miRTarBase - #MIRT023369 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TRAM2   
Synonyms -
Description translocation associated membrane protein 2
Transcript NM_012288   
Expression
Putative miRNA Targets on TRAM2
3'UTR of TRAM2
(miRNA target sites are highlighted)
>TRAM2|NM_012288|3'UTR
   1 GGCCAAAGTGCTAAGAACAGGAATCCTCTTGGTGGGGGCCGAGCAGGGGGCAAGGAGCCCAGGCCCCCTCCCTGCCTCCT
  81 CCTTCCTGCCTGTGATGCTCCGTCTCAAACAGCCGAAACCTGTCTTGCAATGGGGGGAGGGGGCGTTTCGCTTTCCTTCT
 161 TCTTGGCTTCCTCTTATTCTTCCACAAACCATTCTCAATAAAGCCAAAAATCTTTCTCTTTCTCCCCCTCAGGCCACCTC
 241 CTGTCCTCACTCCTGTCCTGTGCTGGCTTTTCTGGAACGCCAGGCGCCCATGGCTGGCACCTTTCTGCTTGCTCTGTCTC
 321 TTGCCTTATGGCTGCTGCTTTTCCTTTTTACTTCCTATTTTCACCTTATCTTGCAATTTTTCTGTCTGATTTTTACAATG
 401 GGAGGGGAGCTAAGATTGCAGTCCTGTCCTTCGGTCCCCCAGGGCCTGCCGGTCAGAAGCCTGGGGCTGGTAGGCCCTTG
 481 GTGGTCCTCATGTGGATGGGCAAGAAGAGAGCGGCCATCTCGGATCATAATCTCCTTGGTGCTGATTAACTGACGAGATA
 561 TATGATTCCAGTTCTGCATGTACCATCTTGAGGCACAGCAGCCACTGCTCGTTGTAAATGCCAAGGCATTTGGCTTTGGG
 641 ACGTGACAACTCAATCCAGAAGGATGGTGTGAACTCGGTTGGGTCCCGTGACTCGAGCTCCTACCAGTGGCTGGCCGCGG
 721 ATTGGAAGCCAGCCTGCTGTCGCTCTGTGGGGGGGGACACGTCTTCCCACTGCTTAGAGCGAGAGCAGAGCAAACTGCGC
 801 AGCAGGCACCTCCAGAAAGGTAATGGTGGCAGAACCCACAGTGGAGTCGACCTAGGCCTTTCTCCAGCAGTCCCAGTCGC
 881 CATTGCTTTTTCAGCCATTCACAAGCATTCAAAACCAAACCAAACAGCAGTTCATATACCTGCCTGAGATAGGCTGGTCC
 961 TCACCTCCAGAGCCAGCCAGCCCCGTCAGGGGCCAAACTTACTACCTTGACTTCATCTCTAGCTGCAGAAACACTAAGTC
1041 TCAAGGGCTTCAGCCCCATGCTGGTCCCTTGGTGTTCAGGGAGGGTCACTTGGACCGCTGTTCATCTGGCCGCCCTTGTT
1121 GAGTGTTCTTTGGAATTGTCGTTTTTTGAGCACAACTACAGCATTTTAGACTGCATGAAACCATGACTGACTGAGAGTCA
1201 CTCTCTGGGTAGATGATAGGCGCCTTTCTGGCCCCTTCCCTCACAGATTCTTTCCCCTCCCCTCCACCTGAAGAGAAGGC
1281 CTCCAAGTCCTTTTGGTGCCTTGTGAGGACTTTTAGAAGGGGCGTTCAGCTTTAAAAAGCCGGTCCTAATTACGGCCGGA
1361 CGCAGTAGCTTACGCCTGTTATCCCAGCACTTTGGGAGGTCGAGGTGGGCAGATCACCTGAGGTTAGGAGTTCAAGACCA
1441 GCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGGTGTAGTGGCAGGCACCTGTAATCCCAGC
1521 TACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCTAGAAGGCGGAGGTTGCAGTGAGCGGAGATTGTACCATGGCACT
1601 CCAGCCTGGACAACAAGAGCGAAATTCTGTCTAAAAAAACAAAAGTCCCAATTAAGAACCTCCGAACTCTGTTTTGAGGC
1681 AAAGGGGAGTAGTTCTTGGTAGGTGCAGGAATAGTAGTGTCATTTGGAATACTGGTCATCTTTCTGACATCACAGTAGAA
1761 ACCAAACCTTGGATTTAGATTCAAAAGGGGGGAAATGGGTCTTTTCATCAAGGCAACTCCCCTTCTCCAAGTCACTTACA
1841 TCATAGATAAATTTTAGCTTCCCAGTAACTGAGGGATTTGTTTCCTAACGCCATTGGAGGCCTTCATCCCTCTCTACGAT
1921 AAGGTTGCAGAAATGGGAAGAGCTACCCGTGGTTGCTTTTGATTACCCTTAGGAAGTGAGACAGTGTTTTTGAAAATATG
2001 TATTTCCCCCATTTCTCCCTCTCCTTCCCTGACACTTCTCTGGGCTGCACAGCAGAAACGTTGGTAAAAGGGCAGTTTGG
2081 TTTCAACACAGCAGACCTGATATGGGATCCCTTAGCCACTTTAGTCAAACAGCCCTGACAGAGTCTATAATTGAGTTCAG
2161 GCCCCCCACCTTGCCTAATAACTGCAAATCGCATGTTCAGCCAGCAGCCTCCTAAGCCCACCTTCCTCCCCCATTAGAGA
2241 ACACCCATCCTAGGTGCTCTCCAGGCTGTGTCATTGGCAGGGCTTCACATGCAGGAGGCCTCTCTCAGGTGAGTCCAGGT
2321 TAAACTGTTGAGTTGTGGCTTCAACAGATATGTATGGCATGCTGGGATGTGCCAGGTGCCTGCGTTGTGCCAGTTGCTGG
2401 AGAGGTAGTGTGAGCAGAGCAGCTGAAATCTTGCCATCAAGCAACCCTCATTCTCATGCCTGTAGGTTTCCATTGCTCTG
2481 TCCCAGGACACTTGCGTGCCAGAGACGCCACAACTTCATGTCCCTGTCTCTTGCAAGCTCCCCGTGCTGCCAGTACTTCA
2561 TGCCTTGGATGTGGTCCCACCAGCCCAGTGGCCGGGGTCAGCTTAGGCTCTGCTTCCCAGTGGACGGGTGTGCTAAGGGT
2641 TTATTTTATGTAAAAAAAAAAAAAAAAACAAAAAAAAACCCTGAGACCATGAGTGGGGCTGGCATCTTGCCAGCCTGGGC
2721 TTCAGGGATGTTTGGGGGGGGTGGTTAGAGGGTAGTTGTAGGGTACTTTGTCACCCCCCTCCCCCTGCCACCCTCCCTGG
2801 CACGTTTATTTCACAGCAGAGCCAAGTCTGTGGCAGGTTGACACAGACTGTGTTGCCAGAGCTGAAATAATTCCACTTCA
2881 TCCTATGAGCGTGTTGGGCTAGCTTGTTCTAATTTTGGCCACTTTGGCTGTTTTCTTCAGTTTTATGCATTCTCTCCTGC
2961 CCCAAAGTGCCAAGCCATTTGTGAAGGCTCTGCCAGACACCTCCAAGCTTGAGAGCTCAGCACCATGCACCAAGAGCAGG
3041 AGAAAAGACGTAAACCTACCCCAGCAACTGTGGCCTCTCGACAGCCCTGGCTAACTAACTTACATTTGTGGGGAAGCCAA
3121 CAGACACAGCAGGAGGAGAGGGAGGTGGCGCTGGTGGACCAAGGATCTGTGCTACCCGCTCCCCTCCTTGGAGGTGCAGT
3201 GATGATGGGAGTTATTTTTACCATCCGGGCGCTGATAGCTGCACTATTAATAAATTGCATGTGTTCCTTTTGAAGGTAGG
3281 GGATGGTTCTGGGTGAGAGGGGAGCAGGCTGAGCCGGCGGGGGATCTGCTGTCCTCCCTTTTGAGTCAGTTCTAATCCCA
3361 TGTGTGTCTGGGCCACCAGACCGAAATGGTTGCTGAGAAACTTGTCTGTTCATGTCCCAAGGCATAACTTCCCAACATTT
3441 AAGAAACCCCAATAGACACCTCTGCCCTGGCCACGTTCACAGATCCTTCTCTTGACCGGAAACCCTGGGACCCTAAGAAC
3521 CCCTGAAGCTTGGGGTGGGTGTGTGCTTCTGGGGTCTCTTTTGGGACCTCCTTTGTCAGTACCCCTTCTTTTTTCTAAGC
3601 AGCTAATAAGAGGTTGGGTGAAAGAGTGCATCTCCTCCCAGGATTCCACAACAAAATTCTTATCTTCCATGGATGCTTTA
3681 ATTGGAAGTGGGTTGCCGACCCCCTTGTGCCTAGAAAAGGCCTTCGCTTGGGTTTCCTTTGTATGCTTCAGCCTTCCTAG
3761 TTGGTTTTTCTAGGCCTGGTGTGAGAGGTAGGGAAGTCTGCACATAACTAATTCTTTTGCTTAAGGGCCTATGGCACAAG
3841 TGCACAAACTTCAATTCTTGATGTTCTAAGCTCTCTCCTCTAACAGAGGGAGTGCTGAAAGCTTTTGAGTCAAGACAATG
3921 GAGTGCTCTTCCTCCCTCACTCTGCCTTCCGAGCTTATGGTTCCTTTTCTCAGGAGAGGATTTTCAGGATTATTGGAGGA
4001 TTAGGTCATTGTCAGATGACTGGAAAACCTAAATAGGATCTCTCTCCAGCTCAAGGTTGTCCCAGTGAGGAAGACTTTAC
4081 CAACTTCTCACTCTACCCCACTACTCACATGAGTGTTAGCTCCACCTTGCAAAGGCTGAAGACCAGTTCTCCCCAGTGAA
4161 AGCTGCCTCATTCTTTTATGGAGTTCCCTGGAGTGGCAGAGCTATAAAGACGAGCATTGGGATTTGCAGTCTCCATGTAG
4241 CCTTTCGTGCTTGGCAACCCCTGTAGACTTTTTGTCCCAAGCAGATTGCGTGCGTGCGCCTGTGTGTGAGAATAAGTGCC
4321 TTACTTTGCTGTGTGGTTTTCAACTTGTACTCCGTGGCCAGCCCCCAGTTGCCAGGGCTCGACGGCAGCCAAGGACACCA
4401 TACCTCAGTATAGTTATATATAAAAGGGACACGGATTGTGACAGTTTCACCCCATTTGTTTCTAACCCCGCTGCCCAGGA
4481 TTAGGGTCTGTGGTGTGTTCTGTTTTGTTTTTGGTTTCTCCCTTGTGTCAGTTCTCTTCTGGCCCAGCTGGGTGGCTGTG
4561 GAAGTCTGTGAGGTGGCCCAACCACAAGCATACCTATTAAGAGAAGCCCAGAGCTTCCAGCCCCCACTTCGAAAACTCTC
4641 CTCTGGCCCCACATAGCAAACTCCTTCTCCGTTATTTTCCCCACCCCCAGATTTTTTTTAAAAGGCCCACTTGCCGTAAC
4721 CTCTTTTGGTCTATTTTGCTTCCCATTCAGCCCAAAGTTTATATGATAAAGGTGTTTACTTTTACTTCCCAGTCTCCAAG
4801 TGCTAACACATAAACACATACATGTCTGACTGTTGCAGAACTGTTCGAGCTCCTAATTCAGTGTTACCTTGTTTTAGTCG
4881 CAGCAACCCTCTCCCCTACCCCTTGCCCGCCCACGTTTTTCTCACTCTTCCGGGTTGTGCAATAACTCTCCCAGCCAGTG
