miRTarBase - #MIRT023384 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARSB   
Synonyms ASB, G4S, MPS6
Description arylsulfatase B
Transcript NM_000046   
Other Transcripts NM_198709   
Expression
Putative miRNA Targets on ARSB
3'UTR of ARSB
(miRNA target sites are highlighted)
>ARSB|NM_000046|3'UTR
   1 GATTTCAGGGAGGCTAGAAAACCTTTCAATTGGAAGTTGGACCTCAGGCCTTTTCTCACGACTCTTGTCTCATTTGTTAT
  81 CCCAACCTGGGTTCACTTGGCCCTTCTCTTGCTCTTAAACCACACCGAGGTGTCTAATTTCAACCCCTAATGCATTTAAG
 161 AAGCTGATAAAATCTGCAACACTCCTGCTGTTGGCTGGAGCATGTGTCTAGAGGTGGGGGTGGCTGGGTTTATCCCCCTT
 241 TCCTAAGCCTTGGGACAGCTGGGAACTTAACTTGAAATAGGAAGTTCTCACTGAATCCTGGAGGCTGGAACAGCTGGCTC
 321 TTTTAGACTCACAAGTCAGACGTTCGATTCCCCTCTGCCAATAGCCAGTTTTATTGGAGTGAATCACATTTCTTACGCAA
 401 ATGAAGGGAGCAGACAGTGATTAATGGTTCTGTTGGCCAAGGCTTCTCCCTGTCGGTGAAGGATCATGTTCAGGCACTCC
 481 AAGTGAACCACCCCTCTTGGTTCACCCCTTACTCACTTATCTCATCACAGAGCATAAGGCCCATTTTGTTGTTCAGGTCA
 561 ACAGCAAAATGCCTGCACCATGACTGTGGCTTTTAAAATAAAGAAATGTGTTTTTATCGTAATTTATTTCCCCCCAGCCA
 641 TTGCTCACTCTGTCTAGACTTCCTGCCACTTCCAATTCTTCTGTGGCTTTTCCTGCCTTTCCTTTTGACCTCAGTAGTCC
 721 TATCCCTGGGAAGGCCACTTTGCTTCTCTACCTGAGCACCCCTGATTTCTGGAACGCTGCTGAGCCCTGCCTTACTTTTG
 801 CCCCTAGGGCTGAAGCTAGAGGCCTCCCCGTAATAGGCGGTGGAGTTGCTCTGTGAGGATGTTCATGGTAGACACTAAGA
 881 GGGCTGGGTGGGAGATGCTTGGCTCTGTGGCATCTGTTCAGCGAGGCTTTTCCTATATTGCATGGAGTTAGTCATTGTGA
 961 TTGTAGCTTTATTTCATAATATATTAAGACTTGCACTGCTATTTACTAGCAGTGAGAAGAAACCTCAGGAAAGGATATGA
1041 AAAAGCAAGTGGCCAGTGTCTGGGATACTGGGCCTTGGTAAAGCAGAGGAGGGCACACCCACAGTCCTCTTATTCTCTGT
1121 TTTACTGCTTGTTTTGAGGTTCTGGGGTCTGGCAAAGAGGATGCAGTTTGACACCTGCAGCCCTTTCTCAATCCCACTAA
1201 TGTCTTACTAATGTGGAACAGTCCATATTAGCTCCAGAGAGTGTCAAACCCAGAGAAATGTGTGCAAAAATGATACTCTT
1281 TTCTGCATTAGCCCCACCATTGTGTTCACCAATGCTTGGAACACTGCCTGAAGGCACTCATTTTTTAATTTTTATTTTAT
1361 TTTTAATTTTTTATATCTTTATGAGACGATCTCACTCTGTCACCAGGTTGGAGTACAGTGGTACAATCACAACTCACCGT
1441 AGCCTCAAACTCCTGGGCTCAAGTGATTCTCCCACCTCAGGCACCCAAATAGCTGGAACTACAGGCATATACCGCCACAC
1521 CCAGCTAATTTTATTTTTTGAAAAGACAAGGTTCCCTATGTTGCCCAGCTGGTCTTAAACTCCTGGGCTCCAGCAATTAT
1601 CCCAGCTTGGGCTCCAAAAGTGCTGGGATTACAGGCATGAGTCACCATGCCTGGCCTCATTTTTTAAAACAAATGAATAA
1681 ATGGACAAATGAGTAAATGAGAAAGTCTCACACCATGAAAGATGCTAGTCCAATGAGCTGAATACAGAGGTAATATAAAT
1761 GTCTTCCAGCTGTTGCTTTTCTGTTCTCAAGCTGCCCCTCCTGGGGTAGGAGCATAATCTACATCACTGGGCAGTCACAG
1841 GACACTCTATAGCAAGGTTGTAGCGTCCTCTCCAGTGGGGGGAGAAAAGGAACTGTGCCTACCAAAGGTACTCTCTTGTC
1921 AGCAATTTCCATTTCTATACTTTATGGGACACTAGAAACTAAAAGCAACAAATAATCTGATATAAGTCCTTGTATAGTCA
2001 TCCTTCAATTCAGTAGCAATATTTTCTGGTCACTACTAACCTGTATTGTATTAAAATGAGACTATTGGAAGGAAATGGTG
2081 CTAAAACTAATAACATCTCTTACCAACCTTTACCCAACTCCTGGGTTGGCAAACAGCTGACCAAACTGCCATCACCTCCC
2161 ACTTGGAAGTGTATGGCCGACAGCATGAAATAGCTGAGCCCAGATGTTCCTTCTGCATCCTCCGAATCCCAGGGCTGGGT
2241 GTAGGTAGCCGTTGGAGGCCATCGCTACAGGGCACCTATCTGTTATCGCTGCTGTCCTCCCAACAGCTGTCTCCAGTTCT
2321 AGTTCCTTGGTTTTCAGGCACAGTGGGGGATGTTCTGCACCCAGTGGACTTCAAAAGAGTTTTGAAGACTTAATTTTTTG
