-->
miRTarBase - #MIRT023362 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HSPA5   
Synonyms BIP, GRP78, HEL-S-89n, MIF2
Description heat shock protein family A (Hsp70) member 5
Transcript NM_005347   
Expression
Putative miRNA Targets on HSPA5
3'UTR of HSPA5
(miRNA target sites are highlighted)		 
>HSPA5|NM_005347|3'UTR
   1 ACACTGATCTGCTAGTGCTGTAATATTGTAAATACTGGACTCAGGAACTTTTGTTAGGAAAAAATTGAAAGAACTTAAGT
  81 CTCGAATGTAATTGGAATCTTCACCTCAGAGTGGAGTTGAAACTGCTATAGCCTAAGCGGCTGTTTACTGCTTTTCATTA
 161 GCAGTTGCTCACATGTCTTTGGGTGGGGGGGAGAAGAAGAATTGGCCATCTTAAAAAGCGGGTAAAAAACCTGGGTTAGG
 241 GTGTGTGTTCACCTTCAAAATGTTCTATTTAACAACTGGGTCATGTGCATCTGGTGTAGGAAGTTTTTTCTACCATAAGT
 321 GACACCAATAAATGTTTGTTATTTACACTGGTCTAATGTTTGTGAGAAGCTTCTAATTAGATCAATTACTTATTTTAGGA
 401 AATTTAAGACTAGATACTCGTGTGTGGGGTGAGGGGAGGGAGTATTTGGTATGTTGGGATAAGGAAACACTTCTATTTAA
 481 TGCTTCCAGGGATTTTTTTTTTTTTTTTTAACCCTCCTGGGCCCAAGTGATCCTTCCACCTCAGTCTCCCAGCTAATTGA
 561 GACCACAGGCTTGTTACCACCATGCTCGGCTTTTGCATTAATCTAAGAAAAGGGGAGAGAAGTTAATCCACATCTTTACT
 641 CAGGCAAGGGGCATTTCACAGTGCCCAAGAGTGGGGTTTTCTTGAACATACTTGGTTTCCTATTTCCCCTTATCTTTCTA
 721 AAACTGCCTTTCTGGTGGCTTTTTTTAAAATTATTACTAATGATGCTTTTATAGCTGCTTGGATTCTCTGAGAAATGATG
 801 GGGAGTGAGTGATCACTGGTATTAACTTTATACACTTGGATTTCATTTGTAACTTTAGGATGTAAAGGTATATTGTGAAC
 881 CCTAGCTGTGTCAGAATCTCCATCCCTGAAATTTCTCATTAGTGGTACTGGGGTGGGATCTTGGATGGTGACATTGAAAC
 961 TACACTAAATCCCCTCACTATGAATGGGTTGTTAAAGGCAATGGTTTGTGTCAAAACTGGTTTAGGATTACTTAGATTGT
1041 GTTCCTGAAGAAAAGAGTCCAGGTAAATGGTATGATCAATAAAGGACAGGCTGGTGCTAACATAAAATCCAATATTGTAA
1121 TCCTAGCACTTTGGGAGGCCAAGGCGGGTGGATCACAAGGTCAAGAGATAGAGACCATCTTTGCCAACATGGTGAAACTC
1201 CATCTCTACTGAAAATACAAAAATTAGCTGGGCGTGGTAGTGCAAGCTGAAGGCTGAGGCAGGAGAATCACTCGAACCCG
1281 GGAGGCAGAGGTTGCAGTGAGCCGAGATCACACCACTGTACTCCAGCCCGGCACTCCAGCCTGGCGACAAGAGTGAGACT
1361 CCACCTCAAAAAAAAAAAAAAGAATCCAATACTGCCCAAGGATAGGTATTTTATAGATGGGCAACTGGCTGAAAGGTTAA
1441 TTCTCTAGGGCTAGTAGAACTGGATCCCAACACCAAACTCTTAATTAGACCTAGGCCTCAGCTGCACTGCCCGAAAAGCA
1521 TTTGGGCAGACCCTGAGCAGAATACTGGTCTCAGGCCAAGCCCAATACAGCCATTAAAGATGACCTACAGTGCTGTGTAC
1601 CCTGGGGCAATAGGGTTAAATGGTAGTTAGCAACTAGGGCTAGTCTTCCCTTACCTCAAAGGCTCTCACTACCGTGGACC
1681 ACCTAGTCTGTAACTCTTTCTGAGGAGCTGTTACTGAATATTAAAAAGATAGACTTCAACTATGAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1 
miRNA  3' guuUGUGGUAACA---------G-UGUGAGGu 5'
             |||||| |||         | :|||||| 