4961 GTCCTTTCCACAGCCTTTCTGTCCCTTAAAACACCTGCAACTGGGGGAGAAATGGGACCCATGGGAGGGGGAGTCGTCAT
5041 CCCTTACACAAGAAATAGCCACTTTCCTTTTGTTGTCATTCTTGTGATCCTGGGTGGGTTTCTGTGGCACTCTTTTAGAA
5121 CATGTAGCATCATCTTAGAGGTCTATTTTTAAAAAATGTGTTGAAGAGGAAAAAACCATTCTCACGATGGGGCTTAAGTC
5201 ATTGTCCAGGAATAAGATTGGCGTGGTGCCCATGACATCACCGTCACTCTGCCTAAAAGCACTCTAGAGCTACTTGTTCA
5281 CGTGGAGAGGAAGGATATTTTGCGAAGCAACAGCCGCAGGTGGAGAGCCCTGTTCACCTGATAGGGTCTAGCTGTGACAG
5361 TAAATATAATACCGCTGTTTCCTTGGGTACAGATTTGAGTGTTCATGTGATGAGACTGTAAACCTCATTTTTCGGTTCCT
5441 CTGTTTAAAAAAACATCTGAAGGATGAACTAAGGCTGCTGGTGCCCTGAGCAACTGATAATGCAAATGTGGACAAAGTGT
5521 CTGTTTTCTACTCTAGCCTGTTCATATGGACCAAATTTCAACAAGGAACTCAAGGAAAATTTGTACCTGCCGTATTTATG
5601 CTTTCATGTAAAAAAGGGTTGGGGGGAGGGGTGTCTTTTTGCTTTTGGTGAACTTTTTTTCAAAATCATTTTTCCACTGT
5681 TTCTGTCTGGTTTTAAAACAAATTACAGTTTTGTATGGATTTTTTAAATGTACATTTTGGAACAAATGATCAAATATTTT
5761 CTGAAATAACAATAAAAGGCAGAAAATTATCAGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ::|||| ||  :|||||| 
Target 5' attGTACCA-TG--GCACTCCa 3'
1585 - 1603 138.00 -17.60
2
miRNA  3' guuuGUGGUA--ACA-GUGUGAGGu 5'
              |||| |  ||| | |||||| 
Target 5' aggcCACC-TCCTGTCCTCACTCCt 3'
231 - 254 127.00 -18.00
3
miRNA  3' guuuGUGGUAA--CAGUGUGAGGu 5'
              | || ||   | |||||:| 
Target 5' ccctCTCC-TTCCCTGACACTTCt 3'
2017 - 2039 127.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26664560 4 COSMIC
COSN30456068 37 COSMIC
COSN31562418 38 COSMIC
COSN4928207 40 COSMIC
COSN26999621 41 COSMIC
COSN30517308 55 COSMIC
COSN30494363 62 COSMIC
COSN30449239 85 COSMIC
COSN30141714 89 COSMIC
COSN30101205 99 COSMIC
COSN8798177 102 COSMIC
COSN30107920 115 COSMIC
COSN30115626 115 COSMIC
COSN30484980 135 COSMIC
COSN30135622 144 COSMIC
COSN31582145 216 COSMIC
COSN7052433 335 COSMIC
COSN8401206 433 COSMIC
COSN20102945 749 COSMIC
COSN9908909 940 COSMIC
COSN16936502 1024 COSMIC
COSN17616491 1141 COSMIC
COSN27976370 1315 COSMIC
COSN32062451 1342 COSMIC
COSN21063123 1890 COSMIC
COSN27031966 1928 COSMIC
COSN19073073 2495 COSMIC
COSN20351017 2664 COSMIC
COSN27272803 2669 COSMIC
COSN20457042 2673 COSMIC
COSN28639417 4267 COSMIC
COSN31491029 4284 COSMIC
COSN22079943 4297 COSMIC
COSN25662835 4589 COSMIC
COSN20091399 4640 COSMIC
COSN31545076 4871 COSMIC
COSN22840531 4876 COSMIC
COSN21301876 4893 COSMIC
COSN27671531 4898 COSMIC
COSN26641389 4900 COSMIC
COSN24301493 4915 COSMIC
COSN24301890 4916 COSMIC
COSN31488918 5024 COSMIC
COSN28228876 5223 COSMIC
COSN6323975 5358 COSMIC
COSN31590866 5375 COSMIC
COSN23607703 5450 COSMIC
COSN31572108 5516 COSMIC
COSN28771352 5590 COSMIC
COSN31518310 5591 COSMIC
COSN30538482 5661 COSMIC
COSN30538485 5667 COSMIC
COSN5632035 5712 COSMIC
COSN30538488 5751 COSMIC
COSN30174964 5761 COSMIC
COSN31520438 5790 COSMIC
rs2073183 1233 GWAS
rs9367486 4630 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773921830 1 dbSNP
rs1183755476 4 dbSNP
rs1460611822 6 dbSNP
rs200800334 9 dbSNP
rs201682217 12 dbSNP
rs781673799 18 dbSNP
rs769056221 19 dbSNP
rs375684959 25 dbSNP
rs370974185 26 dbSNP
rs758876031 28 dbSNP
rs1315837115 29 dbSNP
rs746067201 31 dbSNP
rs1205157072 37 dbSNP
rs368132280 40 dbSNP
rs1000688924 41 dbSNP
rs760429934 41 dbSNP
rs1300233806 44 dbSNP
rs757323296 48 dbSNP
rs1037724613 49 dbSNP
rs1431712663 53 dbSNP
rs1195568726 62 dbSNP
rs1222082951 65 dbSNP
rs575236610 70 dbSNP
rs1166656522 72 dbSNP
rs747181489 76 dbSNP
rs1356013023 78 dbSNP
rs1372719397 79 dbSNP
rs1023671644 84 dbSNP
rs1388102445 87 dbSNP
rs1388209357 92 dbSNP
rs41273846 98 dbSNP
rs889204235 101 dbSNP
rs749707167 102 dbSNP
rs147322476 110 dbSNP
rs1005109696 114 dbSNP
rs933407467 115 dbSNP
rs1365176114 122 dbSNP
rs886676341 133 dbSNP
rs1448963761 134 dbSNP
rs1049724945 137 dbSNP
rs1186553663 139 dbSNP
rs1156498987 143 dbSNP
rs1421536135 144 dbSNP
rs923133112 145 dbSNP
rs3032 150 dbSNP
rs1195000461 158 dbSNP
rs772490131 165 dbSNP
rs1326181794 176 dbSNP
rs1039476880 177 dbSNP
rs1252365440 182 dbSNP
rs945998384 182 dbSNP
rs1387210490 189 dbSNP
rs144061637 207 dbSNP
rs1290156388 210 dbSNP
rs1209119193 212 dbSNP
rs914451391 215 dbSNP
rs1486730472 218 dbSNP
rs989835518 219 dbSNP
rs1262657616 220 dbSNP
rs958326595 221 dbSNP
rs1464647722 225 dbSNP
rs926943576 226 dbSNP
rs1206880387 231 dbSNP
rs1243973219 241 dbSNP
rs536075112 242 dbSNP
rs981211866 243 dbSNP
rs1486150568 245 dbSNP
rs1181211985 246 dbSNP
rs567325314 248 dbSNP
rs1165142986 254 dbSNP
rs550897135 255 dbSNP
rs9474231 258 dbSNP
rs1455358926 260 dbSNP
rs1236649593 261 dbSNP
rs375107064 265 dbSNP
rs923871204 276 dbSNP
rs371965755 278 dbSNP
rs1387612779 279 dbSNP
rs1286717113 284 dbSNP
rs1016892473 285 dbSNP
rs1006463136 286 dbSNP
rs1359432631 287 dbSNP
rs532517528 290 dbSNP
rs1286350259 292 dbSNP
rs560604709 294 dbSNP
rs1317608353 297 dbSNP
rs1209271460 305 dbSNP
rs1235690307 307 dbSNP
rs967908078 308 dbSNP
rs1452105889 312 dbSNP
rs1188360045 313 dbSNP
rs41273844 318 dbSNP
rs1471369009 324 dbSNP
rs1189159941 329 dbSNP
rs1028935151 331 dbSNP
rs201344111 343 dbSNP
rs990875882 344 dbSNP
rs1413444003 347 dbSNP
rs757247586 349 dbSNP
rs997586693 354 dbSNP
rs1437189298 357 dbSNP
rs901908791 361 dbSNP
rs1041571084 366 dbSNP
rs1004872574 373 dbSNP
rs886726165 378 dbSNP
rs530366040 383 dbSNP
rs1027904905 386 dbSNP
rs561315863 398 dbSNP
rs1213102958 399 dbSNP
rs1278343227 400 dbSNP
rs1349946118 402 dbSNP
rs779763790 404 dbSNP
rs995460295 406 dbSNP
rs139873090 414 dbSNP
rs1481965429 428 dbSNP
rs945831981 429 dbSNP
rs575850947 432 dbSNP
rs1233068001 433 dbSNP
rs1228820376 434 dbSNP
rs900679630 436 dbSNP
rs1396427816 438 dbSNP
rs1455911490 441 dbSNP
rs1039194477 443 dbSNP
rs893061118 444 dbSNP
rs1408600005 445 dbSNP
rs1382075341 446 dbSNP