2401 TAAAACAAGTACTTGAGATTTTGGTTTATCCATAATAGAATGTATTTCATTAGATTCTCTGATTCTATATAAGAATGTGA
2481 AAAGATTGATATATTGTTGTTAGAAATAATGTTATTTCTTTCCAATTTTTTTTTTTTTTTTTTTTGAGATGGAGTCTCGC
2561 TCTGTCACCCAGGCTGGAGTGCAGTGGTGTGATCTCGGCTCACTGCAGCCTCTAACTCCCAGGTTCAAGCTATTCTCCTG
2641 CCTCAGCCTCCCAAGTAGCTGGATTACAGGCATACACCACCACGCCTGGCTATGTTTTGTATTTTTCGTAGAGATAGGGT
2721 TTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCCACTTCAGCTTCCCAAAGCACTGGGATT
2801 ACAGGTGTGAGCCACTGTGCCCGGCAAATTTTTTTACCTTTACAGAAGGTTTTGCTTATTTAATTGTGAGCTCATTTTTC
2881 TTTGTTACTTTTGTCCCCCCAGATTTGGGGGACAAAATAAAATTAATCTTTTAAAATGTGTCAGCCATATGTATGGGGCT
2961 TCCATTTGGGGTGAGGAGAAAGTTCTGGAACTAGATAGTGGTCATGGTTATACAACATCATAAATGCAATTACTGCCACT
3041 GAATTGTATGTTTTAAAGTGGTTAAAATGTTAAGTTTTATGTTTTATTACAATTTTTAAATGTGTCAACCAACTTTATAG
3121 TACATAAATTATATCTCAGTAAAGCTGTTAAATAAATAAATATAGTAAAAATTTTAGAACTAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUA-ACAGUGUGAGGu 5'
            :|:|  || ||  ||||||| 
Target 5' ctGATAAAATCTGCAACACTCCt 3'
164 - 186 152.00 -11.60
2
miRNA  3' guUUGUGGUAACAG--UGUGAGGu 5'
            |: |:|||  ||  :|||||| 
Target 5' gaAGGATCATGTTCAGGCACTCCa 3'
458 - 481 142.00 -17.30
3
miRNA  3' guuuGUGGUAAC--AGUGUGAGGu 5'
              ||||:| |  ||| ||||| 
Target 5' aactCACCGTAGCCTCAAACTCCt 3'
1431 - 1454 136.00 -15.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
354302 60 ClinVar
906772 166 ClinVar
354301 202 ClinVar
354300 212 ClinVar
906771 340 ClinVar
906770 384 ClinVar
906769 420 ClinVar
354299 608 ClinVar
354298 618 ClinVar
354297 619 ClinVar
354296 635 ClinVar
354295 793 ClinVar
354294 810 ClinVar
905174 922 ClinVar
905173 933 ClinVar
905172 965 ClinVar
354293 990 ClinVar
904376 994 ClinVar
904375 1146 ClinVar
354292 1147 ClinVar
904374 1153 ClinVar
354291 1169 ClinVar
354290 1257 ClinVar
354289 1276 ClinVar
354288 1286 ClinVar
354287 1302 ClinVar
907718 1326 ClinVar
354286 1360 ClinVar
354285 1373 ClinVar
907717 1373 ClinVar
354284 1387 ClinVar
907716 1420 ClinVar
354283 1469 ClinVar
354282 1499 ClinVar
354281 1513 ClinVar
354280 1540 ClinVar
906690 1594 ClinVar
354279 1610 ClinVar
906689 1635 ClinVar
354278 1730 ClinVar
354277 1900 ClinVar
906688 1951 ClinVar
354276 1989 ClinVar
354275 2013 ClinVar
354274 2022 ClinVar
354273 2080 ClinVar
905108 2092 ClinVar
905107 2155 ClinVar
905106 2158 ClinVar
905105 2164 ClinVar
354272 2243 ClinVar
905104 2251 ClinVar
354271 2287 ClinVar
904313 2408 ClinVar
904312 2524 ClinVar
904311 2525 ClinVar
904310 2526 ClinVar
354270 2546 ClinVar
904309 2559 ClinVar
904308 2571 ClinVar
354269 2578 ClinVar
904307 2593 ClinVar
354268 2608 ClinVar
354267 2640 ClinVar
907643 2654 ClinVar
354266 2672 ClinVar
907642 2680 ClinVar
907641 2684 ClinVar
354265 2707 ClinVar
354264 2708 ClinVar
907640 2784 ClinVar
906618 2831 ClinVar
354263 2859 ClinVar
354262 2975 ClinVar
354261 3047 ClinVar