Target 5' atcACACCACTGTACTCCAGCCCGGCACTCCa 3'
 		1307 - 1338 139.00 -19.80
2 
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              || ||| || | ||||| 
Target 5' ttgcCAACATGGTGAAACTCCa 3'
 		1181 - 1202 134.00 -12.00
3 
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        |||||:| 
Target 5' gttgggataaggaaACACTTCt 3'
 		453 - 474 124.00 -7.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31559412 32 COSMIC
COSN31576523 44 COSMIC
COSN26979438 60 COSMIC
COSN30166687 66 COSMIC
COSN30123958 84 COSMIC
COSN30501986 109 COSMIC
COSN30519449 109 COSMIC
COSN31591781 150 COSMIC
COSN31532605 184 COSMIC
COSN20092014 185 COSMIC
COSN2310540 199 COSMIC
COSN17076019 243 COSMIC
COSN2310538 277 COSMIC
COSN28425972 319 COSMIC
COSN20106605 493 COSMIC
COSN16454680 557 COSMIC
COSN23884996 844 COSMIC
COSN15739677 869 COSMIC
COSN29325469 1080 COSMIC
COSN32214848 1194 COSMIC
COSN32214847 1299 COSMIC
COSN30066230 1537 COSMIC
COSN32214846 1702 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs370379797 7 dbSNP
rs1333898323 17 dbSNP
rs201563180 24 dbSNP
rs776180854 26 dbSNP
rs767964385 27 dbSNP
rs762374850 30 dbSNP
rs374304928 33 dbSNP
rs371044182 36 dbSNP
rs1413088404 40 dbSNP
rs1351094724 42 dbSNP
rs749620615 43 dbSNP
rs377621230 48 dbSNP
rs1042373878 50 dbSNP
rs745994144 51 dbSNP
rs549555794 65 dbSNP
rs1199682739 66 dbSNP
rs896500678 71 dbSNP
rs1288121247 83 dbSNP
rs1289708066 84 dbSNP
rs1352842270 111 dbSNP
rs781703382 123 dbSNP
rs184764893 128 dbSNP
rs1002112028 129 dbSNP
rs1306726732 137 dbSNP
rs7922 138 dbSNP
rs1224256193 157 dbSNP
rs1292687008 158 dbSNP
rs1490256351 168 dbSNP
rs1048942716 173 dbSNP
rs1254124893 175 dbSNP
rs929154427 176 dbSNP
rs919082883 182 dbSNP
rs1405725724 183 dbSNP
rs1425268510 184 dbSNP
rs539758783 185 dbSNP
rs375214521 186 dbSNP
rs1003872812 187 dbSNP
rs1414585594 191 dbSNP
rs951074055 192 dbSNP
rs545483922 193 dbSNP
rs764342860 202 dbSNP
rs1316196328 204 dbSNP
rs1418398446 209 dbSNP
rs1358960361 217 dbSNP
rs547105684 218 dbSNP
rs8759 220 dbSNP
rs1438412280 224 dbSNP
rs1203923284 230 dbSNP
rs1055277525 233 dbSNP
rs985799328 235 dbSNP
rs1183951644 237 dbSNP
rs956985468 240 dbSNP
rs1442387427 241 dbSNP
rs1170152004 249 dbSNP
rs532229278 250 dbSNP
rs925546632 254 dbSNP
rs1366966967 258 dbSNP
rs1353215658 260 dbSNP
rs879103793 273 dbSNP
rs193070834 283 dbSNP
rs1337798797 285 dbSNP
rs544297547 286 dbSNP
rs530793569 288 dbSNP
