miRTarBase - #MIRT023365 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RABIF   
Synonyms MSS4, RASGFR3, RASGRF3
Description RAB interacting factor
Transcript NM_002871   
Expression
Putative miRNA Targets on RABIF
3'UTR of RABIF
(miRNA target sites are highlighted)
>RABIF|NM_002871|3'UTR
   1 CTGAGGGGAGGGGTACTCAGCTCCATCTCCAAAGATAAACCTACTCCCCACAAGAACTGGCCTTTAATGTGGTATAACTG
  81 TTCCGCTGCCTTCTTGTCTGTGCTAATATAAATACTGAGTACCAGCATGTCCATTTGAACATGCAGAGGGTTAATCCTGC
 161 TTCCTAAAGCCTCAAGTACATGCCTCCTGCTTAGTTCACTTTGTATCACATTTCCTAAGCTCCCTTTTCCCCCAGTTTTG
 241 GGACACTGTGCTTACCTCCAAAAATCTCATCTCTTCCCTGGCATTCTCCCTAGGCTCTGTTTTGCCCAGGGGCTCCCGCT
 321 TTTTCTTGCTCTAGAAGAGCAGTATTCAACCTTTTAGCTATGATGACACATAACAAAAGATGCTTATGTACTAATAGTTG
 401 AAATCTGCCTTTTTCTCATTCAAGAAGGCATACAAATATCTGAGAGTGACTTTGTTGTATGGCTACCCTTGTGATCTACA
 481 GTAATTTATTCTTTCTAAAAGTAAAGCATTTTCAAAACTCAGTATTTAAACCACTAACCAGAAACATTACTTTGGATGCA
 561 TCTCTAATACCATGTTTGAGCACCTCTGCTCTAGGTTGAGAATGACATTTTATTGTGAAGATGGGTGTGGTCCCTCTTCC
 641 CTTGAAATCTTGTAGTTTCTTTTTATATTAGCTCCTCACTGCTACAGCCTAGAAGGTGAGAAGCAGATTTTAACCCCATC
 721 TGGCAGCCATTCAAGGAAAACCCAGCCCTGGCTGTTTACTCAGGCTCTCTTAGAATGAGAGTGGAGGGTGTAGGATATGA
 801 GGGTTAGGCCTTTGCCACATTATACAAAAGTTTATAATTTGCCACATCTGGACAAGTAACTTTCTTCTTTTGTTCATAGG
 881 CAAGACTTCTTTAATGGATAGTATCATTTACTGAACCTACTGGGCATGGTCCTCATGGAGTTTTGGTTCAACTGGAATCT
 961 CTGTGCCAACCCAGGATACAAACTTCCATCCAGATGCATGGATACAAATTTCCATAGCTCCGGGGCTGCTCTAACAGTTT
1041 GATATCAGCAGACGTGTTTAAGCCTTCAACTTGATTTCCAATTATTCCATCATTTCTATTCTGAAATGACTCACTGTCGT
1121 AGAAGGAAGTTTATTATATAACCAAGGTTTCAGGTATCCTCCTGTCACCACCTCTACTATTCAGGAGGCCTAAAATTGAA
1201 ATAAGTACTAAACAGAAACCTTACCATCTGAAGTCCCTTCCATTGTTTTCTAGTTGCTTCCTCATTCCTTTACCCCCAAA
1281 CTTTCTAAGGGCTCCCCGACTGCAGTGCAAGGTGGCCTTGGGCACAGTTTTGCAACCAACCTACTCCCCTGGAAAGATGG
1361 CTTCCTTCTCCAATTAGCCTGAATGAGCTTTAGTAAGCAATTGAGAGAACTGTGTTTTTCCGACAAACGGTCACATGTCC
1441 ATCGTTATGGCATGTGCAGAAAAACAGAGTTATCCACACAAGTCAGGAGCAAAACCCAAGTAGATGCCTCTAGGGGCACA
1521 TGGCCCCTCACATCACAAGCCAGAACCTAAGCTAAGCATTTTTTAAATTGAGTTTGAGACTAGCCTGGGCAACATAGTGA
1601 GACCCCATCTCTATTTAAAAAATGAACAAAATTACCTGGGCATAGTGGTGTATACCTGTAGTCCCTGCTACTTGGGAGGC
1681 TCAGGTGGGAGGATCACTTGAGCCCCAAAGATGGTGGCTGCAGTAAGCCAAGATCACACCACTGGCACTCCAGCCTGGGC
1761 AACAGAGTGAGACCCTGTCTCAAACAAACAACAACAGTAACAACAAAAAAATATATAGCGACTTGAATAGGAAACCATAG
1841 TATTTCATTGTTTTAATTTGCATTTATTTTATTTCTAGTGAAACTTTTATATACGTATCGGTCATTTCTATTTCCTTTTT
1921 TGAGAACTGCCAAATGTTGCCCTAGTAGCCAAAAATATCAGGTTGCTATTCTGCCTTTTCAGTTTGATCTGAAAGAAATA
2001 AAGGCATTTAAGCAATGGAAATTAGATTTCTGCATGTCCTTGGGAAGAATATATAAATTGAAAAAACAAAGGAGAGCTGA
2081 AACCTGAACCTTGGGGTTTAGCTTAAGGTCAACCAACTGATTATCTAGTCAGCTATAAAATGCAAACGTCATTTCTTCAT