rs753880806 450 dbSNP
rs559176280 451 dbSNP
rs1373306410 452 dbSNP
rs1234871355 471 dbSNP
rs937222835 474 dbSNP
rs1432265922 482 dbSNP
rs9296679 483 dbSNP
rs1197314366 485 dbSNP
rs923562190 491 dbSNP
rs572488503 496 dbSNP
rs1463429277 499 dbSNP
rs1254268635 501 dbSNP
rs949797891 505 dbSNP
rs552677389 507 dbSNP
rs1192180719 511 dbSNP
rs1194758655 512 dbSNP
rs535936882 513 dbSNP
rs918290860 522 dbSNP
rs946595864 533 dbSNP
rs1404929813 540 dbSNP
rs752250372 541 dbSNP
rs1324164109 549 dbSNP
rs114133105 553 dbSNP
rs962556012 554 dbSNP
rs990594506 555 dbSNP
rs1324608075 569 dbSNP
rs767159325 593 dbSNP
rs960806631 595 dbSNP
rs556884078 610 dbSNP
rs1355390439 611 dbSNP
rs1231018386 622 dbSNP
rs985471411 642 dbSNP
rs1468675170 643 dbSNP
rs1207528226 649 dbSNP
rs1259124857 650 dbSNP
rs953618717 654 dbSNP
rs1195973271 657 dbSNP
rs537225096 676 dbSNP
rs1028964839 677 dbSNP
rs997449322 679 dbSNP
rs763242992 681 dbSNP
rs1420270179 683 dbSNP
rs571468775 687 dbSNP
rs551687402 688 dbSNP
rs532580521 694 dbSNP
rs1020753736 695 dbSNP
rs566869294 709 dbSNP
rs1286082905 715 dbSNP
rs892983566 716 dbSNP
rs111500083 717 dbSNP
rs1054282569 718 dbSNP
rs547156877 719 dbSNP
rs1352248067 722 dbSNP
rs1207370957 723 dbSNP
rs1285539150 732 dbSNP
rs1167264330 735 dbSNP
rs900733537 738 dbSNP
rs144655097 739 dbSNP
rs530146205 741 dbSNP
rs905754953 742 dbSNP
rs890916686 744 dbSNP
rs1257152050 747 dbSNP
rs1045426809 749 dbSNP
rs1181376556 749 dbSNP
rs949664669 750 dbSNP
rs918249142 751 dbSNP
rs902189219 752 dbSNP
rs561387379 753 dbSNP
rs1469159799 755 dbSNP
rs1491174407 757 dbSNP
rs398094190 757 dbSNP
rs5876278 757 dbSNP
rs1347789464 758 dbSNP
rs1491260852 758 dbSNP
rs1064217 760 dbSNP
rs531098999 761 dbSNP
rs1282845167 772 dbSNP
rs765653320 777 dbSNP
rs909402845 780 dbSNP
rs1248646640 781 dbSNP
rs762191681 783 dbSNP
rs777247626 797 dbSNP
rs1394624466 798 dbSNP
rs768573593 799 dbSNP
rs927762268 803 dbSNP
rs922149133 808 dbSNP
rs983564897 810 dbSNP
rs950834361 812 dbSNP
rs1279838420 815 dbSNP
rs976063216 821 dbSNP
rs966475954 831 dbSNP
rs1020264974 836 dbSNP
rs1010766080 840 dbSNP
rs1398170334 848 dbSNP
rs920626754 849 dbSNP
rs957447647 865 dbSNP
rs565270224 868 dbSNP
rs1232683343 871 dbSNP
rs1306305123 873 dbSNP
rs1349281535 874 dbSNP
rs1001328040 876 dbSNP
rs905784638 877 dbSNP
rs2073184 878 dbSNP
rs999300109 879 dbSNP
rs1460789518 901 dbSNP
rs1427909454 911 dbSNP
rs1014175691 920 dbSNP
rs896839660 929 dbSNP
rs1374592609 936 dbSNP
rs902242154 946 dbSNP
rs1324832763 951 dbSNP
rs1036689825 957 dbSNP
rs1417340627 960 dbSNP
rs941122151 976 dbSNP
rs1326049916 981 dbSNP
rs909611415 982 dbSNP
rs1471174209 983 dbSNP
rs1054969948 984 dbSNP
rs572548598 985 dbSNP
rs1228365029 990 dbSNP
rs1272750196 990 dbSNP
rs932119080 991 dbSNP
rs1469283860 992 dbSNP
rs1215620439 995 dbSNP
rs1253781185 1000 dbSNP
rs922096141 1002 dbSNP
rs552539081 1005 dbSNP
rs1485467029 1009 dbSNP
rs80125873 1024 dbSNP
rs772438870 1026 dbSNP
rs1037502716 1032 dbSNP
rs1047998749 1046 dbSNP
rs1462740190 1052 dbSNP
rs1284445264 1053 dbSNP
rs1206548727 1057 dbSNP
rs573679206 1071 dbSNP
rs920664862 1077 dbSNP
rs1347870737 1082 dbSNP
rs1430568354 1087 dbSNP
rs372438236 1089 dbSNP
rs149387537 1094 dbSNP
rs988803692 1095 dbSNP
rs536885693 1096 dbSNP
rs973464826 1097 dbSNP
rs1353793279 1098 dbSNP
rs1234457304 1100 dbSNP
rs1235379405 1103 dbSNP
rs1273833130 1109 dbSNP
rs1316439134 1110 dbSNP
rs9474230 1111 dbSNP
rs558131754 1112 dbSNP
rs534907272 1115 dbSNP
rs1486180838 1118 dbSNP
rs879206164 1122 dbSNP
rs1186937556 1124 dbSNP
rs1255217703 1136 dbSNP
rs969916507 1137 dbSNP
rs1475944978 1139 dbSNP
rs1345593445 1140 dbSNP
rs757055730 1141 dbSNP
rs1402639632 1143 dbSNP
rs1383131990 1148 dbSNP
rs373778119 1160 dbSNP
rs1347452135 1162 dbSNP
rs1158106951 1163 dbSNP
rs1312582338 1167 dbSNP
rs1374045579 1175 dbSNP
rs954917002 1184 dbSNP
rs13192439 1187 dbSNP
rs897044165 1189 dbSNP
rs1037125506 1195 dbSNP
rs1222118509 1195 dbSNP
rs566472470 1197 dbSNP
rs9370127 1199 dbSNP
rs1049501742 1203 dbSNP
rs1210081066 1205 dbSNP
rs1444910575 1207 dbSNP
rs1486541581 1207 dbSNP
rs1211105116 1212 dbSNP
rs375528934 1217 dbSNP
rs1231934529 1220 dbSNP
rs752715533 1221 dbSNP
rs371005864 1222 dbSNP
rs749130791 1227 dbSNP
rs2073183 1233 dbSNP
rs913444458 1234 dbSNP
rs1440791795 1238 dbSNP
rs1173591495 1242 dbSNP
rs879534962 1243 dbSNP
rs531038820 1244 dbSNP
rs989224616 1247 dbSNP
rs1335328805 1254 dbSNP
rs1271696187 1259 dbSNP
rs1440371477 1263 dbSNP
rs555320332 1268 dbSNP
rs1428447167 1270 dbSNP
rs1324900611 1274 dbSNP
rs1299890530 1282 dbSNP
rs1033279398 1286 dbSNP
rs1003435957 1290 dbSNP
rs548596146 1296 dbSNP
rs1219573368 1298 dbSNP
rs528850301 1300 dbSNP
rs528766566 1313 dbSNP
rs1172270444 1321 dbSNP
rs898956753 1323 dbSNP
rs1467666494 1324 dbSNP
rs1191255197 1336 dbSNP
rs755511063 1341 dbSNP
rs41273742 1342 dbSNP
rs1173519493 1345 dbSNP
rs1419250514 1346 dbSNP
rs943404565 1350 dbSNP
rs1172834587 1353 dbSNP
rs970119396 1353 dbSNP
rs867231425 1354 dbSNP
rs1324035715 1355 dbSNP
rs1024160021 1357 dbSNP
rs542276360 1358 dbSNP
rs573568496 1361 dbSNP
rs1015477545 1362 dbSNP
rs933588794 1363 dbSNP
rs1005874954 1365 dbSNP
rs868185145 1367 dbSNP
rs1027927628 1373 dbSNP
rs996564280 1374 dbSNP
rs977657911 1375 dbSNP
rs1474648204 1378 dbSNP
rs900906366 1379 dbSNP
rs1486345541 1386 dbSNP
rs1461184108 1388 dbSNP
rs767069452 1401 dbSNP
rs1021762089 1405 dbSNP
rs1405833663 1407 dbSNP
rs1053938668 1410 dbSNP
rs959093178 1410 dbSNP
rs1432614947 1414 dbSNP
rs1040521884 1417 dbSNP
rs944858343 1422 dbSNP
rs1231075348 1423 dbSNP
rs1209594840 1427 dbSNP
rs1033331216 1431 dbSNP
rs774576142 1433 dbSNP
rs1275111188 1439 dbSNP
rs1212517324 1443 dbSNP
