miRTarBase - #MIRT023374 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FSTL3   
Synonyms FLRG, FSRP
Description follistatin like 3
Transcript NM_005860   
Expression
Putative miRNA Targets on FSTL3
3'UTR of FSTL3
(miRNA target sites are highlighted)
>FSTL3|NM_005860|3'UTR
   1 GCCTGCAGGACAGGCCTGGGCCTGGTGCCCGAGGCCCCCCATCATCCCCTGTTATTTATTGCCACAGCAGAGTCTAATTT
  81 ATATGCCACGGACACTCCTTAGAGCCCGGATTCGGACCACTTGGGGATCCCAGAACCTCCCTGACGATATCCTGGAAGGA
 161 CTGAGGAAGGGAGGCCTGGGGGCCGGCTGGTGGGTGGGATAGACCTGCGTTCCGGACACTGAGCGCCTGATTTAGGGCCC
 241 TTCTCTAGGATGCCCCAGCCCCTACCCTAAGACCTATTGCCGGGGAGGATTCCACACTTCCGCTCCTTTGGGGATAAACC
 321 TATTAATTATTGCTACTATCAAGAGGGCTGGGCATTCTCTGCTGGTAATTCCTGAAGAGGCATGACTGCTTTTCTCAGCC
 401 CCAAGCCTCTAGTCTGGGTGTGTACGGAGGGTCTAGCCTGGGTGTGTACGGAGGGTCTAGCCTGGGTGAGTACGGAGGGT
 481 CTAGCCTGGGTGAGTACGGAGGGTCTAGCCTGGGTGAGTACGGAGGGTCTAGCCTGGGTGTGTATGGAGGATCTAGCCTG
 561 GGTGAGTATGGAGGGTCTAGCCTGGGTGAGTATGGAGGGTCTAGCCTGGGTGTGTATGGAGGGTCTAGCCTGGGTGAGTA
 641 TGGAGGGTCTAGCCTGGGTGTGTATGGAGGGTCTAGCCTGGGTGAGTATGGAGGGTCTAGCCTGGGTGTGTACGGAGGGT
 721 CTAGTCTGAGTGCGTGTGGGGACCTCAGAACACTGTGACCTTAGCCCAGCAAGCCAGGCCCTTCATGAAGGCCAAGAAGG
 801 CTGCCACCATTCCCTGCCAGCCCAAGAACTCCAGCTTCCCCACTGCCTCTGTGTGCCCCTTTGCGTCCTGTGAAGGCCAT
 881 TGAGAAATGCCCAGTGTGCCCCCTGGGAAAGGGCACGGCCTGTGCTCCTGACACGGGCTGTGCTTGGCCACAGAACCACC
 961 CAGCGTCTCCCCTGCTGCTGTCCACGTCAGTTCATGAGGCAACGTCGCGTGGTCTCAGACGTGGAGCAGCCAGCGGCAGC
1041 TCAGAGCAGGGCACTGTGTCCGGCGGAGCCAAGTCCACTCTGGGGGAGCTCTGGCGGGGACCACGGGCCACTGCTCACCC
1121 ACTGGCCCCGAGGGGGGTGTAGACGCCAAGACTCACGCATGTGTGACATCCGGAGTCCTGGAGCCGGGTGTCCCAGTGGC
1201 ACCACTAGGTGCCTGCTGCCTCCACAGTGGGGTTCACACCCAGGGCTCCTTGGTCCCCCACAACCTGCCCCGGCCAGGCC
1281 TGCAGACCCAGACTCCAGCCAGACCTGCCTCACCCACCAATGCAGCCGGGGCTGGCGACACCAGCCAGGTGCTGGTCTTG
1361 GGCCAGTTCTCCCACGACGGCTCACCCTCCCCTCCATCTGCGTTGATGCTCAGAATCGCCTACCTGTGCCTGCGTGTAAA
1441 CCACAGCCTCAGACCAGCTATGGGGAGAGGACAACACGGAGGATATCCAGCTTCCCCGGTCTGGGGTGAGGAATGTGGGG
1521 AGCTTGGGCATCCTCCTCCAGCCTCCTCCAGCCCCCAGGCAGTGCCTTACCTGTGGTGCCCAGAAAAGTGCCCCTAGGTT
1601 GGTGGGTCTACAGGAGCCTCAGCCAGGCAGCCCACCCCACCCTGGGGCCCTGCCTCACCAAGGAAATAAAGACTCAAGCC
1681 ATTTAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::|||  |  ||||||| 
Target 5' tatATGCCACGG--ACACTCCt 3'
80 - 99 151.00 -13.10
2
miRNA  3' guuuguggUAACAGUGUGAGGu 5'
                  |||  ||||||:| 
Target 5' cggggaggATT-CCACACTTCc 3'
281 - 301 133.00 -10.90
3
miRNA  3' guuuGUGGUAAC-AGUGUGAGGu 5'
              ||| |  | |||| |||| 
Target 5' ctccCACGACGGCTCACCCTCCc 3'
