723 dbSNP
rs147592491 1734 dbSNP
rs915053566 1735 dbSNP
rs1367854472 1739 dbSNP
rs1321791155 1740 dbSNP
rs1435092646 1745 dbSNP
rs183723408 1750 dbSNP
rs782272461 1790 dbSNP
rs1324888321 1792 dbSNP
rs782333536 1796 dbSNP
rs1042088287 1801 dbSNP
rs1405471736 1811 dbSNP
rs1389520659 1812 dbSNP
rs12010382 1820 dbSNP
rs1451075634 1830 dbSNP
rs781928931 1843 dbSNP
rs1057511036 1850 dbSNP
rs894711677 1851 dbSNP
rs1447519315 1870 dbSNP
rs782406338 1877 dbSNP
rs1013555145 1889 dbSNP
rs1452290653 1894 dbSNP
rs1289398316 1895 dbSNP
rs781988316 1897 dbSNP
rs1344749001 1900 dbSNP
rs1062471 1912 dbSNP
rs1363586109 1928 dbSNP
rs1277155826 1944 dbSNP
rs1062472 1961 dbSNP
rs1348843194 1967 dbSNP
rs1321162806 1974 dbSNP
rs1431323886 1984 dbSNP
rs1026392945 1987 dbSNP
rs1167674955 2009 dbSNP
rs1427615016 2026 dbSNP
rs1427141928 2033 dbSNP
rs954913853 2041 dbSNP
rs1191745177 2060 dbSNP
rs1478387170 2082 dbSNP
rs1246267330 2117 dbSNP
rs1197364943 2122 dbSNP
rs35668650 2127 dbSNP
rs1484127418 2147 dbSNP
rs782470678 2148 dbSNP
rs1204841608 2153 dbSNP
rs781814501 2158 dbSNP
rs1220371847 2159 dbSNP
rs1366288078 2219 dbSNP
rs188413446 2221 dbSNP
rs1017993843 2225 dbSNP
rs1411147957 2230 dbSNP
rs1350682094 2233 dbSNP
rs1307065596 2234 dbSNP
rs17139614 2242 dbSNP
rs1360741112 2244 dbSNP
rs1176696579 2246 dbSNP
rs1413771210 2286 dbSNP
rs989319153 2288 dbSNP
rs782817037 2289 dbSNP
rs1174308709 2298 dbSNP
rs1473632052 2299 dbSNP
rs1252771791 2303 dbSNP
rs1181796896 2310 dbSNP
rs1479857441 2314 dbSNP
rs1239651092 2337 dbSNP
rs915084962 2344 dbSNP
rs1211273815 2346 dbSNP
rs1312070039 2349 dbSNP
rs1261843975 2358 dbSNP
rs945205929 2361 dbSNP
rs1229662706 2377 dbSNP
rs977851741 2381 dbSNP
rs782819360 2384 dbSNP
rs927719158 2392 dbSNP
rs1380893614 2394 dbSNP
rs781867723 2412 dbSNP
rs1303151794 2420 dbSNP
rs192931550 2443 dbSNP
rs1322514994 2446 dbSNP
rs1054810146 2458 dbSNP
rs1458868874 2470 dbSNP
rs782604003 2481 dbSNP
rs1158704711 2494 dbSNP
rs1417490251 2516 dbSNP
rs1416255935 2518 dbSNP
rs1182761415 2520 dbSNP
rs1483149177 2527 dbSNP
rs1062473 2531 dbSNP
rs1241808456 2546 dbSNP
rs1211186372 2552 dbSNP
rs948998838 2558 dbSNP
rs1062474 2570 dbSNP
rs1266863685 2576 dbSNP
rs1236268262 2580 dbSNP
rs1323099413 2585 dbSNP
rs143400015 2596 dbSNP
rs1227500233 2604 dbSNP
rs1062475 2609 dbSNP
rs782744109 2611 dbSNP
rs1380372029 2621 dbSNP
rs1062476 2622 dbSNP
rs1062477 2637 dbSNP
rs1299721053 2641 dbSNP
rs782446493 2643 dbSNP
rs1387827892 2650 dbSNP
rs1319909380 2653 dbSNP
rs1451757515 2654 dbSNP
rs1351800171 2674 dbSNP
rs6622701 2679 dbSNP
rs1165806974 2681 dbSNP
rs1423582668 2683 dbSNP
rs1037922921 2685 dbSNP
rs1383849537 2688 dbSNP
rs1190914121 2689 dbSNP
rs782578079 2693 dbSNP
rs1247973938 2694 dbSNP
rs782288456 2694 dbSNP
rs781821274 2696 dbSNP
rs782008914 2710 dbSNP
rs782403280 2710 dbSNP
rs1489199522 2711 dbSNP
rs1265641968 2712 dbSNP
rs184990005 2715 dbSNP
rs782525577 2719 dbSNP
rs1357008037 2729 dbSNP
rs1276432027 2741 dbSNP
rs1228888384 2747 dbSNP
rs1364314200 2754 dbSNP
rs1293395174 2759 dbSNP
rs1380577940 2760 dbSNP
rs899364100 2763 dbSNP