906617 3147 ClinVar
354260 3152 ClinVar
354259 3163 ClinVar
354258 3174 ClinVar
354256 3181 ClinVar
354257 3181 ClinVar
COSN31503204 21 COSMIC
COSN30103892 22 COSMIC
COSN30506533 23 COSMIC
COSN30104893 43 COSMIC
COSN30104896 44 COSMIC
COSN30161037 57 COSMIC
COSN14794341 60 COSMIC
COSN31500536 67 COSMIC
COSN30472777 81 COSMIC
COSN31549923 87 COSMIC
COSN30189498 90 COSMIC
COSN30494252 90 COSMIC
COSN30152682 114 COSMIC
COSN20075383 116 COSMIC
COSN30513822 123 COSMIC
COSN26966880 127 COSMIC
COSN31529489 160 COSMIC
COSN14747592 1302 COSMIC
COSN2118355 1702 COSMIC
COSN9191897 1855 COSMIC
COSN31962423 2288 COSMIC
COSN17076283 2358 COSMIC
COSN32063586 2511 COSMIC
COSN26506354 2816 COSMIC
COSN26569614 2818 COSMIC
COSN26646337 2822 COSMIC
COSN31594654 2828 COSMIC
COSN31485662 2850 COSMIC
COSN26577549 2975 COSMIC
COSN31591722 3027 COSMIC
COSN31609174 3052 COSMIC
COSN31530576 3077 COSMIC
COSN23517425 3149 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750709579 11 dbSNP
rs751374701 12 dbSNP
rs765642308 14 dbSNP
rs1373019578 26 dbSNP
rs973645146 29 dbSNP
rs528847475 30 dbSNP
rs763032043 32 dbSNP
rs771166433 36 dbSNP
rs760606288 37 dbSNP
rs961821444 40 dbSNP
rs773498963 44 dbSNP
rs748400777 46 dbSNP
rs779294772 49 dbSNP
rs1328841844 50 dbSNP
rs1014704758 58 dbSNP
rs753076331 59 dbSNP
rs2173012 60 dbSNP
rs543708824 63 dbSNP
rs1339629559 76 dbSNP
rs1469298938 79 dbSNP
rs140351894 85 dbSNP
rs1011886534 94 dbSNP
rs1264712699 96 dbSNP
rs1471333228 99 dbSNP
rs894738625 102 dbSNP
rs1408175203 104 dbSNP
rs1045384481 111 dbSNP
rs775428543 120 dbSNP
rs1162155474 122 dbSNP
rs760017254 126 dbSNP
rs1441164968 127 dbSNP
rs1461867569 130 dbSNP
rs948384397 131 dbSNP
rs185532972 132 dbSNP
rs915800011 136 dbSNP
rs1369166152 144 dbSNP
rs936241596 147 dbSNP
rs181321349 166 dbSNP
rs1231756993 167 dbSNP
rs1355570833 183 dbSNP
rs1170889070 184 dbSNP
rs572550609 190 dbSNP
rs1335601010 194 dbSNP
rs1428141388 195 dbSNP
rs73770019 202 dbSNP
rs977259176 203 dbSNP
rs188797170 207 dbSNP
rs1455724072 208 dbSNP
rs911948568 209 dbSNP
rs1237326220 210 dbSNP
rs561718720 212 dbSNP
rs1185403736 214 dbSNP
rs1419364874 216 dbSNP
rs1475222394 218 dbSNP
rs986066683 219 dbSNP
rs1394169010 235 dbSNP
rs1411607467 242 dbSNP
rs931960275 243 dbSNP
rs1488125595 262 dbSNP
rs1374664812 274 dbSNP
rs1233319102 283 dbSNP
rs1027679834 287 dbSNP
rs920517397 291 dbSNP
rs898113042 298 dbSNP
rs973379680 304 dbSNP
rs1273621807 310 dbSNP
rs1342069078 330 dbSNP
rs1003717209 332 dbSNP
rs1280023472 334 dbSNP
rs1234619423 340 dbSNP
rs770600510 341 dbSNP
rs906927489 342 dbSNP
rs576318055 345 dbSNP
rs556525312 346 dbSNP
rs1191778557 352 dbSNP
rs1218066138 353 dbSNP
rs34610517 354 dbSNP
rs907739644 356 dbSNP
rs981897789 357 dbSNP
rs1408518821 370 dbSNP
rs1394424720 372 dbSNP
rs1370380182 379 dbSNP
rs1432587219 382 dbSNP
rs970465323 384 dbSNP
rs1023361743 392 dbSNP