2161 TTCCCTCACACCTAATAGGCTCTCAGTACATACTTGTGAATCAGCTGCTATTTGCTGTGGGTAGATAGAGGCAACCTGTG
2241 CTTTCTGCTCCGAGTATAGAAACTTCCGTTTTCTATTGGGGAGAGCAGTTGATTTTGTGAAAGCCTGATTGTTTCCACAT
2321 AATTGTCTGTTGTTTTACAAAAACATGGAATCAAAGATGGGCAGTGGTGTACTGACATTTCACAAATTGTCACCATGTTG
2401 TATATGAGGCTACACATGTAACTGAGTAACTATGAGGACTTCTGCTTCTGATAATGGTGGATAGGTCCTTTGGACTACCC
2481 AGCTCACTGGTTAACTAGAAAGGCTGGACAAAATACTTTAGAAATCTGTGTGAACACACCAAGAGAGCCGACTTGACTTT
2561 GAAGAATTGCTAAACCAGGACAGCAGAGGAGATGGGAACCCTGGGAGGTGGGCTTGGTGTGAGGGCCACCGTTCTCCTGG
2641 GAGCATTTGCCAAACTTGGAGGTGATTCAGAGGCTTAGCAGTGATTTTAGCAGCCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| ||  :|||||| 
Target 5' atcACACCACTG--GCACTCCa 3'
1733 - 1752 151.00 -20.10
2
miRNA  3' guuuGUGGUAAC--AGUGUGAGGu 5'
              |||: |||  |||||:|:| 
Target 5' agttCACT-TTGTATCACATTTCc 3'
193 - 215 131.00 -13.40
3
miRNA  3' guUUGUGGUAACA-GUGUGAGGu 5'
            :| |:|  |||  |||| || 
Target 5' taGAAATCTGTGTGAACACACCa 3'
2519 - 2541 120.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30150967 3 COSMIC
COSN30450070 6 COSMIC
COSN30102124 13 COSMIC
COSN30512204 36 COSMIC
COSN30139855 41 COSMIC
COSN31480146 46 COSMIC
COSN31546072 61 COSMIC
COSN31578562 84 COSMIC
COSN31500615 102 COSMIC
COSN31521813 251 COSMIC
COSN15697969 336 COSMIC
COSN15691772 337 COSMIC
COSN28670774 383 COSMIC
COSN31485481 432 COSMIC
COSN30173564 476 COSMIC
COSN31515998 686 COSMIC
COSN8428957 886 COSMIC
COSN20278215 905 COSMIC
COSN16449447 1578 COSMIC
COSN9056972 1627 COSMIC
COSN21775144 1875 COSMIC
COSN25862251 1952 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1054058101 1 dbSNP
rs201348739 10 dbSNP
rs1286818835 11 dbSNP
rs879098224 13 dbSNP
rs746182410 18 dbSNP
rs1287885172 23 dbSNP
rs771645228 27 dbSNP
rs745515653 28 dbSNP
rs781541009 41 dbSNP
rs1480108708 43 dbSNP
rs141723574 44 dbSNP
rs1000615324 48 dbSNP
rs368057777 51 dbSNP
rs1231537653 53 dbSNP
rs1234279986 55 dbSNP
rs1471441400 60 dbSNP
rs1042017861 62 dbSNP
rs148239627 66 dbSNP
rs566606348 69 dbSNP
rs1380350738 74 dbSNP
rs1423492874 75 dbSNP
rs966111113 83 dbSNP
rs1018865591 84 dbSNP
rs755078837 85 dbSNP
rs1008015236 96 dbSNP
rs3820379 105 dbSNP
rs920079883 115 dbSNP
rs1309939862 116 dbSNP
rs754292384 122 dbSNP
rs961481653 146 dbSNP
rs1294059177 151 dbSNP
rs866855610 153 dbSNP
rs546873068 164 dbSNP
rs908621324 165 dbSNP
rs1195515609 173 dbSNP
rs981430527 178 dbSNP
rs1023001294 179 dbSNP
rs971399572 180 dbSNP
rs1243024562 183 dbSNP
rs533012231 186 dbSNP
rs1022997691 192 dbSNP
rs563914149 205 dbSNP
rs182884644 213 dbSNP
rs531656767 228 dbSNP
rs1394031758 230 dbSNP
rs1032176051 235 dbSNP
rs1311503088 236 dbSNP
rs766806189 240 dbSNP