1369 - 1391 126.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30143265 35 COSMIC
COSN31539558 93 COSMIC
COSN20079613 106 COSMIC
COSN24294783 359 COSMIC
COSN8262871 450 COSMIC
COSN23426868 498 COSMIC
COSN27378284 503 COSMIC
COSN23919966 686 COSMIC
COSN23889489 690 COSMIC
COSN17745300 936 COSMIC
COSN6148359 1044 COSMIC
COSN15237753 1125 COSMIC
COSN6670101 1173 COSMIC
COSN31609667 1338 COSMIC
COSN31601119 1344 COSMIC
COSN26552446 1499 COSMIC
COSN31539541 1537 COSMIC
COSN29512393 1548 COSMIC
COSN29512003 1550 COSMIC
COSN31932784 1603 COSMIC
COSN20115235 1678 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs377149734 6 dbSNP
rs1391071188 7 dbSNP
rs1470243695 8 dbSNP
rs1327019795 10 dbSNP
rs750778881 11 dbSNP
rs1405992565 12 dbSNP
rs1283034528 15 dbSNP
rs200986019 16 dbSNP
rs780465189 17 dbSNP
rs753964131 20 dbSNP
rs1339401741 21 dbSNP
rs923486350 25 dbSNP
rs1249240595 29 dbSNP
rs755167536 31 dbSNP
rs144896081 32 dbSNP
rs760188373 35 dbSNP
rs1241339146 36 dbSNP
rs546075799 38 dbSNP
rs758290122 39 dbSNP
rs373498221 40 dbSNP
rs1203061000 46 dbSNP
rs1373721955 46 dbSNP
rs1274157536 49 dbSNP
rs371259653 49 dbSNP
rs770562121 50 dbSNP
rs1166212766 60 dbSNP
rs754981373 63 dbSNP
rs1425501646 64 dbSNP
rs751583219 65 dbSNP
rs1302951109 68 dbSNP
rs1343986340 73 dbSNP
rs1489123637 86 dbSNP
rs1185486703 87 dbSNP
rs776320752 88 dbSNP
rs1256604440 89 dbSNP
rs147529856 90 dbSNP
rs745536499 91 dbSNP
rs1226144708 94 dbSNP
rs769231007 95 dbSNP
rs139917094 96 dbSNP
rs762335908 99 dbSNP
rs1052216847 101 dbSNP
rs1290798662 105 dbSNP
rs550862342 106 dbSNP
rs1188219411 108 dbSNP
rs1262407473 109 dbSNP
rs1427841421 110 dbSNP
rs749371538 114 dbSNP
rs1022514732 115 dbSNP
rs1445506023 117 dbSNP
rs1163100428 119 dbSNP
rs1348518026 120 dbSNP
rs1455732676 121 dbSNP
rs1012360297 122 dbSNP
rs1246292600 126 dbSNP
rs1384925129 128 dbSNP
rs1381001721 132 dbSNP
rs1294799723 133 dbSNP
rs773597296 138 dbSNP
rs1246261392 144 dbSNP
rs1002508527 146 dbSNP
rs761012383 147 dbSNP
rs1311873461 152 dbSNP
rs1402827887 169 dbSNP
rs1367233050 172 dbSNP
rs1305125399 174 dbSNP
rs1355587731 175 dbSNP
rs1363297997 177 dbSNP
rs1157085831 178 dbSNP
rs1416046891 185 dbSNP
rs1005988944 186 dbSNP
rs1014592498 197 dbSNP
rs1214353450 199 dbSNP
rs35156721 203 dbSNP
rs770965040 203 dbSNP
rs962188043 209 dbSNP
rs976217289 210 dbSNP
rs1209048361 214 dbSNP
rs547858422 215 dbSNP
rs953615379 218 dbSNP
rs1217358294 219 dbSNP
rs142795219 220 dbSNP
rs534115860 224 dbSNP
rs1221626306 225 dbSNP