rs114935268 396 dbSNP
rs577550485 403 dbSNP
rs1175459613 408 dbSNP
rs374929000 415 dbSNP
rs977184196 426 dbSNP
rs773033700 435 dbSNP
rs1000473258 454 dbSNP
rs151197584 455 dbSNP
rs1041918987 462 dbSNP
rs1009043206 467 dbSNP
rs1345272774 471 dbSNP
rs1204223287 484 dbSNP
rs1259024942 486 dbSNP
rs1184317639 489 dbSNP
rs953530086 495 dbSNP
rs1079397 496 dbSNP
rs890544960 505 dbSNP
rs1188673674 520 dbSNP
rs1452516611 532 dbSNP
rs1315340032 534 dbSNP
rs1395529344 539 dbSNP
rs1050497091 540 dbSNP
rs1157098460 542 dbSNP
rs868866414 545 dbSNP
rs973438440 551 dbSNP
rs932052233 552 dbSNP
rs1250838186 557 dbSNP
rs962569360 562 dbSNP
rs920646570 564 dbSNP
rs866877062 567 dbSNP
rs749372784 584 dbSNP
rs569587593 586 dbSNP
rs940643881 588 dbSNP
rs1258537337 589 dbSNP
rs1253812344 595 dbSNP
rs907768933 603 dbSNP
rs1208976878 607 dbSNP
rs886060796 608 dbSNP
rs1208743341 616 dbSNP
rs757857543 618 dbSNP
rs886060795 619 dbSNP
rs1289651239 621 dbSNP
rs898209203 629 dbSNP
rs1227126866 630 dbSNP
rs1350358734 632 dbSNP
rs1267762278 633 dbSNP
rs970496566 634 dbSNP
rs534480571 635 dbSNP
rs894258651 640 dbSNP
rs552876911 647 dbSNP
rs958008157 648 dbSNP
rs1164292133 669 dbSNP
rs1392464826 674 dbSNP
rs1454482492 674 dbSNP
rs1032035805 675 dbSNP
rs1319691778 676 dbSNP
rs1389961360 677 dbSNP
rs999866691 678 dbSNP
rs1390975198 687 dbSNP
rs1337140255 688 dbSNP
rs1228671390 690 dbSNP
rs1292127191 714 dbSNP
rs771930799 720 dbSNP
rs967638908 724 dbSNP
rs1156980699 734 dbSNP
rs1041604176 735 dbSNP
rs1020507735 752 dbSNP
rs1193806816 757 dbSNP
rs1252462133 762 dbSNP
rs1473021367 766 dbSNP
rs1009076221 775 dbSNP
rs1187999025 776 dbSNP
rs565551823 786 dbSNP
rs186035080 788 dbSNP
rs1051032311 791 dbSNP
rs886060794 793 dbSNP
rs996301793 800 dbSNP
rs1300233737 802 dbSNP
rs899235523 804 dbSNP
rs535536121 808 dbSNP
rs777160780 810 dbSNP
rs1234543667 817 dbSNP
rs1163114508 819 dbSNP
rs907903168 823 dbSNP
rs532783256 827 dbSNP
rs982340985 829 dbSNP
rs1225199841 830 dbSNP
rs971005935 834 dbSNP
rs1483229620 835 dbSNP
rs1209900291 841 dbSNP
rs560652209 842 dbSNP
rs1012424576 844 dbSNP
rs1182500219 848 dbSNP
rs1418947137 855 dbSNP
rs1329081955 859 dbSNP
rs886361824 867 dbSNP
rs768636313 876 dbSNP
rs1274422377 877 dbSNP
rs1247610585 878 dbSNP
rs949300140 883 dbSNP
rs1339128409 891 dbSNP
rs1387411139 899 dbSNP
rs569544305 910 dbSNP
rs1032779548 911 dbSNP
rs201284766 922 dbSNP
rs879097374 923 dbSNP
rs549791435 924 dbSNP
rs181041239 926 dbSNP
rs1318634291 932 dbSNP
rs924998163 933 dbSNP
rs1297557625 935 dbSNP
rs1342826712 942 dbSNP
rs1395302771 955 dbSNP
rs144818735 965 dbSNP
rs1277985573 972 dbSNP
rs1350288659 975 dbSNP
rs1211170116 976 dbSNP
rs1241581858 979 dbSNP
rs966331733 986 dbSNP
rs1484901028 988 dbSNP
rs886060793 990 dbSNP
rs190632756 994 dbSNP
rs931853872 1001 dbSNP
rs757351138 1006 dbSNP
rs748370529 1008 dbSNP
rs1397312687 1010 dbSNP