rs1478051873 294 dbSNP
rs766369605 301 dbSNP
rs1214445336 313 dbSNP
rs1272081983 315 dbSNP
rs1340364256 319 dbSNP
rs1021105850 325 dbSNP
rs775339168 325 dbSNP
rs1290433765 328 dbSNP
rs1271036852 330 dbSNP
rs1211136150 341 dbSNP
rs1204297058 342 dbSNP
rs1353596477 346 dbSNP
rs1283278652 348 dbSNP
rs1218841868 349 dbSNP
rs1459765329 349 dbSNP
rs865855272 350 dbSNP
rs1242296985 351 dbSNP
rs12352030 353 dbSNP
rs1165628958 355 dbSNP
rs1014127801 364 dbSNP
rs912516305 375 dbSNP
rs1341591065 376 dbSNP
rs1280488887 380 dbSNP
rs139823170 385 dbSNP
rs1345138222 393 dbSNP
rs541771507 393 dbSNP
rs1430333085 398 dbSNP
rs187978141 403 dbSNP
rs1347526277 405 dbSNP
rs921118086 413 dbSNP
rs1407189047 417 dbSNP
rs1262356576 419 dbSNP
rs759554665 420 dbSNP
rs1164553258 423 dbSNP
rs1284751967 431 dbSNP
rs973861938 443 dbSNP
rs962467724 446 dbSNP
rs1478268087 457 dbSNP
rs908281784 458 dbSNP
rs887750767 459 dbSNP
rs552785466 463 dbSNP
rs1198107248 465 dbSNP
rs1429146324 471 dbSNP
rs16927997 474 dbSNP
rs993408851 475 dbSNP
rs1386211897 479 dbSNP
rs971094481 486 dbSNP
rs1316417776 488 dbSNP
rs1247251127 489 dbSNP
rs1024362019 491 dbSNP
rs897691236 498 dbSNP
rs1200876146 509 dbSNP
rs1241146703 510 dbSNP
rs1459438217 510 dbSNP
rs34358468 510 dbSNP
rs397734296 510 dbSNP
rs533396738 510 dbSNP
rs879172863 510 dbSNP
rs1348038249 512 dbSNP
rs1184671340 513 dbSNP
rs910920259 515 dbSNP
rs1449425959 518 dbSNP
rs1469884048 526 dbSNP
rs1157221086 527 dbSNP
rs1387258072 532 dbSNP
rs1288517178 540 dbSNP
rs1198963796 554 dbSNP
rs1013865109 557 dbSNP
rs760608713 577 dbSNP
rs767511327 585 dbSNP
rs35228219 588 dbSNP
rs1319565094 589 dbSNP
rs1393229993 597 dbSNP
rs1255702307 601 dbSNP
rs959593524 617 dbSNP
rs1040198553 619 dbSNP
rs1316963322 628 dbSNP
rs1001027372 631 dbSNP
rs766954501 638 dbSNP
rs1439200817 640 dbSNP
rs147455948 646 dbSNP
rs910303741 650 dbSNP
rs1195875802 652 dbSNP
rs1050147501 665 dbSNP
rs547857487 670 dbSNP
rs35130081 675 dbSNP
rs1245398491 701 dbSNP
rs932597665 702 dbSNP
rs1163108102 706 dbSNP
rs770818733 709 dbSNP
rs1409200441 714 dbSNP
rs1463557115 716 dbSNP
rs574033766 720 dbSNP
rs979706069 727 dbSNP
rs1389647256 732 dbSNP
rs1338455988 740 dbSNP
rs569522206 746 dbSNP
rs1312370080 747 dbSNP
rs35204075 747 dbSNP
rs577800796 751 dbSNP
rs763081615 753 dbSNP
rs1250318440 762 dbSNP
rs773911474 762 dbSNP
rs992347466 763 dbSNP
rs961121039 766 dbSNP