rs1405190739 242 dbSNP
rs552000226 251 dbSNP
rs1314941867 256 dbSNP
rs34563074 260 dbSNP
rs906954008 268 dbSNP
rs1341208157 269 dbSNP
rs1226943160 277 dbSNP
rs1268676845 283 dbSNP
rs1220726378 286 dbSNP
rs1311756700 289 dbSNP
rs35720508 291 dbSNP
rs1438896066 298 dbSNP
rs1393918833 307 dbSNP
rs1199605973 317 dbSNP
rs562550394 318 dbSNP
rs1460319667 321 dbSNP
rs1206196797 325 dbSNP
rs1131905 336 dbSNP
rs1423936225 342 dbSNP
rs1191887425 345 dbSNP
rs770253084 349 dbSNP
rs750744465 357 dbSNP
rs1007826638 358 dbSNP
rs1343328718 360 dbSNP
rs1428424331 361 dbSNP
rs1287249842 373 dbSNP
rs1131906 383 dbSNP
rs1381675804 384 dbSNP
rs560662450 389 dbSNP
rs1342541712 392 dbSNP
rs1219486376 412 dbSNP
rs1283037218 413 dbSNP
rs1321925624 448 dbSNP
rs1257061100 454 dbSNP
rs1401092478 454 dbSNP
rs1409808586 456 dbSNP
rs1203978882 459 dbSNP
rs1191434692 464 dbSNP
rs1453409902 465 dbSNP
rs1194012744 476 dbSNP
rs1428313873 479 dbSNP
rs1253143135 483 dbSNP
rs1351750307 497 dbSNP
rs10753924 500 dbSNP
rs1049472650 506 dbSNP
rs774190446 508 dbSNP
rs1140707 511 dbSNP
rs930577850 512 dbSNP
rs749771549 518 dbSNP
rs898781215 534 dbSNP
rs1400823499 540 dbSNP
rs533357767 549 dbSNP
rs578131128 564 dbSNP
rs1302827891 566 dbSNP
rs1215629258 571 dbSNP
rs1343992104 572 dbSNP
rs1388840149 576 dbSNP
rs1302430172 584 dbSNP
rs558356013 589 dbSNP
rs1317902410 595 dbSNP
rs971877674 604 dbSNP
rs1283250941 611 dbSNP
rs940188798 620 dbSNP
rs908594324 621 dbSNP
rs966059097 621 dbSNP
rs1489731522 624 dbSNP
rs1465140015 625 dbSNP
rs1192648081 627 dbSNP
rs912000725 639 dbSNP
rs1304303466 640 dbSNP
rs986137606 650 dbSNP
rs953528835 652 dbSNP
rs1388619161 665 dbSNP
rs568527963 669 dbSNP
rs1179648204 672 dbSNP
rs1359889259 675 dbSNP
rs981949781 694 dbSNP
rs537955779 698 dbSNP
rs1163033808 705 dbSNP
rs1363884428 725 dbSNP
rs1459645678 735 dbSNP
rs1294486748 759 dbSNP
rs1431389200 764 dbSNP
rs1362287696 765 dbSNP
rs768245622 767 dbSNP
rs575371779 771 dbSNP
rs1312151417 788 dbSNP
rs998544465 789 dbSNP
rs1378335914 793 dbSNP
rs1240176528 799 dbSNP
rs1290413251 803 dbSNP
rs1319476827 804 dbSNP
rs1011135245 808 dbSNP
rs1433760106 809 dbSNP
rs562771691 813 dbSNP
rs915907418 819 dbSNP
rs372672045 824 dbSNP
rs1395340228 827 dbSNP
rs1177724713 833 dbSNP
rs1426230113 834 dbSNP
rs762578137 842 dbSNP
rs1182993212 858 dbSNP
rs143189405 863 dbSNP
rs1425770868 870 dbSNP
rs149523605 872 dbSNP
rs1165816374 875 dbSNP
rs1354282041 876 dbSNP
rs544676772 890 dbSNP
rs1003753024 891 dbSNP
rs1401582880 892 dbSNP
rs1452551261 898 dbSNP
rs906943876 907 dbSNP
rs1376411334 912 dbSNP
rs1229652325 919 dbSNP
rs1045917804 922 dbSNP
rs1486470121 927 dbSNP
rs1313039457 929 dbSNP