rs1186522900 1029 dbSNP
rs1172976136 1035 dbSNP
rs1176403847 1045 dbSNP
rs1037775565 1049 dbSNP
rs527854622 1055 dbSNP
rs940793510 1057 dbSNP
rs1322001320 1072 dbSNP
rs996723029 1077 dbSNP
rs1365813988 1090 dbSNP
rs1464096485 1093 dbSNP
rs899266221 1096 dbSNP
rs907870506 1099 dbSNP
rs1369537564 1107 dbSNP
rs1016264331 1108 dbSNP
rs1004849064 1113 dbSNP
rs1267411454 1115 dbSNP
rs970934187 1117 dbSNP
rs1212193383 1118 dbSNP
rs916835791 1119 dbSNP
rs991371140 1128 dbSNP
rs958219979 1130 dbSNP
rs1032947684 1134 dbSNP
rs978532328 1142 dbSNP
rs141001994 1146 dbSNP
rs886060792 1147 dbSNP
rs116753785 1153 dbSNP
rs949358366 1155 dbSNP
rs1008522141 1168 dbSNP
rs886060791 1169 dbSNP
rs1388820672 1189 dbSNP
rs895026594 1191 dbSNP
rs1054985956 1194 dbSNP
rs1295756190 1199 dbSNP
rs1323743226 1208 dbSNP
rs576528077 1234 dbSNP
rs1436881603 1240 dbSNP
rs755419247 1242 dbSNP
rs925063028 1244 dbSNP
rs977868731 1251 dbSNP
rs562723822 1253 dbSNP
rs754567 1257 dbSNP
rs753090974 1258 dbSNP
rs1211911917 1260 dbSNP
rs986453662 1262 dbSNP
rs765584711 1273 dbSNP
rs576847356 1275 dbSNP
rs886060790 1276 dbSNP
rs1452719617 1283 dbSNP
rs1204244461 1285 dbSNP
rs886060789 1286 dbSNP
rs954999507 1298 dbSNP
rs754566 1302 dbSNP
rs1430244774 1307 dbSNP
rs886531225 1309 dbSNP
rs1391772359 1312 dbSNP
rs543870655 1320 dbSNP
rs974942925 1326 dbSNP
rs1415812014 1332 dbSNP
rs1405931641 1334 dbSNP
rs1377728806 1337 dbSNP
rs1200310142 1339 dbSNP
rs1352611101 1340 dbSNP
rs1450406725 1340 dbSNP
rs1411882043 1341 dbSNP
rs963848246 1346 dbSNP
rs1308799486 1347 dbSNP
rs534611208 1353 dbSNP
rs949382494 1354 dbSNP
rs886060788 1360 dbSNP
rs916804604 1368 dbSNP
rs146584784 1373 dbSNP
rs551749278 1373 dbSNP
rs757145837 1381 dbSNP
rs555581069 1387 dbSNP
rs886510789 1388 dbSNP
rs925467585 1393 dbSNP
rs1024943358 1398 dbSNP
rs1013978794 1415 dbSNP
rs79166190 1420 dbSNP
rs1055417691 1435 dbSNP
rs569769513 1438 dbSNP
rs1348815119 1439 dbSNP
rs1473081409 1448 dbSNP
rs185570308 1456 dbSNP
rs55710452 1469 dbSNP
rs1431327742 1478 dbSNP
rs1271496284 1484 dbSNP
rs1375055262 1487 dbSNP
rs1020012070 1488 dbSNP
rs1330594305 1490 dbSNP
rs1336244798 1493 dbSNP
rs1322879407 1495 dbSNP
rs1341206155 1496 dbSNP
rs886060787 1499 dbSNP
rs193031954 1501 dbSNP
rs765951533 1506 dbSNP
rs1050801552 1511 dbSNP
rs886060786 1513 dbSNP
rs548070913 1514 dbSNP
rs996102871 1515 dbSNP
rs527994638 1520 dbSNP
rs1257641033 1521 dbSNP
rs1191845234 1529 dbSNP
rs932272605 1529 dbSNP
rs1246070422 1532 dbSNP
rs1451312059 1535 dbSNP
rs562140646 1536 dbSNP
rs886060785 1540 dbSNP
rs1433079859 1544 dbSNP
rs1174479461 1547 dbSNP
rs548797606 1549 dbSNP
rs531689793 1551 dbSNP
rs144259967 1558 dbSNP
rs1367946495 1563 dbSNP
rs1476792785 1564 dbSNP
rs963661356 1567 dbSNP
rs148514393 1571 dbSNP
rs1183593693 1581 dbSNP
rs760270486 1588 dbSNP
rs1235902324 1590 dbSNP
rs188998831 1594 dbSNP
rs1046529653 1596 dbSNP