rs891949220 1450 dbSNP
rs553046432 1452 dbSNP
rs1284145297 1453 dbSNP
rs1003151238 1461 dbSNP
rs1277748433 1464 dbSNP
rs543502250 1471 dbSNP
rs1357645867 1472 dbSNP
rs906486544 1478 dbSNP
rs1251917770 1481 dbSNP
rs1311121633 1483 dbSNP
rs1186104013 1488 dbSNP
rs936230285 1492 dbSNP
rs1473150945 1497 dbSNP
rs1158124108 1499 dbSNP
rs754617846 1502 dbSNP
rs1173181401 1503 dbSNP
rs1026650203 1505 dbSNP
rs1423396567 1510 dbSNP
rs980071762 1512 dbSNP
rs948803034 1520 dbSNP
rs1166157030 1525 dbSNP
rs577953319 1526 dbSNP
rs1374638010 1527 dbSNP
rs917301912 1536 dbSNP
rs1475969336 1537 dbSNP
rs993079888 1540 dbSNP
rs1294778294 1546 dbSNP
rs1415281780 1547 dbSNP
rs557993999 1557 dbSNP
rs961270091 1559 dbSNP
rs1804082 1564 dbSNP
rs1349079973 1569 dbSNP
rs1480678489 1570 dbSNP
rs1219450931 1571 dbSNP
rs191146750 1580 dbSNP
rs952601198 1581 dbSNP
rs943456919 1586 dbSNP
rs889190316 1587 dbSNP
rs1027963289 1588 dbSNP
rs1258506913 1598 dbSNP
rs866081103 1611 dbSNP
rs1051983288 1617 dbSNP
rs539521352 1617 dbSNP
rs1441400280 1620 dbSNP
rs1159201493 1621 dbSNP
rs1273549615 1629 dbSNP
rs1394205571 1630 dbSNP
rs1234960258 1633 dbSNP
rs900938980 1637 dbSNP
rs1432595640 1638 dbSNP
rs924927522 1639 dbSNP
rs1402453052 1645 dbSNP
rs1390467956 1647 dbSNP
rs1337210165 1651 dbSNP
rs1326216259 1654 dbSNP
rs1019391993 1661 dbSNP
rs1227753032 1662 dbSNP
rs1374174501 1663 dbSNP
rs868373748 1664 dbSNP
rs765559549 1666 dbSNP
rs1310595109 1671 dbSNP
rs376927762 1672 dbSNP
rs1300373317 1675 dbSNP
rs1232541371 1677 dbSNP
rs141250001 1680 dbSNP
rs1053681898 1685 dbSNP
rs1195453000 1689 dbSNP
rs936253343 1690 dbSNP
rs1248444261 1694 dbSNP
rs1459166755 1698 dbSNP
rs1179379272 1702 dbSNP
rs754262840 1703 dbSNP
rs914639690 1707 dbSNP
rs138643512 1709 dbSNP
rs948668634 1712 dbSNP
rs917246789 1714 dbSNP
rs186689495 1723 dbSNP
rs1409568524 1732 dbSNP
rs981953247 1737 dbSNP
rs41304902 1738 dbSNP
rs1163102415 1744 dbSNP
rs908400560 1749 dbSNP
rs1253610551 1751 dbSNP
rs1439352546 1754 dbSNP
rs1303783668 1763 dbSNP
rs971045170 1768 dbSNP
rs879104285 1772 dbSNP
rs1226916969 1775 dbSNP
rs1215261073 1781 dbSNP
rs183819263 1788 dbSNP
rs12189880 1789 dbSNP
rs1199333711 1796 dbSNP
rs1252527638 1801 dbSNP
rs1263852513 1804 dbSNP
rs1192874537 1807 dbSNP
rs773515035 1809 dbSNP
rs1221148440 1816 dbSNP
rs1267741474 1817 dbSNP
rs993554168 1818 dbSNP
rs963096315 1819 dbSNP
rs1425313403 1828 dbSNP
rs1465881070 1832 dbSNP
rs1163501929 1840 dbSNP
rs1391663560 1843 dbSNP
rs191680660 1844 dbSNP
rs1295831186 1845 dbSNP
rs775700260 1856 dbSNP
rs144907271 1859 dbSNP
rs1309206731 1862 dbSNP
rs28544415 1864 dbSNP
rs1293951021 1872 dbSNP
rs1342607756 1874 dbSNP
rs1219486482 1883 dbSNP
rs1272574618 1887 dbSNP
rs1222191819 1889 dbSNP
rs375991218 1890 dbSNP
rs570178972 1902 dbSNP
rs1485537828 1903 dbSNP
rs1203160047 1904 dbSNP
rs1304821220 1906 dbSNP
rs1051931972 1910 dbSNP
rs1443494728 1914 dbSNP
rs1186803496 1917 dbSNP
rs1392771100 1918 dbSNP
rs372985785 1923 dbSNP
rs1292542292 1937 dbSNP
rs1453970884 1945 dbSNP
rs1164919419 1948 dbSNP
rs965052212 1949 dbSNP
rs1346649470 1951 dbSNP
rs1350959247 1963 dbSNP
rs1453757328 1965 dbSNP
rs1296664171 1966 dbSNP
rs997728227 1968 dbSNP
rs903419700 1969 dbSNP
rs1292874585 1979 dbSNP
rs1377310177 1983 dbSNP
rs1019677918 1985 dbSNP
rs1230091684 1985 dbSNP
rs1395549901 1988 dbSNP
rs1316205863 1990 dbSNP
rs1195445177 1992 dbSNP
rs1041995034 1993 dbSNP
rs1287826771 1996 dbSNP
rs1488510552 1998 dbSNP
rs1209935545 1999 dbSNP
rs1254930786 2000 dbSNP
rs1452296834 2002 dbSNP
rs1484062159 2005 dbSNP
rs6900141 2007 dbSNP
rs1406613381 2010 dbSNP
rs1186936207 2011 dbSNP
rs1157417186 2016 dbSNP
rs914585929 2016 dbSNP
rs141067082 2019 dbSNP
rs937426814 2020 dbSNP
rs1312717471 2021 dbSNP
rs1357644254 2023 dbSNP
rs1450474231 2024 dbSNP
rs759802673 2028 dbSNP
rs1000327772 2033 dbSNP
rs879916668 2038 dbSNP
rs1311322624 2044 dbSNP
rs1354380656 2052 dbSNP
rs1233272813 2056 dbSNP
rs1278003573 2059 dbSNP
rs146426290 2060 dbSNP
rs1044704944 2061 dbSNP
rs1231768504 2063 dbSNP
rs1479354504 2067 dbSNP
rs1180024746 2091 dbSNP
rs1240559916 2095 dbSNP
rs1440922515 2096 dbSNP
rs919146874 2097 dbSNP
rs972020389 2099 dbSNP
rs963340408 2103 dbSNP
rs1177088653 2108 dbSNP
rs543012355 2118 dbSNP
rs2073182 2122 dbSNP
rs895839482 2128 dbSNP
rs1377546376 2129 dbSNP
rs1440085650 2134 dbSNP
rs1272800291 2139 dbSNP
rs1363630972 2144 dbSNP
rs779636475 2147 dbSNP
rs1057438708 2148 dbSNP
rs1271826192 2149 dbSNP
rs1030115024 2151 dbSNP
rs1286768961 2155 dbSNP
rs770591270 2158 dbSNP
rs1199981219 2162 dbSNP
rs1258152220 2163 dbSNP
rs143440991 2167 dbSNP
rs1389454023 2168 dbSNP
rs1193588589 2170 dbSNP
rs903368514 2181 dbSNP
rs77359883 2182 dbSNP
rs1192182605 2189 dbSNP
rs893097393 2190 dbSNP
rs1175017955 2191 dbSNP
rs41308309 2192 dbSNP
rs1401143753 2193 dbSNP
rs1460812901 2193 dbSNP
rs931181635 2198 dbSNP
rs555400998 2200 dbSNP
rs11554808 2202 dbSNP
rs1170869919 2211 dbSNP
rs1436914615 2215 dbSNP
rs867753781 2220 dbSNP
rs1269446792 2226 dbSNP
rs1337870784 2228 dbSNP
rs928707222 2231 dbSNP
rs113569025 2233 dbSNP
rs1191809690 2241 dbSNP
rs1487982863 2243 dbSNP
rs965250723 2246 dbSNP
rs559095636 2247 dbSNP
rs1288327470 2248 dbSNP
rs1213175794 2256 dbSNP
rs1343479677 2257 dbSNP
rs1241898639 2258 dbSNP
rs573990162 2260 dbSNP
rs866872354 2261 dbSNP
rs988190690 2268 dbSNP
rs1309656667 2271 dbSNP
rs1275868129 2274 dbSNP
rs941923851 2279 dbSNP
rs909163536 2283 dbSNP
rs1405884797 2289 dbSNP
rs1355749815 2290 dbSNP
rs1317299421 2293 dbSNP
rs1314161993 2299 dbSNP
rs372998914 2301 dbSNP
rs956486996 2306 dbSNP
rs1241970971 2307 dbSNP
rs1354486274 2307 dbSNP
rs145798563 2307 dbSNP
rs1285517430 2308 dbSNP
rs1359002169 2311 dbSNP