rs1424180459 2766 dbSNP
rs1363956950 2768 dbSNP
rs993662986 2775 dbSNP
rs1170817347 2780 dbSNP
rs1430837733 2807 dbSNP
rs1047866279 2815 dbSNP
rs782249586 2828 dbSNP
rs1191730119 2838 dbSNP
rs868957556 2854 dbSNP
rs1434383377 2872 dbSNP
rs1267524677 2875 dbSNP
rs1190130360 2876 dbSNP
rs1489688745 2880 dbSNP
rs190232474 2891 dbSNP
rs868926032 2892 dbSNP
rs1341254236 2904 dbSNP
rs1249527208 2917 dbSNP
rs1235407873 2925 dbSNP
rs1009373393 2934 dbSNP
rs181887074 2936 dbSNP
rs1017607630 2939 dbSNP
rs965037991 2940 dbSNP
rs186394214 2957 dbSNP
rs1022167168 2959 dbSNP
rs1343828469 2966 dbSNP
rs782621926 2972 dbSNP
rs1410804629 2980 dbSNP
rs1396302140 2983 dbSNP
rs966542137 3008 dbSNP
rs1467973255 3009 dbSNP
rs80335538 3015 dbSNP
rs977884274 3021 dbSNP
rs1378736963 3025 dbSNP
rs1479190007 3026 dbSNP
rs927760985 3027 dbSNP
rs1182519955 3028 dbSNP
rs1482601470 3037 dbSNP
rs1248071653 3040 dbSNP
rs1201976373 3077 dbSNP
rs1483507677 3091 dbSNP
rs1255370692 3096 dbSNP
rs782696413 3098 dbSNP
rs35910085 3110 dbSNP
rs1321567588 3124 dbSNP
rs189586870 3126 dbSNP
rs1229314719 3132 dbSNP
rs916255269 3133 dbSNP
rs1335406187 3137 dbSNP
rs940996975 3138 dbSNP
rs782154939 3139 dbSNP
rs1327206690 3156 dbSNP
rs1398182593 3157 dbSNP
rs782522124 3158 dbSNP
rs1336700705 3160 dbSNP
rs1037996668 3162 dbSNP
rs1159260180 3163 dbSNP
rs1469256654 3180 dbSNP
rs1189310062 3183 dbSNP
rs920827724 3187 dbSNP
rs1442828073 3193 dbSNP
rs1255358471 3194 dbSNP
rs1201761024 3196 dbSNP
rs1460034822 3214 dbSNP
rs929489306 3223 dbSNP
rs1209460167 3226 dbSNP
rs1350169740 3260 dbSNP
rs1047910700 3278 dbSNP
rs890581429 3283 dbSNP
rs1247403409 3288 dbSNP
rs1008992769 3292 dbSNP
rs782756691 3310 dbSNP
rs1314957170 3324 dbSNP
rs1451006508 3333 dbSNP
rs1391486125 3362 dbSNP
rs1320582991 3367 dbSNP
rs1399646048 3388 dbSNP
rs1382284925 3400 dbSNP
rs1164686067 3402 dbSNP
rs781833018 3404 dbSNP
rs1181530202 3410 dbSNP
rs782078242 3416 dbSNP
rs1451194369 3418 dbSNP
rs1248596770 3422 dbSNP
rs1193946786 3441 dbSNP
rs1446544068 3452 dbSNP
rs1211923760 3454 dbSNP
rs1357320529 3476 dbSNP
rs1291419497 3501 dbSNP
rs900540946 3502 dbSNP
rs1244263857 3513 dbSNP
rs1367922257 3521 dbSNP
rs1299042888 3534 dbSNP
rs1429384912 3537 dbSNP
rs1324234090 3539 dbSNP
rs1325112360 3546 dbSNP
rs1405521775 3567 dbSNP
rs1364588811 3577 dbSNP
rs1161392941 3583 dbSNP
rs782577290 3589 dbSNP
rs1431436894 3590 dbSNP
rs1390681145 3615 dbSNP
rs1010845923 3616 dbSNP
rs1475121693 3618 dbSNP
rs1240360722 3634 dbSNP
rs1201103264 3658 dbSNP
rs1062479 3660 dbSNP
rs1490560631 3661 dbSNP
rs1268483987 3662 dbSNP
rs1022199874 3663 dbSNP
rs782720264 3668 dbSNP
rs782761330 3669 dbSNP
rs1214570040 3685 dbSNP
rs966613625 3686 dbSNP
rs999372691 3694 dbSNP
rs1436604543 3699 dbSNP
rs1034861095 3701 dbSNP
rs1300952888 3706 dbSNP
rs960787519 3718 dbSNP
rs1371006328 3719 dbSNP
rs1169488566 3728 dbSNP
rs1408080309 3740 dbSNP
rs1427205235 3749 dbSNP
rs990617638 3755 dbSNP
rs138788451 3764 dbSNP
rs1480827632 3773 dbSNP
rs916312599 3791 dbSNP
rs1428830921 3808 dbSNP
rs1197606118 3812 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*