rs780597595 935 dbSNP
rs1265852444 937 dbSNP
rs566455416 940 dbSNP
rs1347557490 946 dbSNP
rs1259758963 950 dbSNP
rs1032682436 951 dbSNP
rs979260182 959 dbSNP
rs966964948 962 dbSNP
rs894108323 967 dbSNP
rs115774713 969 dbSNP
rs1419018311 970 dbSNP
rs930525485 977 dbSNP
rs1007918448 979 dbSNP
rs919176629 981 dbSNP
rs890909062 982 dbSNP
rs1027942374 992 dbSNP
rs775441447 998 dbSNP
rs546603807 1010 dbSNP
rs1335375165 1016 dbSNP
rs1356898966 1017 dbSNP
rs944573901 1022 dbSNP
rs769622964 1024 dbSNP
rs1360757699 1025 dbSNP
rs1039038604 1029 dbSNP
rs539688063 1033 dbSNP
rs1318398898 1034 dbSNP
rs1222794142 1036 dbSNP
rs193004296 1037 dbSNP
rs745886842 1042 dbSNP
rs1413963410 1045 dbSNP
rs1241596400 1049 dbSNP
rs989484084 1053 dbSNP
rs1375772398 1054 dbSNP
rs1196188298 1067 dbSNP
rs550317556 1071 dbSNP
rs137954080 1081 dbSNP
rs1372053762 1087 dbSNP
rs1031292938 1098 dbSNP
rs115174803 1107 dbSNP
rs971327096 1111 dbSNP
rs879482905 1118 dbSNP
rs1397725649 1119 dbSNP
rs1299701419 1125 dbSNP
rs769289954 1129 dbSNP
rs112897849 1136 dbSNP
rs1272876414 1138 dbSNP
rs894232184 1153 dbSNP
rs1027692361 1154 dbSNP
rs994499115 1159 dbSNP
rs979741189 1164 dbSNP
rs966679807 1171 dbSNP
rs897737267 1176 dbSNP
rs780837655 1188 dbSNP
rs1202463014 1189 dbSNP
rs1479768137 1196 dbSNP
rs1036263202 1199 dbSNP
rs1219033125 1202 dbSNP
rs1286958493 1224 dbSNP
rs1250870575 1225 dbSNP
rs944646122 1226 dbSNP
rs1490254187 1233 dbSNP
rs890257846 1240 dbSNP
rs1197129130 1250 dbSNP
rs1228285359 1250 dbSNP
rs1320035901 1252 dbSNP
rs1177187093 1258 dbSNP
rs529304869 1264 dbSNP
rs1379120609 1276 dbSNP
rs141264849 1279 dbSNP
rs1159958856 1287 dbSNP
rs1360708499 1294 dbSNP
rs1232534694 1297 dbSNP
rs932021036 1298 dbSNP
rs540593879 1303 dbSNP
rs1389363971 1305 dbSNP
rs989473942 1307 dbSNP
rs935347533 1309 dbSNP
rs1332667150 1310 dbSNP
rs924170049 1325 dbSNP
rs751578760 1327 dbSNP
rs1374611124 1335 dbSNP
rs1242345193 1345 dbSNP
rs138710395 1352 dbSNP
rs367741960 1358 dbSNP
rs1466750291 1363 dbSNP
rs1004866245 1372 dbSNP
rs145841462 1373 dbSNP
rs1024187313 1379 dbSNP
rs1045895974 1383 dbSNP
rs1014442174 1387 dbSNP
rs991003846 1392 dbSNP
rs894535630 1403 dbSNP
rs1179902587 1406 dbSNP
rs765583112 1416 dbSNP
rs958695146 1421 dbSNP
rs1190014699 1422 dbSNP
rs17498748 1423 dbSNP
rs994446629 1428 dbSNP
rs575909658 1429 dbSNP
rs561866823 1430 dbSNP
rs1448910331 1436 dbSNP
rs1310064904 1437 dbSNP
rs945282274 1439 dbSNP
rs1242844178 1441 dbSNP
rs367952622 1443 dbSNP
rs142552127 1444 dbSNP
rs986562526 1448 dbSNP
rs189037308 1450 dbSNP
rs1459481718 1467 dbSNP
rs756887718 1467 dbSNP
rs955218096 1467 dbSNP
rs552897728 1468 dbSNP