rs753657217 2324 dbSNP
rs1229410065 2329 dbSNP
rs1298689023 2333 dbSNP
rs1285698158 2339 dbSNP
rs1032474814 2347 dbSNP
rs780646337 2348 dbSNP
rs1000612234 2351 dbSNP
rs1264154578 2354 dbSNP
rs148863171 2358 dbSNP
rs1185425402 2369 dbSNP
rs1169751425 2371 dbSNP
rs1030470489 2373 dbSNP
rs1157955552 2377 dbSNP
rs536996190 2379 dbSNP
rs1421270282 2380 dbSNP
rs571426800 2383 dbSNP
rs1023120664 2384 dbSNP
rs1013204688 2386 dbSNP
rs896029286 2391 dbSNP
rs1057134138 2397 dbSNP
rs1004586215 2408 dbSNP
rs887108175 2419 dbSNP
rs1048500218 2423 dbSNP
rs777443977 2434 dbSNP
rs1352225246 2436 dbSNP
rs931376950 2440 dbSNP
rs899702438 2449 dbSNP
rs967914888 2455 dbSNP
rs1287195906 2456 dbSNP
rs1344508373 2456 dbSNP
rs1198969843 2458 dbSNP
rs1020452824 2464 dbSNP
rs754527940 2470 dbSNP
rs893378831 2473 dbSNP
rs1039482440 2475 dbSNP
rs943986595 2478 dbSNP
rs1001469168 2480 dbSNP
rs1376872240 2485 dbSNP
rs188146573 2495 dbSNP
rs145502128 2496 dbSNP
rs9277 2506 dbSNP
rs1335067278 2507 dbSNP
rs1375242455 2513 dbSNP
rs924971725 2520 dbSNP
rs115018256 2523 dbSNP
rs1330914561 2524 dbSNP
rs1339391922 2525 dbSNP
rs941871529 2532 dbSNP
rs140939221 2543 dbSNP
rs986063216 2544 dbSNP
rs183572139 2553 dbSNP
rs549770998 2555 dbSNP
rs1364864660 2556 dbSNP
rs532922173 2559 dbSNP
rs17652536 2563 dbSNP
rs1179206204 2569 dbSNP
rs967149904 2574 dbSNP
rs1200796380 2576 dbSNP
rs1377838991 2585 dbSNP
rs7771 2593 dbSNP
rs1036387007 2594 dbSNP
rs1395409694 2611 dbSNP
rs1332591176 2619 dbSNP
rs1167390842 2624 dbSNP
rs1385438034 2625 dbSNP
rs527528871 2626 dbSNP
rs1331834644 2628 dbSNP
rs74741335 2630 dbSNP
rs1276335235 2632 dbSNP
rs1320135645 2638 dbSNP
rs1199395444 2639 dbSNP
rs1182681751 2640 dbSNP
rs1421383088 2644 dbSNP
rs541618008 2648 dbSNP
rs1236950776 2649 dbSNP
rs1198332734 2650 dbSNP
rs1469197318 2651 dbSNP
rs1191102746 2652 dbSNP
rs1477261965 2652 dbSNP
rs1274605077 2653 dbSNP
rs576285967 2657 dbSNP
rs907159318 2658 dbSNP
rs1368399410 2659 dbSNP
rs73740390 2659 dbSNP
rs543448491 2660 dbSNP
rs994609613 2661 dbSNP
rs1240636468 2662 dbSNP
rs897225299 2662 dbSNP
rs11752918 2663 dbSNP
rs1312099454 2663 dbSNP
rs112967280 2664 dbSNP
rs557879933 2664 dbSNP
rs1488449152 2665 dbSNP
rs996268733 2665 dbSNP
rs1411018035 2666 dbSNP
rs61590094 2666 dbSNP
rs1308453352 2667 dbSNP
rs1491492183 2668 dbSNP
rs200545924 2668 dbSNP
rs1244277018 2669 dbSNP
rs1302287916 2669 dbSNP
rs13217723 2669 dbSNP
rs1362688838 2669 dbSNP
rs1377107836 2669 dbSNP
rs1397899707 2669 dbSNP
rs1431768128 2669 dbSNP
rs59714938 2669 dbSNP
rs752612489 2669 dbSNP
rs879228961 2669 dbSNP
rs1441290899 2670 dbSNP
rs746116356 2671 dbSNP
rs751940820 2672 dbSNP
rs770312726 2672 dbSNP
rs867154990 2672 dbSNP
rs1175587569 2673 dbSNP
rs12195210 2673 dbSNP
rs369554880 2674 dbSNP
rs370458340 2674 dbSNP
rs781200143 2674 dbSNP
rs1311124699 2675 dbSNP
rs1444496527 2675 dbSNP
rs1373828077 2676 dbSNP
rs887622049 2677 dbSNP
rs1050299027 2678 dbSNP
rs9395798 2678 dbSNP
rs1197336991 2679 dbSNP
rs1210202338 2679 dbSNP
rs1240614992 2679 dbSNP
rs1457672003 2679 dbSNP
rs368707931 2679 dbSNP
rs368947355 2679 dbSNP
rs923218795 2679 dbSNP
rs1321386993 2680 dbSNP
rs1333254354 2680 dbSNP
rs1355092332 2680 dbSNP
rs1399679467 2680 dbSNP
rs1435482233 2680 dbSNP
rs1491332698 2682 dbSNP
rs752489489 2682 dbSNP
rs1491346471 2683 dbSNP
rs1223771888 2689 dbSNP
rs887129158 2695 dbSNP
rs1276973274 2697 dbSNP
rs1315492141 2698 dbSNP
rs1200035720 2706 dbSNP
rs1403790276 2714 dbSNP
rs1221205624 2721 dbSNP
rs531890719 2723 dbSNP
rs1489562424 2732 dbSNP
rs1200460924 2733 dbSNP
rs535645790 2734 dbSNP
rs76545285 2735 dbSNP
rs550190291 2738 dbSNP
rs899903417 2739 dbSNP
rs1321274218 2740 dbSNP
rs1039516439 2741 dbSNP
rs1297176646 2742 dbSNP
rs1338040933 2742 dbSNP
rs1406617473 2742 dbSNP
rs368703713 2742 dbSNP
rs1219925121 2745 dbSNP
rs1270272646 2750 dbSNP
rs912959861 2757 dbSNP
rs1255255311 2758 dbSNP
rs989873590 2762 dbSNP
rs1362006186 2765 dbSNP
rs1223757053 2767 dbSNP
rs1262728772 2774 dbSNP
rs532984806 2775 dbSNP
rs943837006 2776 dbSNP
rs890956884 2779 dbSNP
rs1242791343 2780 dbSNP
rs1450675042 2780 dbSNP
rs1472402523 2782 dbSNP
rs1161358391 2787 dbSNP
rs927469842 2800 dbSNP
rs1157893183 2802 dbSNP
rs1284602977 2803 dbSNP
rs753296528 2804 dbSNP
rs971665364 2809 dbSNP
rs1445228999 2814 dbSNP
rs935245448 2823 dbSNP
rs1362295803 2830 dbSNP
rs1247170376 2846 dbSNP
rs1285759317 2846 dbSNP
rs1351711964 2849 dbSNP
rs924970548 2850 dbSNP
rs994162954 2853 dbSNP
rs1441891953 2856 dbSNP
rs979064573 2861 dbSNP
rs1285160713 2873 dbSNP
rs191667108 2875 dbSNP
rs1185584212 2877 dbSNP
rs1234891513 2879 dbSNP
rs947804838 2890 dbSNP
rs767683174 2891 dbSNP
rs991914472 2893 dbSNP
rs1445168100 2897 dbSNP
rs1272841025 2898 dbSNP
rs1435579099 2902 dbSNP
rs960524893 2919 dbSNP
rs1421094928 2922 dbSNP
rs1035844160 2945 dbSNP
rs983465137 2946 dbSNP
rs1330672510 2947 dbSNP
rs1335696629 2953 dbSNP
rs1412251923 2953 dbSNP
rs1385530412 2956 dbSNP
rs1454000504 2967 dbSNP
rs951631645 2971 dbSNP
rs1026959066 2975 dbSNP
rs1319240125 2976 dbSNP
rs995426964 2977 dbSNP
rs759719856 2985 dbSNP
rs899936403 2987 dbSNP
rs1018349298 2989 dbSNP
rs1017000648 2991 dbSNP
rs1280345644 2999 dbSNP
rs547555190 3006 dbSNP
rs1008312479 3011 dbSNP
rs1198732021 3017 dbSNP
rs1005646749 3019 dbSNP
rs887569554 3023 dbSNP
rs1050246999 3024 dbSNP
rs527388957 3037 dbSNP
rs1420634147 3039 dbSNP
rs1182334285 3040 dbSNP
rs890979306 3041 dbSNP
rs1476840385 3045 dbSNP
rs774648725 3049 dbSNP
rs901744373 3050 dbSNP
rs866084655 3065 dbSNP
rs1435865018 3069 dbSNP
rs1398812437 3072 dbSNP
rs1393498804 3074 dbSNP
rs999862496 3079 dbSNP
rs536931963 3080 dbSNP
rs1231360183 3083 dbSNP
rs1171182164 3085 dbSNP
rs912899498 3090 dbSNP