rs914594383 225 dbSNP
rs947344979 226 dbSNP
rs977543566 243 dbSNP
rs924653622 244 dbSNP
rs1387553433 250 dbSNP
rs1384588771 253 dbSNP
rs1287160075 261 dbSNP
rs935192510 262 dbSNP
rs933683859 265 dbSNP
rs1056304471 268 dbSNP
rs896434269 270 dbSNP
rs947979819 272 dbSNP
rs772370806 274 dbSNP
rs1479747472 275 dbSNP
rs377706967 277 dbSNP
rs1187025183 282 dbSNP
rs374544123 283 dbSNP
rs1014665694 286 dbSNP
rs897570586 292 dbSNP
rs997668028 293 dbSNP
rs1187924367 295 dbSNP
rs558601196 296 dbSNP
rs1261971088 301 dbSNP
rs953647558 302 dbSNP
rs13730 303 dbSNP
rs537654671 310 dbSNP
rs556278157 312 dbSNP
rs1226478243 313 dbSNP
rs1324502514 319 dbSNP
rs1293642603 326 dbSNP
rs1384152985 333 dbSNP
rs574242794 348 dbSNP
rs1365940427 350 dbSNP
rs1043585651 362 dbSNP
rs905049968 363 dbSNP
rs1173702775 366 dbSNP
rs72976224 366 dbSNP
rs1436053109 367 dbSNP
rs1461754563 378 dbSNP
rs553387095 382 dbSNP
rs968753325 385 dbSNP
rs1194793679 387 dbSNP
rs977419112 390 dbSNP
rs1449767490 391 dbSNP
rs924725460 397 dbSNP
rs1034936164 403 dbSNP
rs1181271454 408 dbSNP
rs938736374 410 dbSNP
rs34594434 412 dbSNP
rs1462573457 413 dbSNP
rs1256724734 414 dbSNP
rs1325342300 414 dbSNP
rs1195184158 418 dbSNP
rs1337142240 420 dbSNP
rs992017617 425 dbSNP
rs1430709303 426 dbSNP
rs1229884317 428 dbSNP
rs1343196534 431 dbSNP
rs1314426466 432 dbSNP
rs917774721 434 dbSNP
rs1271256654 435 dbSNP
rs1335375543 435 dbSNP
rs947851799 436 dbSNP
rs1232492467 437 dbSNP
rs1394778907 437 dbSNP
rs112168163 446 dbSNP
rs887688043 450 dbSNP
rs182220058 451 dbSNP
rs993465345 453 dbSNP
rs1035972848 456 dbSNP
rs1446476750 458 dbSNP
rs897601563 460 dbSNP
rs1216457986 462 dbSNP
rs1243736880 466 dbSNP
rs997237100 467 dbSNP
rs1192710410 469 dbSNP
rs2072105 470 dbSNP
rs1455358346 471 dbSNP
rs1156431656 474 dbSNP
rs952146516 475 dbSNP
rs1244071376 479 dbSNP
rs1383671914 479 dbSNP
rs112420088 480 dbSNP
rs1008103700 483 dbSNP
rs1319585271 484 dbSNP
rs1284922906 485 dbSNP
rs1391401200 486 dbSNP
rs1006739497 487 dbSNP
rs1439165167 490 dbSNP
rs1365370533 491 dbSNP
rs879364211 494 dbSNP
rs1372168176 495 dbSNP
rs969371254 498 dbSNP
rs1413887020 499 dbSNP
rs1157549576 502 dbSNP
rs1277970395 502 dbSNP
rs998886947 503 dbSNP
rs62134284 504 dbSNP
rs1224360580 508 dbSNP
rs1479953735 508 dbSNP
rs564637582 515 dbSNP
rs1286273280 518 dbSNP
rs146717515 522 dbSNP
rs1212983764 526 dbSNP
rs2057713 527 dbSNP
rs1253453194 529 dbSNP
rs1017674581 530 dbSNP
rs760954924 536 dbSNP
rs1469627472 542 dbSNP
rs1348672275 543 dbSNP