rs776864291 1470 dbSNP
rs920987091 1473 dbSNP
rs1050683459 1476 dbSNP
rs1213054342 1477 dbSNP
rs1441374380 1480 dbSNP
rs1184817963 1481 dbSNP
rs1369788571 1482 dbSNP
rs1472929504 1483 dbSNP
rs751206742 1484 dbSNP
rs1335364853 1485 dbSNP
rs754992749 1498 dbSNP
rs1169613506 1504 dbSNP
rs893869791 1511 dbSNP
rs1467101557 1513 dbSNP
rs4950885 1519 dbSNP
rs1394317177 1521 dbSNP
rs1017010138 1522 dbSNP
rs935419562 1523 dbSNP
rs1003887625 1530 dbSNP
rs780243264 1538 dbSNP
rs879355673 1540 dbSNP
rs1276679981 1541 dbSNP
rs923908173 1543 dbSNP
rs982115625 1544 dbSNP
rs548353947 1551 dbSNP
rs1368227231 1558 dbSNP
rs1198169809 1564 dbSNP
rs1257663905 1579 dbSNP
rs1442637481 1590 dbSNP
rs1192548461 1607 dbSNP
rs1260727458 1615 dbSNP
rs894630539 1615 dbSNP
rs1171155493 1617 dbSNP
rs1324613339 1623 dbSNP
rs1464490647 1627 dbSNP
rs1131907 1629 dbSNP
rs536886966 1636 dbSNP
rs529979598 1642 dbSNP
rs749942413 1647 dbSNP
rs1296622480 1648 dbSNP
rs151079332 1650 dbSNP
rs1400940204 1656 dbSNP
rs973099641 1658 dbSNP
rs770396464 1678 dbSNP
rs961779122 1682 dbSNP
rs1441762681 1687 dbSNP
rs549239053 1696 dbSNP
rs1215298116 1698 dbSNP
rs377706144 1701 dbSNP
rs1489076149 1717 dbSNP
rs1193047556 1720 dbSNP
rs142977093 1732 dbSNP
rs1008603564 1742 dbSNP
rs370908061 1746 dbSNP
rs1378238388 1749 dbSNP
rs1419124803 1749 dbSNP
rs1156951284 1752 dbSNP
rs149006370 1755 dbSNP
rs1362627772 1760 dbSNP
rs1420543018 1762 dbSNP
rs1050983106 1767 dbSNP
rs758322646 1774 dbSNP
rs558017591 1776 dbSNP
rs1302538895 1777 dbSNP
rs1376842893 1786 dbSNP
rs769445497 1792 dbSNP
rs1345255530 1796 dbSNP
rs921081993 1797 dbSNP
rs1355406201 1807 dbSNP
rs746891633 1807 dbSNP
rs1441033390 1810 dbSNP
rs975313392 1813 dbSNP
rs559659689 1814 dbSNP
rs8884 1815 dbSNP
rs1211445647 1817 dbSNP
rs145730318 1819 dbSNP
rs1381017057 1820 dbSNP
rs1384769650 1821 dbSNP
rs1159606311 1836 dbSNP
rs1439019420 1843 dbSNP
rs1176783110 1850 dbSNP
rs1421791299 1856 dbSNP
rs1053631078 1864 dbSNP
rs1164398181 1872 dbSNP
rs75692754 1877 dbSNP
rs1459726610 1884 dbSNP
rs1173192587 1885 dbSNP
rs763855697 1887 dbSNP
rs1445306710 1889 dbSNP
rs1478403367 1891 dbSNP
rs1046825058 1895 dbSNP
rs1378541115 1898 dbSNP
rs1191010789 1900 dbSNP
rs949445371 1903 dbSNP
rs531165718 1910 dbSNP
rs1446338226 1916 dbSNP
rs562279126 1927 dbSNP
rs1218561334 1931 dbSNP
rs541573072 1933 dbSNP
rs1484540304 1943 dbSNP
rs916801829 1946 dbSNP
rs762486619 1950 dbSNP
rs1219383062 1952 dbSNP
rs377623944 1958 dbSNP
rs1267882675 1966 dbSNP
rs1024001837 1979 dbSNP
rs34918348 1980 dbSNP
rs572853389 1986 dbSNP
rs920061935 1988 dbSNP
rs972879256 1999 dbSNP
rs1162969167 2005 dbSNP
rs958978643 2016 dbSNP