rs1033738461 771 dbSNP
rs1458682638 771 dbSNP
rs1002231438 774 dbSNP
rs1236020201 774 dbSNP
rs369656374 781 dbSNP
rs949813991 783 dbSNP
rs34295340 789 dbSNP
rs1027608788 790 dbSNP
rs1183401614 795 dbSNP
rs536195133 800 dbSNP
rs1203344641 801 dbSNP
rs916946213 809 dbSNP
rs1307339236 814 dbSNP
rs1463992510 818 dbSNP
rs993854623 819 dbSNP
rs1279777304 820 dbSNP
rs1406735147 831 dbSNP
rs991141486 834 dbSNP
rs567052770 835 dbSNP
rs773464793 836 dbSNP
rs1363606545 837 dbSNP
rs769846479 840 dbSNP
rs1163874460 844 dbSNP
rs865971004 846 dbSNP
rs979643791 858 dbSNP
rs748180899 862 dbSNP
rs1324911428 869 dbSNP
rs770588256 873 dbSNP
rs1203411150 875 dbSNP
rs1329618381 877 dbSNP
rs1486971762 880 dbSNP
rs1206007183 881 dbSNP
rs1441735479 883 dbSNP
rs1201718437 884 dbSNP
rs1429847726 889 dbSNP
rs1480096073 895 dbSNP
rs1359599554 897 dbSNP
rs1008747477 904 dbSNP
rs1021513991 905 dbSNP
rs888926205 917 dbSNP
rs1287858735 921 dbSNP
rs1050203586 922 dbSNP
rs1406195801 938 dbSNP
rs1177977640 949 dbSNP
rs935720394 949 dbSNP
rs781284602 953 dbSNP
rs1346664045 958 dbSNP
rs1223516478 960 dbSNP
rs1412488948 964 dbSNP
rs1299633631 970 dbSNP
rs904231006 972 dbSNP
rs1394431229 980 dbSNP
rs553613596 986 dbSNP
rs149360936 989 dbSNP
rs1441049273 990 dbSNP
rs531372256 996 dbSNP
rs945669507 1008 dbSNP
rs1377929238 1010 dbSNP
rs1487441950 1019 dbSNP
rs1224785321 1022 dbSNP
rs914160989 1031 dbSNP
rs746508172 1035 dbSNP
rs1029650910 1036 dbSNP
rs539887938 1037 dbSNP
rs1410088196 1049 dbSNP
rs1419411620 1055 dbSNP
rs777330435 1055 dbSNP
rs1378076340 1068 dbSNP
rs892755990 1068 dbSNP
rs992796830 1069 dbSNP
rs1238786347 1072 dbSNP
rs1364479970 1077 dbSNP
rs1433697717 1077 dbSNP
rs1212709827 1079 dbSNP
rs899802635 1081 dbSNP
rs1038258111 1090 dbSNP
rs1306794346 1092 dbSNP
rs192990703 1095 dbSNP
rs1484872082 1115 dbSNP
rs1280289008 1116 dbSNP
rs1351740508 1125 dbSNP
rs939564909 1139 dbSNP
rs570866292 1145 dbSNP
rs550905481 1146 dbSNP
rs1358745474 1150 dbSNP
rs886964663 1159 dbSNP
rs1234487343 1166 dbSNP
rs1356020639 1171 dbSNP
rs1480948044 1174 dbSNP
rs768980593 1176 dbSNP
rs980859924 1187 dbSNP
rs530810056 1189 dbSNP
rs1446072595 1200 dbSNP
rs1223228763 1201 dbSNP
rs1380189341 1202 dbSNP
rs1403052459 1203 dbSNP
rs1304762129 1212 dbSNP
rs1445587269 1216 dbSNP
rs1374598649 1218 dbSNP
rs1443609270 1229 dbSNP
rs533854821 1230 dbSNP
rs949859904 1233 dbSNP
rs1027660611 1234 dbSNP