rs868780111 3092 dbSNP
rs1218148084 3097 dbSNP
rs1256069770 3101 dbSNP
rs567979112 3101 dbSNP
rs13217180 3103 dbSNP
rs1194907858 3104 dbSNP
rs183392583 3110 dbSNP
rs1201175248 3114 dbSNP
rs1487126942 3117 dbSNP
rs1261807932 3121 dbSNP
rs1167998058 3123 dbSNP
rs1371777707 3125 dbSNP
rs980227470 3126 dbSNP
rs1299048198 3127 dbSNP
rs1056639796 3129 dbSNP
rs572741616 3129 dbSNP
rs1211049542 3139 dbSNP
rs1349957479 3140 dbSNP
rs763140897 3141 dbSNP
rs1276418212 3144 dbSNP
rs1218365091 3146 dbSNP
rs928806499 3148 dbSNP
rs998100 3150 dbSNP
rs1228094792 3155 dbSNP
rs114822624 3165 dbSNP
rs1338786460 3166 dbSNP
rs1297646442 3172 dbSNP
rs1224517323 3175 dbSNP
rs1415548351 3177 dbSNP
rs1361339703 3182 dbSNP
rs748051815 3183 dbSNP
rs1005594317 3184 dbSNP
rs1430768033 3185 dbSNP
rs954100480 3186 dbSNP
rs1028437654 3187 dbSNP
rs1420710094 3191 dbSNP
rs1165941026 3193 dbSNP
rs1173335920 3194 dbSNP
rs1399645151 3204 dbSNP
rs1476628275 3205 dbSNP
rs996002528 3206 dbSNP
rs974290095 3209 dbSNP
rs1311900560 3210 dbSNP
rs1338698052 3215 dbSNP
rs1247812375 3217 dbSNP
rs1292246371 3223 dbSNP
rs781126731 3226 dbSNP
rs1214037304 3227 dbSNP
rs1262162176 3228 dbSNP
rs964055141 3230 dbSNP
rs114370846 3231 dbSNP
rs1008757970 3236 dbSNP
rs763138778 3237 dbSNP
rs1185754469 3240 dbSNP
rs1386273334 3243 dbSNP
rs1419287354 3245 dbSNP
rs1157155890 3252 dbSNP
rs1438362640 3254 dbSNP
rs773564412 3259 dbSNP
rs1454368947 3268 dbSNP
rs891754476 3270 dbSNP
rs1403742896 3273 dbSNP
rs564151544 3276 dbSNP
rs1375831450 3299 dbSNP
rs1031271451 3302 dbSNP
rs1316293498 3305 dbSNP
rs1237748814 3307 dbSNP
rs779516969 3313 dbSNP
rs935698209 3314 dbSNP
rs371711707 3315 dbSNP
rs572524421 3316 dbSNP
rs555545729 3318 dbSNP
rs1012151892 3319 dbSNP
rs894841533 3322 dbSNP
rs1206157522 3323 dbSNP
rs1054684418 3324 dbSNP
rs536080686 3328 dbSNP
rs939114649 3331 dbSNP
rs1410352797 3338 dbSNP
rs1419909229 3340 dbSNP
rs1447915038 3341 dbSNP
rs1175389201 3346 dbSNP
rs576539039 3351 dbSNP
rs1404035929 3352 dbSNP
rs1471018137 3358 dbSNP
rs1355687992 3359 dbSNP
rs917413020 3364 dbSNP
rs1439751507 3368 dbSNP
rs28364697 3368 dbSNP
rs1299675532 3373 dbSNP
rs1373541527 3375 dbSNP
rs145669138 3381 dbSNP
rs540127724 3382 dbSNP
rs907576771 3383 dbSNP
rs758057762 3390 dbSNP
rs1223649336 3399 dbSNP
rs1264289380 3403 dbSNP
rs1047683288 3405 dbSNP
rs1399018745 3411 dbSNP
rs972970084 3414 dbSNP
rs571114996 3416 dbSNP
rs930180216 3418 dbSNP
rs1410946838 3424 dbSNP
rs1481059297 3426 dbSNP
rs750112216 3431 dbSNP
rs1427518132 3434 dbSNP
rs1180827916 3448 dbSNP
rs940262447 3449 dbSNP
rs1470465294 3450 dbSNP
rs920092993 3452 dbSNP
rs1408156119 3457 dbSNP
rs974322618 3464 dbSNP
rs1354932836 3465 dbSNP
rs1457165541 3466 dbSNP
rs1435550950 3474 dbSNP
rs28364698 3475 dbSNP
rs1347071694 3476 dbSNP
rs1404957349 3480 dbSNP
rs1277032863 3486 dbSNP
rs1339246266 3492 dbSNP
rs1028385160 3494 dbSNP
rs1213357408 3494 dbSNP
rs1214589164 3496 dbSNP
rs140177899 3497 dbSNP
rs568161285 3498 dbSNP
rs986795902 3504 dbSNP
rs955647007 3517 dbSNP
rs1031052558 3520 dbSNP
rs999607825 3535 dbSNP
rs1227878770 3536 dbSNP
rs1188173892 3542 dbSNP
rs189659532 3545 dbSNP
rs150836533 3546 dbSNP
rs1161517604 3547 dbSNP
rs1032914585 3554 dbSNP
rs562536204 3556 dbSNP
rs1444961209 3560 dbSNP
rs112044263 3563 dbSNP
rs1324137676 3563 dbSNP
rs1447594807 3567 dbSNP
rs1432344016 3568 dbSNP
rs1272417196 3570 dbSNP
rs1363351944 3575 dbSNP
rs529942556 3579 dbSNP
rs1044116793 3580 dbSNP
rs556634007 3584 dbSNP
rs949842226 3585 dbSNP
rs769328631 3588 dbSNP
rs1347821266 3591 dbSNP
rs1163458406 3599 dbSNP
rs753214622 3603 dbSNP
rs1400791485 3606 dbSNP
rs1445335484 3617 dbSNP
rs1195494353 3623 dbSNP
rs895604374 3627 dbSNP
rs1472432819 3642 dbSNP
rs1181469544 3647 dbSNP
rs551914693 3649 dbSNP
rs1283674907 3659 dbSNP
rs532277966 3662 dbSNP
rs768143239 3663 dbSNP
rs1012181427 3667 dbSNP
rs1318409820 3669 dbSNP
rs1401932095 3669 dbSNP
rs536821659 3671 dbSNP
rs1438811380 3675 dbSNP
rs185298967 3676 dbSNP
rs1313323100 3691 dbSNP
rs141402268 3692 dbSNP
rs572333969 3697 dbSNP
rs562238247 3698 dbSNP
rs1035098922 3700 dbSNP
rs1364365300 3701 dbSNP
rs984387672 3705 dbSNP
rs1489584836 3706 dbSNP
rs932607261 3709 dbSNP
rs755049071 3714 dbSNP
rs1460782882 3717 dbSNP
rs886098158 3720 dbSNP
rs6458841 3725 dbSNP
rs1461592841 3728 dbSNP
rs766433478 3730 dbSNP
rs898698726 3733 dbSNP
rs76791889 3736 dbSNP
rs942973784 3743 dbSNP
rs1158593294 3744 dbSNP
rs1423896489 3746 dbSNP
rs1361465022 3761 dbSNP
rs1467812016 3765 dbSNP
rs911439084 3769 dbSNP
rs1335291591 3770 dbSNP
rs77281913 3771 dbSNP
rs989033455 3787 dbSNP
rs955891537 3788 dbSNP
rs1244956189 3789 dbSNP
rs934045602 3792 dbSNP
rs923918720 3804 dbSNP
rs978200362 3805 dbSNP
rs372215009 3806 dbSNP
rs77605099 3810 dbSNP
rs1022153576 3814 dbSNP
rs1361934639 3815 dbSNP
rs990611469 3825 dbSNP
rs1156349728 3826 dbSNP
rs1439154485 3840 dbSNP
rs554469085 3843 dbSNP
rs1182044782 3845 dbSNP
rs1023050461 3854 dbSNP
rs1479164959 3855 dbSNP
rs778348585 3857 dbSNP
rs773351383 3863 dbSNP
rs1013953946 3864 dbSNP
rs1177883256 3871 dbSNP
rs1470598156 3873 dbSNP
rs148752482 3878 dbSNP
rs1394740133 3880 dbSNP
rs764181060 3881 dbSNP
rs1190858025 3882 dbSNP
rs1345187290 3882 dbSNP
rs770559153 3882 dbSNP
rs1034977313 3885 dbSNP
rs1003868868 3887 dbSNP
rs1285285196 3889 dbSNP
rs748898462 3889 dbSNP
rs376631889 3892 dbSNP
rs1324122727 3895 dbSNP
rs1226646141 3896 dbSNP
rs1249589049 3905 dbSNP
rs886130138 3914 dbSNP
rs1488249511 3918 dbSNP
rs1257105217 3923 dbSNP
rs1026386916 3937 dbSNP
rs1004358471 3939 dbSNP
rs1290579264 3944 dbSNP
rs761630806 3950 dbSNP
rs1269011529 3951 dbSNP
rs548040372 3951 dbSNP
rs1048641254 3957 dbSNP
rs1371906209 3958 dbSNP