rs1250099504 1599 dbSNP
rs1265744034 1601 dbSNP
rs1204816800 1606 dbSNP
rs867100156 1610 dbSNP
rs1252314114 1616 dbSNP
rs895147155 1620 dbSNP
rs560115128 1628 dbSNP
rs772943935 1632 dbSNP
rs936904306 1634 dbSNP
rs35597782 1635 dbSNP
rs959671330 1637 dbSNP
rs1033682042 1651 dbSNP
rs1001215657 1652 dbSNP
rs978263367 1665 dbSNP
rs1344463533 1668 dbSNP
rs1289034386 1671 dbSNP
rs945562772 1704 dbSNP
rs903760421 1705 dbSNP
rs1042258162 1710 dbSNP
rs1009380100 1714 dbSNP
rs890884893 1715 dbSNP
rs1051254420 1722 dbSNP
rs1388844435 1723 dbSNP
rs369595123 1730 dbSNP
rs1331298588 1732 dbSNP
rs1237968771 1747 dbSNP
rs1285898564 1749 dbSNP
rs1330535316 1751 dbSNP
rs1228479461 1762 dbSNP
rs761441478 1767 dbSNP
rs1359517975 1773 dbSNP
rs1335840675 1778 dbSNP
rs1211389647 1781 dbSNP
rs920969946 1791 dbSNP
rs544889795 1793 dbSNP
rs1267843236 1794 dbSNP
rs921604154 1796 dbSNP
rs1180362911 1797 dbSNP
rs1038025057 1804 dbSNP
rs942299086 1806 dbSNP
rs909442792 1807 dbSNP
rs572343080 1814 dbSNP
rs1016613595 1830 dbSNP
rs1459300523 1833 dbSNP
rs1459937150 1838 dbSNP
rs1294489392 1841 dbSNP
rs983584764 1847 dbSNP
rs1390044957 1850 dbSNP
rs1305726900 1856 dbSNP
rs1351981682 1862 dbSNP
rs1292190328 1863 dbSNP
rs1410315999 1864 dbSNP
rs950851884 1865 dbSNP
rs145682593 1874 dbSNP
rs542037618 1877 dbSNP
rs1483516243 1878 dbSNP
rs1239558937 1879 dbSNP
rs576181831 1880 dbSNP
rs1254252820 1881 dbSNP
rs950517265 1882 dbSNP
rs1373018447 1887 dbSNP
rs1185738824 1897 dbSNP
rs886060784 1900 dbSNP
rs1371999441 1908 dbSNP
rs1410096753 1914 dbSNP
rs992690607 1920 dbSNP
rs1397282946 1924 dbSNP
rs1313251894 1935 dbSNP
rs572744593 1937 dbSNP
rs1034126032 1945 dbSNP
rs1225837741 1946 dbSNP
rs149854678 1951 dbSNP
rs1331136941 1954 dbSNP
rs1266233628 1955 dbSNP
rs967976212 1956 dbSNP
rs113020259 1971 dbSNP
rs1055094600 1972 dbSNP
rs554221178 1975 dbSNP
rs904078567 1978 dbSNP
rs1448257257 1980 dbSNP
rs891001144 1982 dbSNP
rs183880174 1987 dbSNP
rs878926507 1989 dbSNP
rs1429981892 1994 dbSNP
rs372736205 1997 dbSNP
rs531362043 1997 dbSNP
rs113059935 2013 dbSNP
rs1436735005 2017 dbSNP
rs997025388 2019 dbSNP
rs7704939 2022 dbSNP
rs1038460612 2028 dbSNP
rs147325213 2030 dbSNP
rs933036056 2037 dbSNP
rs548622604 2046 dbSNP
rs1299532585 2047 dbSNP
rs770930093 2048 dbSNP
rs1233304040 2062 dbSNP
rs974411843 2068 dbSNP
rs1314187636 2076 dbSNP
rs886060783 2080 dbSNP
rs1161773995 2082 dbSNP
rs963386501 2102 dbSNP
rs1249203574 2114 dbSNP
rs940989314 2115 dbSNP
rs1189870001 2116 dbSNP
rs1248805368 2130 dbSNP
rs1434592236 2133 dbSNP
rs983366109 2135 dbSNP
rs888035450 2139 dbSNP
rs1387351941 2150 dbSNP
rs1463642631 2158 dbSNP
rs1322390131 2163 dbSNP
rs950647700 2164 dbSNP
rs1435431543 2167 dbSNP
rs35583050 2167 dbSNP
rs1048000804 2170 dbSNP
rs1013428098 2176 dbSNP
rs1322208232 2178 dbSNP
rs929556958 2179 dbSNP
rs555013100 2181 dbSNP
rs918102722 2182 dbSNP
rs1034196064 2183 dbSNP