rs1290702563 545 dbSNP
rs1179266563 546 dbSNP
rs1362813257 551 dbSNP
rs1287057025 552 dbSNP
rs1345201255 552 dbSNP
rs965280083 554 dbSNP
rs1350146939 558 dbSNP
rs992927166 560 dbSNP
rs1398400548 565 dbSNP
rs1386508674 566 dbSNP
rs1470215117 566 dbSNP
rs1159725281 570 dbSNP
rs1469286848 574 dbSNP
rs535149517 575 dbSNP
rs1201380386 576 dbSNP
rs1479112013 578 dbSNP
rs976273374 581 dbSNP
rs1192778352 587 dbSNP
rs543657401 589 dbSNP
rs1331799655 590 dbSNP
rs113588713 594 dbSNP
rs113895885 599 dbSNP
rs1323521993 605 dbSNP
rs1460391139 611 dbSNP
rs956268483 612 dbSNP
rs1325801903 613 dbSNP
rs553166668 614 dbSNP
rs1395723735 618 dbSNP
rs1428218753 622 dbSNP
rs1327674158 624 dbSNP
rs1320709697 633 dbSNP
rs987834682 634 dbSNP
rs574789944 635 dbSNP
rs1388846845 638 dbSNP
rs1414775796 642 dbSNP
rs1418546660 647 dbSNP
rs796614275 648 dbSNP
rs913551112 649 dbSNP
rs754136523 653 dbSNP
rs1249969690 654 dbSNP
rs112534095 658 dbSNP
rs1327127676 660 dbSNP
rs1460949612 661 dbSNP
rs867598870 662 dbSNP
rs1239861713 666 dbSNP
rs946378983 668 dbSNP
rs1272826932 670 dbSNP
rs1212425699 678 dbSNP
rs1043878432 679 dbSNP
rs1297655313 686 dbSNP
rs1451225278 687 dbSNP
rs981004803 688 dbSNP
rs1290360693 690 dbSNP
rs1304460196 691 dbSNP
rs184349924 702 dbSNP
rs1326677253 703 dbSNP
rs941932964 705 dbSNP
rs1232650244 709 dbSNP
rs1392306089 710 dbSNP
rs1169486559 714 dbSNP
rs145597354 715 dbSNP
rs1383462273 719 dbSNP
rs1056221427 720 dbSNP
rs138119623 724 dbSNP
rs932952764 727 dbSNP
rs1232641413 729 dbSNP
rs73506019 731 dbSNP
rs1249393156 734 dbSNP
rs140848095 735 dbSNP
rs1212596025 741 dbSNP
rs887789042 744 dbSNP
rs1183518859 753 dbSNP
rs764406871 754 dbSNP
rs1006188807 760 dbSNP
rs1007763610 761 dbSNP
rs764698190 764 dbSNP
rs1043605828 770 dbSNP
rs866853874 777 dbSNP
rs557234006 785 dbSNP
rs999127170 787 dbSNP
rs998127955 790 dbSNP
rs142713124 794 dbSNP
rs937430625 800 dbSNP
rs1167057051 804 dbSNP
rs1031899855 808 dbSNP
rs188330446 814 dbSNP
rs1407831805 819 dbSNP
rs570658815 821 dbSNP
rs989079903 828 dbSNP
rs1473738298 841 dbSNP
rs1014260856 844 dbSNP
rs1489756994 845 dbSNP
rs1166448427 846 dbSNP
rs914797894 847 dbSNP
rs772880548 848 dbSNP
rs1304704046 850 dbSNP
rs968124469 851 dbSNP
rs979080011 855 dbSNP
rs1282476498 856 dbSNP
rs926402986 858 dbSNP
rs538142696 865 dbSNP
rs1295528223 866 dbSNP
rs980652887 890 dbSNP
rs755347302 892 dbSNP
rs917769251 893 dbSNP
rs868466776 895 dbSNP
rs1459336284 896 dbSNP
rs1413152698 899 dbSNP
rs1199192490 901 dbSNP
rs201663550 904 dbSNP