rs1463848646 3961 dbSNP
rs755927042 3971 dbSNP
rs1214765772 3974 dbSNP
rs1342044079 3984 dbSNP
rs932888832 3986 dbSNP
rs73740389 3993 dbSNP
rs1422998514 3995 dbSNP
rs776488566 3997 dbSNP
rs1041431143 4003 dbSNP
rs1346199457 4021 dbSNP
rs1381771401 4025 dbSNP
rs1293336359 4026 dbSNP
rs944076653 4034 dbSNP
rs74899311 4036 dbSNP
rs1290780813 4041 dbSNP
rs1356767931 4044 dbSNP
rs1224210021 4045 dbSNP
rs1292111497 4047 dbSNP
rs142456869 4047 dbSNP
rs144294333 4059 dbSNP
rs1430823221 4064 dbSNP
rs955838114 4064 dbSNP
rs1376820211 4066 dbSNP
rs1189556449 4067 dbSNP
rs1385037580 4073 dbSNP
rs1170942054 4075 dbSNP
rs889945504 4077 dbSNP
rs1165683539 4078 dbSNP
rs925790977 4079 dbSNP
rs978603480 4081 dbSNP
rs969938376 4087 dbSNP
rs781075578 4088 dbSNP
rs1022908614 4097 dbSNP
rs1014317012 4098 dbSNP
rs562054349 4105 dbSNP
rs1314063101 4106 dbSNP
rs1380274640 4110 dbSNP
rs1426133146 4113 dbSNP
rs1191515933 4120 dbSNP
rs551976086 4143 dbSNP
rs959749770 4145 dbSNP
rs2073181 4146 dbSNP
rs775062863 4148 dbSNP
rs888238120 4149 dbSNP
rs771525047 4151 dbSNP
rs1185884569 4154 dbSNP
rs923975746 4155 dbSNP
rs997047040 4158 dbSNP
rs76434724 4160 dbSNP
rs1064229 4162 dbSNP
rs944008837 4170 dbSNP
rs913910506 4173 dbSNP
rs915294284 4181 dbSNP
rs1403898921 4183 dbSNP
rs1454314133 4189 dbSNP
rs1303223771 4190 dbSNP
rs990894391 4195 dbSNP
rs546154324 4199 dbSNP
rs1372097603 4206 dbSNP
rs1221744657 4210 dbSNP
rs561923831 4211 dbSNP
rs1308745224 4212 dbSNP
rs927770634 4217 dbSNP
rs1222434187 4224 dbSNP
rs539183305 4233 dbSNP
rs62407915 4236 dbSNP
rs1322042286 4241 dbSNP
rs114763184 4244 dbSNP
rs1340583155 4246 dbSNP
rs994425507 4247 dbSNP
rs1394189768 4255 dbSNP
rs963107662 4263 dbSNP
rs1056706 4267 dbSNP
rs915789054 4268 dbSNP
rs992770198 4272 dbSNP
rs546431871 4285 dbSNP
rs1427043201 4286 dbSNP
rs1466999493 4289 dbSNP
rs748537211 4290 dbSNP
rs181014776 4293 dbSNP
rs781727331 4294 dbSNP
rs755536466 4297 dbSNP
rs998464214 4298 dbSNP
rs1403720788 4302 dbSNP
rs1280829410 4307 dbSNP
rs1344125458 4309 dbSNP
rs902725835 4312 dbSNP
rs1042421030 4321 dbSNP
rs554554938 4322 dbSNP
rs1003918157 4324 dbSNP
rs1307265785 4324 dbSNP
rs1202943800 4327 dbSNP
rs952427040 4340 dbSNP
rs1465136813 4345 dbSNP
rs946733073 4348 dbSNP
rs1026758988 4350 dbSNP
rs879560818 4353 dbSNP
rs915241756 4354 dbSNP
rs1189766716 4357 dbSNP
rs1020251378 4358 dbSNP
rs1008480932 4361 dbSNP
rs892750052 4363 dbSNP
rs540563965 4364 dbSNP
rs575037666 4366 dbSNP
rs1436637920 4369 dbSNP
rs543547986 4376 dbSNP
rs62407914 4380 dbSNP
rs927832222 4381 dbSNP
rs1343088616 4383 dbSNP
rs1242061723 4384 dbSNP
rs568628517 4394 dbSNP
rs950669294 4397 dbSNP
rs919143966 4407 dbSNP
rs1222490579 4412 dbSNP
rs1241383283 4417 dbSNP
rs1064230 4426 dbSNP
rs1474394597 4426 dbSNP
rs963055210 4433 dbSNP
rs1330474591 4435 dbSNP
rs1017208549 4438 dbSNP
rs1367120240 4444 dbSNP
rs1391800063 4462 dbSNP
rs1165073560 4469 dbSNP
rs938606828 4470 dbSNP
rs1317034160 4471 dbSNP
rs1368350555 4476 dbSNP
rs1429276693 4484 dbSNP
rs908490794 4486 dbSNP
rs1245773752 4488 dbSNP
rs142831873 4496 dbSNP
rs765454326 4499 dbSNP
rs952375545 4501 dbSNP
rs1026706811 4502 dbSNP
rs975169186 4504 dbSNP
rs964520414 4505 dbSNP
rs144300375 4512 dbSNP
rs1460697664 4525 dbSNP
rs1029831576 4526 dbSNP
rs116592495 4531 dbSNP
rs1460915041 4532 dbSNP
rs1405122124 4535 dbSNP
rs902674841 4564 dbSNP
rs73740388 4579 dbSNP
rs866019634 4584 dbSNP
rs1335159966 4585 dbSNP
rs1011146442 4596 dbSNP
rs753893451 4603 dbSNP
rs893841419 4603 dbSNP
rs1348607967 4614 dbSNP
rs1056955464 4619 dbSNP
rs938539959 4624 dbSNP
rs1055507805 4625 dbSNP
rs9367486 4630 dbSNP
rs1242193565 4631 dbSNP
rs550869038 4637 dbSNP
rs1442829394 4638 dbSNP
rs567505436 4640 dbSNP
rs1230879774 4644 dbSNP
rs1473284034 4647 dbSNP
rs1159266860 4649 dbSNP
rs982710692 4650 dbSNP
rs776399743 4654 dbSNP
rs1174681369 4660 dbSNP
rs929166950 4661 dbSNP
rs186481884 4663 dbSNP
rs1325798246 4669 dbSNP
rs973321469 4670 dbSNP
rs941921482 4671 dbSNP
rs910233790 4679 dbSNP
rs764689513 4687 dbSNP
rs1298929211 4689 dbSNP
rs1221576805 4693 dbSNP
rs986158994 4695 dbSNP
rs763946646 4699 dbSNP
rs1379071079 4700 dbSNP
rs531701291 4700 dbSNP
rs1195077206 4702 dbSNP
rs1019811312 4705 dbSNP
rs1030527928 4706 dbSNP
rs774617672 4714 dbSNP
rs563002634 4715 dbSNP
rs1064231 4716 dbSNP
rs1267597280 4721 dbSNP
rs1479195460 4723 dbSNP
rs1158346522 4738 dbSNP
rs956884349 4744 dbSNP
rs966890735 4752 dbSNP
rs1021122770 4754 dbSNP
rs1167709024 4760 dbSNP
rs1394535670 4761 dbSNP
rs138673948 4762 dbSNP
rs560678523 4771 dbSNP
rs1365011986 4779 dbSNP
rs1196349737 4786 dbSNP
rs1031183355 4797 dbSNP
rs1226347464 4798 dbSNP
rs1331614375 4798 dbSNP
rs894040036 4806 dbSNP
rs968312470 4811 dbSNP
rs145987566 4812 dbSNP
rs1012693425 4819 dbSNP
rs142705528 4822 dbSNP
rs906528864 4825 dbSNP
rs1218237100 4826 dbSNP
rs1192867748 4828 dbSNP
rs1388671725 4831 dbSNP
rs1451771619 4835 dbSNP
rs1046958902 4837 dbSNP
rs1384918104 4841 dbSNP
rs1285230237 4843 dbSNP
rs929376730 4845 dbSNP
rs897675246 4846 dbSNP
rs1272899305 4847 dbSNP
rs1231310147 4864 dbSNP
rs1345174267 4874 dbSNP
rs1316184458 4875 dbSNP
rs1037472360 4879 dbSNP
rs941953896 4880 dbSNP
rs1313923561 4882 dbSNP
rs775339610 4893 dbSNP
rs531153690 4896 dbSNP
rs1246285897 4906 dbSNP
rs986057399 4909 dbSNP
rs1318276521 4914 dbSNP
rs933020519 4915 dbSNP
rs181702442 4923 dbSNP
rs1205034919 4926 dbSNP
rs977604802 4927 dbSNP
rs574872587 4931 dbSNP
rs771562508 4932 dbSNP
rs138086257 4944 dbSNP
rs1166952817 4951 dbSNP
rs1369100092 4958 dbSNP
rs986967148 4967 dbSNP
rs1423979313 4968 dbSNP
rs958286367 4971 dbSNP
rs1390835297 4980 dbSNP
rs1476563970 4992 dbSNP
rs1435464536 4994 dbSNP
rs1034382774 4995 dbSNP