rs1230308148 2186 dbSNP
rs1269273787 2188 dbSNP
rs992327686 2193 dbSNP
rs938108540 2199 dbSNP
rs1468442532 2204 dbSNP
rs926705238 2209 dbSNP
rs187146901 2210 dbSNP
rs968008708 2211 dbSNP
rs1042407281 2217 dbSNP
rs1410780767 2219 dbSNP
rs1160778339 2223 dbSNP
rs569360224 2224 dbSNP
rs879385823 2229 dbSNP
rs1351461448 2232 dbSNP
rs891383399 2234 dbSNP
rs1307579840 2238 dbSNP
rs145585943 2243 dbSNP
rs1411679828 2244 dbSNP
rs932831210 2248 dbSNP
rs955257743 2250 dbSNP
rs532513960 2251 dbSNP
rs1321992181 2253 dbSNP
rs996667450 2257 dbSNP
rs899580937 2258 dbSNP
rs1481897481 2263 dbSNP
rs377070327 2264 dbSNP
rs983124484 2265 dbSNP
rs1472419844 2267 dbSNP
rs1161332312 2278 dbSNP
rs886060782 2287 dbSNP
rs917859690 2288 dbSNP
rs560103107 2290 dbSNP
rs1368918177 2291 dbSNP
rs1447849351 2293 dbSNP
rs1308706768 2295 dbSNP
rs1340004790 2302 dbSNP
rs886813621 2313 dbSNP
rs879054893 2319 dbSNP
rs540263664 2333 dbSNP
rs991966401 2334 dbSNP
rs1046694531 2343 dbSNP
rs1339631052 2346 dbSNP
rs929587963 2349 dbSNP
rs1206925088 2358 dbSNP
rs959457835 2360 dbSNP
rs1219267694 2361 dbSNP
rs1490139405 2363 dbSNP
rs1441269540 2370 dbSNP
rs896708004 2389 dbSNP
rs1230199195 2392 dbSNP
rs1473111016 2402 dbSNP
rs1187659119 2405 dbSNP
rs13354324 2408 dbSNP
rs938154411 2420 dbSNP
rs926707538 2424 dbSNP
rs561990948 2428 dbSNP
rs184428932 2435 dbSNP
rs979548899 2443 dbSNP
rs1412789974 2444 dbSNP
rs1369095918 2446 dbSNP
rs1273642695 2449 dbSNP
rs946782758 2455 dbSNP
rs576148086 2457 dbSNP
rs891353928 2460 dbSNP
rs556397528 2467 dbSNP
rs545911498 2468 dbSNP
rs577054714 2475 dbSNP
rs1270369910 2486 dbSNP
rs772062374 2487 dbSNP
rs1343881445 2488 dbSNP
rs1198207935 2492 dbSNP
rs1038569234 2494 dbSNP
rs1461706164 2499 dbSNP
rs759495980 2502 dbSNP
rs1208089636 2511 dbSNP
rs1310192085 2514 dbSNP
rs1428086346 2518 dbSNP
rs1246126518 2520 dbSNP
rs1354091759 2522 dbSNP
rs1177055097 2523 dbSNP
rs868066675 2524 dbSNP
rs867923783 2525 dbSNP
rs1174387311 2526 dbSNP
rs1377265684 2526 dbSNP
rs941741916 2526 dbSNP
rs1423131290 2529 dbSNP
rs1189444154 2531 dbSNP
rs1426034679 2532 dbSNP
rs1480046560 2532 dbSNP
rs1281124325 2546 dbSNP
rs1319054662 2546 dbSNP
rs1391508719 2546 dbSNP
rs1456791721 2546 dbSNP
rs397976147 2546 dbSNP
rs775928946 2546 dbSNP
rs1220203372 2547 dbSNP
rs1266116338 2547 dbSNP
rs1266494341 2551 dbSNP
rs1252302742 2552 dbSNP
rs377237358 2554 dbSNP
rs1206960165 2558 dbSNP
rs975658724 2559 dbSNP
rs1157062344 2560 dbSNP
rs1250475964 2566 dbSNP
rs1210371878 2567 dbSNP
rs963944156 2571 dbSNP
rs1458266278 2574 dbSNP
rs548093605 2578 dbSNP
rs1298515067 2580 dbSNP
rs1223468189 2597 dbSNP
rs1047405937 2598 dbSNP
rs1345780251 2599 dbSNP
rs569254528 2608 dbSNP
rs951121288 2612 dbSNP
rs192507993 2614 dbSNP
rs1408458455 2618 dbSNP
rs1239754410 2636 dbSNP
rs1373043030 2639 dbSNP
rs1013852515 2640 dbSNP
rs886060781 2640 dbSNP
rs147170505 2654 dbSNP