rs1414198593 906 dbSNP
rs909055089 908 dbSNP
rs963150800 910 dbSNP
rs971961296 913 dbSNP
rs376614890 917 dbSNP
rs1006674276 918 dbSNP
rs370540023 920 dbSNP
rs933029539 923 dbSNP
rs1051859851 926 dbSNP
rs1206903282 934 dbSNP
rs1303593634 936 dbSNP
rs910334060 941 dbSNP
rs1387578674 944 dbSNP
rs1361342892 948 dbSNP
rs1030396653 952 dbSNP
rs1437860063 957 dbSNP
rs1390077782 963 dbSNP
rs1277698515 964 dbSNP
rs766221303 965 dbSNP
rs1042789057 966 dbSNP
rs546078084 972 dbSNP
rs1258832781 974 dbSNP
rs1464976712 981 dbSNP
rs1242411909 985 dbSNP
rs904702682 987 dbSNP
rs1346790377 998 dbSNP
rs1256426760 1004 dbSNP
rs549753974 1005 dbSNP
rs1053368209 1007 dbSNP
rs567900736 1008 dbSNP
rs562106000 1009 dbSNP
rs557962524 1010 dbSNP
rs1462785649 1014 dbSNP
rs1170743836 1017 dbSNP
rs1014291909 1021 dbSNP
rs772618778 1022 dbSNP
rs959276851 1027 dbSNP
rs1023369414 1032 dbSNP
rs991885783 1035 dbSNP
rs917633443 1036 dbSNP
rs1313637431 1040 dbSNP
rs905840101 1044 dbSNP
rs1381411891 1048 dbSNP
rs571772157 1054 dbSNP
rs1479547307 1062 dbSNP
rs929146070 1063 dbSNP
rs1207560278 1064 dbSNP
rs1342951280 1065 dbSNP
rs539069763 1066 dbSNP
rs1326839171 1070 dbSNP
rs909156009 1078 dbSNP
rs1230277800 1082 dbSNP
rs1016983351 1083 dbSNP
rs963184292 1087 dbSNP
rs1342837787 1089 dbSNP
rs1211153428 1096 dbSNP
rs370737835 1097 dbSNP
rs1369101741 1104 dbSNP
rs754876312 1105 dbSNP
rs954616613 1106 dbSNP
rs987180059 1108 dbSNP
rs767538118 1112 dbSNP
rs1450498374 1115 dbSNP
rs1473723232 1120 dbSNP
rs576710343 1129 dbSNP
rs575826926 1131 dbSNP
rs1471446883 1132 dbSNP
rs1051856123 1135 dbSNP
rs1174474798 1137 dbSNP
rs1289218051 1138 dbSNP
rs891845100 1140 dbSNP
rs73506022 1145 dbSNP
rs934849186 1146 dbSNP
rs1385506180 1150 dbSNP
rs904799317 1152 dbSNP
rs1053266282 1153 dbSNP
rs1323724534 1156 dbSNP
rs115890931 1158 dbSNP
rs541604339 1161 dbSNP
rs959040892 1171 dbSNP
rs1044621322 1172 dbSNP
rs35799448 1173 dbSNP
rs370642630 1175 dbSNP
rs746041465 1182 dbSNP
rs983277314 1184 dbSNP
rs758620145 1186 dbSNP
rs1413869448 1187 dbSNP
rs1260658182 1189 dbSNP
rs1182699358 1196 dbSNP
rs909027675 1197 dbSNP
rs1246306158 1198 dbSNP
rs1197032935 1208 dbSNP
rs1453343211 1213 dbSNP
rs1017472519 1214 dbSNP
rs1208644269 1221 dbSNP
rs1327749864 1226 dbSNP
rs1270386733 1228 dbSNP
rs1465800691 1238 dbSNP
rs941834988 1246 dbSNP
rs180801604 1249 dbSNP
rs11666961 1255 dbSNP
rs921809498 1264 dbSNP
rs1331161714 1265 dbSNP
rs993321543 1269 dbSNP
rs1026088261 1272 dbSNP
rs1390687213 1273 dbSNP
rs954524543 1276 dbSNP