rs1335860580 4996 dbSNP
rs1376463036 4997 dbSNP
rs1002458713 5000 dbSNP
rs773996899 5002 dbSNP
rs1315795577 5007 dbSNP
rs1444112708 5017 dbSNP
rs1024945447 5022 dbSNP
rs1266706913 5023 dbSNP
rs773846494 5027 dbSNP
rs538336724 5029 dbSNP
rs979606837 5030 dbSNP
rs1242953707 5032 dbSNP
rs1482505511 5032 dbSNP
rs1183796867 5034 dbSNP
rs1276223034 5035 dbSNP
rs1064233 5036 dbSNP
rs749013737 5047 dbSNP
rs1024334293 5050 dbSNP
rs1323014738 5060 dbSNP
rs1037503316 5061 dbSNP
rs756306899 5072 dbSNP
rs1303059960 5075 dbSNP
rs552894784 5076 dbSNP
rs1279090510 5077 dbSNP
rs1012228327 5078 dbSNP
rs1220496735 5088 dbSNP
rs888951728 5089 dbSNP
rs76802273 5094 dbSNP
rs961004475 5099 dbSNP
rs1050795357 5106 dbSNP
rs1338562852 5112 dbSNP
rs375806548 5115 dbSNP
rs933238734 5121 dbSNP
rs1035078310 5122 dbSNP
rs560493627 5123 dbSNP
rs1449374846 5125 dbSNP
rs1256745701 5127 dbSNP
rs7746960 5130 dbSNP
rs1203054892 5133 dbSNP
rs1221662957 5133 dbSNP
rs550834172 5141 dbSNP
rs572427051 5143 dbSNP
rs1469617332 5146 dbSNP
rs1198580106 5148 dbSNP
rs1056709 5151 dbSNP
rs1434619965 5152 dbSNP
rs914291211 5157 dbSNP
rs1353511666 5165 dbSNP
rs1040043177 5168 dbSNP
rs912221591 5176 dbSNP
rs942349578 5176 dbSNP
rs1403864506 5183 dbSNP
rs1274774835 5184 dbSNP
rs780453378 5185 dbSNP
rs569268541 5186 dbSNP
rs1341941612 5188 dbSNP
rs1203252633 5190 dbSNP
rs926795119 5205 dbSNP
rs1483419111 5209 dbSNP
rs749817219 5211 dbSNP
rs935076252 5213 dbSNP
rs552565441 5218 dbSNP
rs1489435752 5219 dbSNP
rs1191515040 5222 dbSNP
rs758440616 5223 dbSNP
rs970978693 5232 dbSNP
rs750486033 5235 dbSNP
rs1458062196 5236 dbSNP
rs1258911440 5237 dbSNP
rs1423385614 5238 dbSNP
rs1321030201 5241 dbSNP
rs1348621654 5242 dbSNP
rs532659498 5243 dbSNP
rs1316351641 5248 dbSNP
rs1364853199 5249 dbSNP
rs1272365303 5251 dbSNP
rs1226659389 5255 dbSNP
rs923722460 5264 dbSNP
rs564587199 5266 dbSNP
rs200164937 5268 dbSNP
rs979554438 5269 dbSNP
rs968208780 5274 dbSNP
rs3804496 5280 dbSNP
rs991486991 5281 dbSNP
rs1282959273 5282 dbSNP
rs1016341656 5284 dbSNP
rs1463325053 5290 dbSNP
rs1190347015 5295 dbSNP
rs1248241731 5303 dbSNP
rs960701682 5304 dbSNP
rs200894984 5310 dbSNP
rs149477259 5312 dbSNP
rs546894267 5315 dbSNP
rs3804497 5323 dbSNP
rs1166028123 5327 dbSNP
rs1388636771 5328 dbSNP
rs950764978 5333 dbSNP
rs1323026993 5339 dbSNP
rs1333844163 5343 dbSNP
rs1479608549 5356 dbSNP
rs1447522836 5357 dbSNP
rs763856618 5357 dbSNP
rs3804498 5358 dbSNP
rs1228966130 5360 dbSNP
rs1050242487 5366 dbSNP
rs1353629500 5368 dbSNP
rs535661289 5372 dbSNP
rs752641196 5373 dbSNP
rs901721438 5374 dbSNP
rs1184890167 5375 dbSNP
rs1238851463 5376 dbSNP
rs1472840142 5378 dbSNP
rs1041412922 5387 dbSNP
rs1406613901 5390 dbSNP
rs1176184913 5405 dbSNP
rs114033137 5406 dbSNP
rs891082566 5407 dbSNP
rs1162891389 5412 dbSNP
rs1389781427 5414 dbSNP
rs1414272270 5418 dbSNP
rs1332359901 5420 dbSNP
rs1440283622 5426 dbSNP
rs914240664 5428 dbSNP
rs1051190278 5433 dbSNP
rs1448828672 5433 dbSNP
rs1348518131 5434 dbSNP
rs1239751548 5435 dbSNP
rs1230106186 5437 dbSNP
rs62407913 5438 dbSNP
rs1176606614 5441 dbSNP
rs747931503 5442 dbSNP
rs1479780553 5443 dbSNP
rs1343951795 5447 dbSNP
rs1198589384 5454 dbSNP
rs1280282484 5459 dbSNP
rs1232528817 5463 dbSNP
rs879218892 5465 dbSNP
rs1203774278 5471 dbSNP
rs1442693425 5471 dbSNP
rs935023555 5472 dbSNP
rs1473300110 5474 dbSNP
rs1184892969 5475 dbSNP
rs115849540 5483 dbSNP
rs576404101 5489 dbSNP
rs1323606857 5504 dbSNP
rs1171249622 5514 dbSNP
rs1043470828 5517 dbSNP
rs946851969 5517 dbSNP
rs937095873 5519 dbSNP
rs1245850947 5523 dbSNP
rs1411751115 5525 dbSNP
rs926800666 5533 dbSNP
rs759575574 5535 dbSNP
rs564547105 5537 dbSNP
rs939590299 5538 dbSNP
rs1276441832 5543 dbSNP
rs1345493385 5545 dbSNP
rs1227152354 5546 dbSNP
rs761334801 5548 dbSNP
rs1293772622 5550 dbSNP
rs983431745 5554 dbSNP
rs1251850702 5561 dbSNP
rs1451585316 5564 dbSNP
rs1437937399 5565 dbSNP
rs1347581481 5567 dbSNP
rs1024801632 5571 dbSNP
rs1013928726 5575 dbSNP
rs895027151 5579 dbSNP
rs1454995422 5580 dbSNP
rs1168128288 5582 dbSNP
rs878983883 5585 dbSNP
rs6778 5590 dbSNP
rs572624210 5591 dbSNP
rs371260461 5592 dbSNP
rs1384968353 5594 dbSNP
rs1016204070 5595 dbSNP
rs1325472618 5608 dbSNP
rs1331413815 5609 dbSNP
rs1407470894 5613 dbSNP
rs1294938500 5616 dbSNP
rs536356695 5616 dbSNP
rs962534803 5617 dbSNP
rs1228463901 5618 dbSNP
rs1264389985 5620 dbSNP
rs1489615670 5621 dbSNP
rs1018520533 5622 dbSNP
rs1208521657 5624 dbSNP
rs1221924662 5626 dbSNP
rs1006755477 5627 dbSNP
rs1246403154 5627 dbSNP
rs35424026 5632 dbSNP
rs1006274513 5636 dbSNP
rs1451607835 5641 dbSNP
rs536088168 5644 dbSNP
rs1171436291 5661 dbSNP
rs953466051 5662 dbSNP
rs1029246878 5669 dbSNP
rs1164858788 5672 dbSNP
rs1214838907 5674 dbSNP
rs997325902 5675 dbSNP
rs1456496252 5679 dbSNP
rs190051243 5679 dbSNP
rs541756672 5683 dbSNP
rs773017252 5683 dbSNP
rs76055940 5684 dbSNP
rs1338130336 5685 dbSNP
rs1246439287 5686 dbSNP
rs1267748474 5692 dbSNP
rs1302462341 5703 dbSNP
rs1010141710 5705 dbSNP
rs1266584348 5707 dbSNP
rs769022747 5711 dbSNP
rs1365122366 5712 dbSNP
rs1255743656 5716 dbSNP
rs892837685 5720 dbSNP
rs557018962 5725 dbSNP
rs1282085401 5726 dbSNP
rs1054095398 5730 dbSNP
rs537354768 5734 dbSNP
rs946456817 5738 dbSNP
rs1456676498 5742 dbSNP
rs905575728 5748 dbSNP
rs1362323597 5751 dbSNP
rs894930699 5753 dbSNP
rs1045880459 5756 dbSNP
rs1301828400 5762 dbSNP
rs949616062 5765 dbSNP
rs918067095 5766 dbSNP
rs972317814 5770 dbSNP
rs939558415 5771 dbSNP
rs1349373994 5773 dbSNP
rs1228268464 5776 dbSNP
rs1287019832 5776 dbSNP
rs1331590312 5777 dbSNP
rs1217039652 5779 dbSNP
rs1255615002 5788 dbSNP
rs940916746 5790 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2