rs1482879533 2655 dbSNP
rs1180065279 2660 dbSNP
rs992468091 2660 dbSNP
rs1056684795 2662 dbSNP
rs1420185902 2667 dbSNP
rs1357533023 2669 dbSNP
rs755318092 2671 dbSNP
rs886060780 2672 dbSNP
rs1459726902 2673 dbSNP
rs1043901041 2680 dbSNP
rs1412534080 2683 dbSNP
rs188859845 2684 dbSNP
rs1351740036 2687 dbSNP
rs1391471087 2692 dbSNP
rs1311872914 2699 dbSNP
rs979296000 2701 dbSNP
rs183918206 2707 dbSNP
rs141667208 2708 dbSNP
rs569102350 2716 dbSNP
rs767010686 2724 dbSNP
rs922584361 2732 dbSNP
rs1277050591 2736 dbSNP
rs1480961907 2740 dbSNP
rs975395003 2741 dbSNP
rs552392563 2748 dbSNP
rs955362529 2751 dbSNP
rs964286405 2752 dbSNP
rs748128275 2753 dbSNP
rs1184587530 2757 dbSNP
rs1390008938 2784 dbSNP
rs997503655 2797 dbSNP
rs532451927 2801 dbSNP
rs1166260732 2807 dbSNP
rs566654980 2809 dbSNP
rs756745196 2819 dbSNP
rs538499190 2820 dbSNP
rs75662168 2821 dbSNP
rs531460820 2822 dbSNP
rs147981899 2823 dbSNP
rs1025309630 2829 dbSNP
rs1202418679 2830 dbSNP
rs1225906488 2831 dbSNP
rs1014345057 2835 dbSNP
rs887497679 2836 dbSNP
rs1270640753 2838 dbSNP
rs1047502068 2839 dbSNP
rs1209469935 2839 dbSNP
rs561138551 2840 dbSNP
rs1204806417 2844 dbSNP
rs1247959353 2853 dbSNP
rs114729310 2855 dbSNP
rs1190938199 2857 dbSNP
rs116826065 2859 dbSNP
rs937889377 2866 dbSNP
rs770795975 2868 dbSNP
rs1375481440 2869 dbSNP
rs562665068 2872 dbSNP
rs1470677436 2875 dbSNP
rs905432786 2877 dbSNP
rs1337233700 2879 dbSNP
rs1336170008 2881 dbSNP
rs926562355 2887 dbSNP
rs763936533 2897 dbSNP
rs1043932199 2898 dbSNP
rs1390907537 2911 dbSNP
rs1161346299 2923 dbSNP
rs1218919459 2924 dbSNP
rs1299481372 2927 dbSNP
rs1043925780 2928 dbSNP
rs879546741 2931 dbSNP
rs913765568 2939 dbSNP
rs988166925 2941 dbSNP
rs955495102 2943 dbSNP
rs922561706 2947 dbSNP
rs1190213730 2950 dbSNP
rs1425197634 2953 dbSNP
rs1240962700 2957 dbSNP
rs1481108304 2967 dbSNP
rs1317500625 2974 dbSNP
rs3088247 2975 dbSNP
rs1052553644 2976 dbSNP
rs577133342 3002 dbSNP
rs1455640265 3016 dbSNP
rs1161005086 3030 dbSNP
rs922650651 3033 dbSNP
rs1345507147 3034 dbSNP
rs964623529 3039 dbSNP
rs1017199965 3044 dbSNP
rs1207425692 3046 dbSNP
rs560253823 3047 dbSNP
rs1266420438 3048 dbSNP
rs1327691291 3051 dbSNP
rs1226031473 3054 dbSNP
rs1247356312 3062 dbSNP
rs942645282 3067 dbSNP
rs951509111 3068 dbSNP
rs1321429211 3069 dbSNP
rs879132414 3071 dbSNP
rs1219864552 3081 dbSNP
rs1314696942 3089 dbSNP
rs761506604 3105 dbSNP
rs566378759 3109 dbSNP
rs896243234 3110 dbSNP
rs574327325 3120 dbSNP
rs1001894129 3126 dbSNP
rs1408675424 3129 dbSNP
rs905077920 3133 dbSNP
rs1318572263 3140 dbSNP
rs951184697 3143 dbSNP
rs1425606069 3147 dbSNP
rs886060779 3152 dbSNP
rs1043635894 3162 dbSNP
rs545091443 3163 dbSNP
rs886060778 3163 dbSNP
rs1379110119 3172 dbSNP
rs1226940757 3173 dbSNP
rs886060777 3174 dbSNP
rs992632881 3180 dbSNP
rs11750774 3181 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*