rs1165919866 2022 dbSNP
rs1423421381 2032 dbSNP
rs75819201 2039 dbSNP
rs1173498926 2040 dbSNP
rs907664296 2049 dbSNP
rs1442241560 2053 dbSNP
rs1376438804 2058 dbSNP
rs545828907 2059 dbSNP
rs143572916 2064 dbSNP
rs1020380933 2071 dbSNP
rs1317123788 2077 dbSNP
rs1216605837 2083 dbSNP
rs556870581 2084 dbSNP
rs565637040 2088 dbSNP
rs1482350383 2089 dbSNP
rs996078277 2090 dbSNP
rs1235869327 2091 dbSNP
rs1484350563 2093 dbSNP
rs759359388 2095 dbSNP
rs184049151 2096 dbSNP
rs554715867 2104 dbSNP
rs1262875511 2112 dbSNP
rs1475102684 2116 dbSNP
rs768417552 2119 dbSNP
rs1173307913 2122 dbSNP
rs1195686098 2125 dbSNP
rs776064314 2128 dbSNP
rs1414407626 2132 dbSNP
rs1174742777 2135 dbSNP
rs1356989957 2136 dbSNP
rs1484572167 2147 dbSNP
rs890435243 2148 dbSNP
rs770664065 2153 dbSNP
rs1339470262 2155 dbSNP
rs1397844688 2164 dbSNP
rs999397016 2165 dbSNP
rs1270319170 2172 dbSNP
rs1362565428 2174 dbSNP
rs1218632255 2176 dbSNP
rs10920514 2177 dbSNP
rs1046501868 2180 dbSNP
rs1279403093 2185 dbSNP
rs1285523431 2190 dbSNP
rs1487440442 2191 dbSNP
rs1220928411 2205 dbSNP
rs1243126066 2223 dbSNP
rs190426452 2224 dbSNP
rs185960807 2225 dbSNP
rs1422408697 2228 dbSNP
rs909599432 2230 dbSNP
rs982534653 2240 dbSNP
rs1361147966 2250 dbSNP
rs1417549634 2251 dbSNP
rs1055545018 2252 dbSNP
rs931527468 2264 dbSNP
rs1345616590 2266 dbSNP
rs1435630257 2267 dbSNP
rs1327047580 2268 dbSNP
rs758507039 2268 dbSNP
rs920217519 2268 dbSNP
rs1235043452 2269 dbSNP
rs868472730 2276 dbSNP
rs1401041934 2277 dbSNP
rs916912515 2278 dbSNP
rs140093502 2279 dbSNP
rs1451436388 2282 dbSNP
rs34363024 2282 dbSNP
rs1219866129 2285 dbSNP
rs774486043 2286 dbSNP
rs940221914 2287 dbSNP
rs1248904185 2289 dbSNP
rs1455088478 2304 dbSNP
rs1474175998 2306 dbSNP
rs958904189 2308 dbSNP
rs1437408946 2311 dbSNP
rs1159978145 2315 dbSNP
rs1416953861 2331 dbSNP
rs1404493551 2345 dbSNP
rs1321362980 2350 dbSNP
rs907612085 2371 dbSNP
rs182422756 2376 dbSNP
rs1330749454 2377 dbSNP
rs1374831319 2385 dbSNP
rs6703138 2387 dbSNP
rs1307331545 2389 dbSNP
rs1280320023 2391 dbSNP
rs921580028 2395 dbSNP
rs974814513 2411 dbSNP
rs968929719 2416 dbSNP
rs749579872 2417 dbSNP
rs79189212 2418 dbSNP
rs756261138 2423 dbSNP
rs555922762 2426 dbSNP
rs1259421321 2428 dbSNP
rs1201128784 2430 dbSNP
rs977904314 2431 dbSNP
rs146098802 2439 dbSNP
rs1161241989 2451 dbSNP
rs899733419 2451 dbSNP
rs1025244061 2453 dbSNP
rs1229273207 2464 dbSNP
rs1381728865 2474 dbSNP
rs1278012020 2476 dbSNP
rs796806537 2489 dbSNP
rs941298813 2500 dbSNP
rs1393162747 2506 dbSNP
rs1013638031 2519 dbSNP
rs1340092098 2520 dbSNP
rs757641861 2526 dbSNP
rs895225085 2544 dbSNP
rs929710282 2549 dbSNP
rs1033683717 2550 dbSNP