rs1159861183 1283 dbSNP
rs987807823 1284 dbSNP
rs1469041516 1294 dbSNP
rs1422815922 1295 dbSNP
rs1468296976 1299 dbSNP
rs1192028857 1300 dbSNP
rs1017487067 1303 dbSNP
rs917278567 1304 dbSNP
rs933309639 1305 dbSNP
rs1051761851 1321 dbSNP
rs964736500 1328 dbSNP
rs528884635 1329 dbSNP
rs1158390803 1331 dbSNP
rs978449820 1337 dbSNP
rs1250400249 1338 dbSNP
rs1209908498 1340 dbSNP
rs1442141406 1345 dbSNP
rs1364449035 1348 dbSNP
rs1220569309 1354 dbSNP
rs1345345195 1357 dbSNP
rs1458804721 1358 dbSNP
rs925720491 1372 dbSNP
rs551531635 1376 dbSNP
rs988536277 1377 dbSNP
rs904705435 1378 dbSNP
rs374577132 1379 dbSNP
rs950210150 1380 dbSNP
rs531544129 1384 dbSNP
rs1056055129 1387 dbSNP
rs550029802 1394 dbSNP
rs80087121 1396 dbSNP
rs1168230225 1401 dbSNP
rs1390457707 1402 dbSNP
rs529066927 1403 dbSNP
rs769061060 1404 dbSNP
rs1230818843 1410 dbSNP
rs1189756428 1415 dbSNP
rs1271783052 1418 dbSNP
rs941391898 1419 dbSNP
rs1038322912 1420 dbSNP
rs1248673588 1422 dbSNP
rs1479817266 1429 dbSNP
rs185604599 1435 dbSNP
rs1004653510 1436 dbSNP
rs1252689956 1437 dbSNP
rs1297778282 1445 dbSNP
rs994233908 1451 dbSNP
rs1051099547 1453 dbSNP
rs1227642332 1455 dbSNP
rs1376947068 1461 dbSNP
rs890295657 1466 dbSNP
rs1448429703 1468 dbSNP
rs565438325 1473 dbSNP
rs1428121973 1475 dbSNP
rs1008693389 1478 dbSNP
rs963250260 1479 dbSNP
rs1017979025 1483 dbSNP
rs964644193 1494 dbSNP
rs1184119816 1496 dbSNP
rs539516218 1498 dbSNP
rs1046245 1502 dbSNP
rs1251622685 1503 dbSNP
rs1179566193 1506 dbSNP
rs1483855910 1509 dbSNP
rs557507281 1512 dbSNP
rs1046253 1514 dbSNP
rs1220120606 1519 dbSNP
rs537372081 1524 dbSNP
rs1352532218 1528 dbSNP
rs1291855368 1529 dbSNP
rs1349632654 1532 dbSNP
rs1461215167 1532 dbSNP
rs1286296800 1534 dbSNP
rs987496211 1537 dbSNP
rs71335266 1539 dbSNP
rs15490 1542 dbSNP
rs1352512017 1547 dbSNP
rs190017883 1559 dbSNP
rs988565701 1564 dbSNP
rs868316643 1566 dbSNP
rs574343984 1568 dbSNP
rs1351834761 1572 dbSNP
rs1412330859 1578 dbSNP
rs946005002 1586 dbSNP
rs916961249 1608 dbSNP
rs1411650891 1612 dbSNP
rs1355304573 1613 dbSNP
rs1473788185 1632 dbSNP
rs1252037655 1633 dbSNP
rs887331832 1635 dbSNP
rs1487183960 1638 dbSNP
rs1005695370 1640 dbSNP
rs765810356 1640 dbSNP
rs972010873 1643 dbSNP
rs1222209548 1647 dbSNP
rs1038527914 1648 dbSNP
rs1229386733 1653 dbSNP
rs937565221 1668 dbSNP
rs1056361790 1672 dbSNP
rs200850780 1674 dbSNP
rs143269437 1675 dbSNP
rs112808207 1676 dbSNP
rs33916887 1676 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*