rs1218439180 2557 dbSNP
rs1256658807 2562 dbSNP
rs762064443 2563 dbSNP
rs995501899 2567 dbSNP
rs898738033 2572 dbSNP
rs1037269803 2575 dbSNP
rs1349253900 2583 dbSNP
rs1056783628 2590 dbSNP
rs1185029242 2612 dbSNP
rs940294877 2626 dbSNP
rs1406891420 2627 dbSNP
rs891265911 2630 dbSNP
rs927512446 2631 dbSNP
rs1192695880 2636 dbSNP
rs1421320867 2639 dbSNP
rs1176332056 2647 dbSNP
rs1439900601 2652 dbSNP
rs542359721 2658 dbSNP
rs1239509282 2660 dbSNP
rs979018191 2667 dbSNP
rs1191241046 2682 dbSNP
rs1051708016 2688 dbSNP
rs1314953689 2697 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.399 2.7e-2 -0.446 1.4e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.284 5.8e-2 -0.201 1.3e-1 32 Click to see details
GSE19350 CNS germ cell tumors -0.417 8.9e-2 -0.220 2.5e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.154 1.1e-1 -0.143 1.3e-1 64 Click to see details
GSE38226 Liver fibrosis 0.238 1.5e-1 0.254 1.3e-1 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.224 1.5e-1 -0.002 5.0e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.262 1.9e-1 -0.192 2.6e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.176 2.0e-1 -0.112 3.0e-1 25 Click to see details
GSE17306 Multiple myeloma -0.116 2.1e-1 -0.005 4.9e-1 49 Click to see details
GSE17498 Multiple myeloma -0.12 2.3e-1 -0.145 1.9e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.146 2.7e-1 -0.036 4.4e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.287 2.9e-1 -0.200 3.5e-1 6 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.109 3.0e-1 -0.044 4.2e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.02 4.6e-1 0.087 3.4e-1 24 Click to see details
GSE21849 B cell lymphoma 0.012 4.8e-1 -0.015 4.7e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.012 4.8e-1 0.006 4.9e-1 16 Click to see details
GSE14794 Lymphoblastoid cells 0.002 4.9e-1 0.019 4.3e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.639 0.04 0.548 0.08 8 Click to see details
CHOL -0.457 0.11 -0.467 0.1 9 Click to see details
KIRP -0.416 0.13 -0.783 0.01 9 Click to see details
HNSC -0.891 0.15 -1.000 0.5 3 Click to see details
LIHC 0.109 0.23 -0.066 0.33 49 Click to see details
THCA -0.318 0.3 0.100 0.44 5 Click to see details
KICH -0.188 0.33 0.000 0.5 8 Click to see details
KIRC -0.083 0.33 -0.100 0.3 29 Click to see details
ESCA 0.244 0.35 0.000 0.5 5 Click to see details
ESCA 0.244 0.35 0.000 0.5 5 Click to see details
ESCA 0.244 0.35 0.000 0.5 5 Click to see details
ESCA 0.244 0.35 0.000 0.5 5 Click to see details
ESCA 0.244 0.35 0.000 0.5 5 Click to see details
ESCA 0.244 0.35 0.000 0.5 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*