rs1382338222 1236 dbSNP
rs972090984 1237 dbSNP
rs1226659037 1241 dbSNP
rs1298794067 1255 dbSNP
rs962328470 1271 dbSNP
rs569905472 1273 dbSNP
rs1009219349 1277 dbSNP
rs888977274 1278 dbSNP
rs1140763 1279 dbSNP
rs373335205 1280 dbSNP
rs991192397 1281 dbSNP
rs904282058 1285 dbSNP
rs1415549521 1297 dbSNP
rs1187731265 1298 dbSNP
rs1041821074 1302 dbSNP
rs945750565 1303 dbSNP
rs528399935 1306 dbSNP
rs1471137885 1311 dbSNP
rs895458269 1315 dbSNP
rs1340063423 1318 dbSNP
rs1056741104 1326 dbSNP
rs939602293 1329 dbSNP
rs372771226 1330 dbSNP
rs979722804 1333 dbSNP
rs1218092718 1334 dbSNP
rs1276176243 1341 dbSNP
rs1052445598 1342 dbSNP
rs1218073612 1342 dbSNP
rs369770310 1342 dbSNP
rs1489561257 1344 dbSNP
rs1259431058 1345 dbSNP
rs1440336719 1346 dbSNP
rs1217575994 1347 dbSNP
rs545692465 1350 dbSNP
rs1215189326 1351 dbSNP
rs1242353065 1356 dbSNP
rs1396648165 1357 dbSNP
rs1474757157 1357 dbSNP
rs1322367108 1365 dbSNP
rs1413761648 1367 dbSNP
rs576829808 1369 dbSNP
rs1481728186 1378 dbSNP
rs980912083 1380 dbSNP
rs1021150026 1382 dbSNP
rs1346040993 1382 dbSNP
rs1402012302 1382 dbSNP
rs764080853 1382 dbSNP
rs955521101 1382 dbSNP
rs968590427 1382 dbSNP
rs988705261 1382 dbSNP
rs1029703154 1383 dbSNP
rs1354653066 1384 dbSNP
rs1278610261 1385 dbSNP
rs1342544926 1385 dbSNP
rs1284473229 1387 dbSNP
rs930770942 1392 dbSNP
rs920706759 1400 dbSNP
rs972527062 1402 dbSNP
rs1213786248 1413 dbSNP
rs1270494251 1418 dbSNP
rs962100900 1420 dbSNP
rs1358570968 1433 dbSNP
rs911865407 1435 dbSNP
rs779266748 1436 dbSNP
rs953269666 1440 dbSNP
rs1028882017 1445 dbSNP
rs1160673439 1450 dbSNP
rs780267177 1452 dbSNP
rs1419376208 1454 dbSNP
rs1351093458 1463 dbSNP
rs1005490140 1464 dbSNP
rs1162331057 1466 dbSNP
rs1405645477 1475 dbSNP
rs1329304025 1480 dbSNP
rs887012804 1481 dbSNP
rs1046927289 1484 dbSNP
rs1352519228 1499 dbSNP
rs1237581617 1509 dbSNP
rs758860154 1512 dbSNP
rs1460592897 1513 dbSNP
rs1208753187 1522 dbSNP
rs1423813699 1524 dbSNP
rs1194867510 1531 dbSNP
rs777134316 1534 dbSNP
rs1478981696 1536 dbSNP
rs1184392803 1547 dbSNP
rs1233890890 1548 dbSNP
rs1020045678 1551 dbSNP
rs35189333 1563 dbSNP
rs1157023751 1564 dbSNP
rs12009 1568 dbSNP
rs1057193360 1577 dbSNP
rs777616631 1589 dbSNP
rs1411656142 1598 dbSNP
rs925628591 1599 dbSNP
rs1375797616 1601 dbSNP
rs1043099541 1605 dbSNP
rs905454682 1611 dbSNP
rs1383098265 1615 dbSNP
rs1045264699 1622 dbSNP
rs1263215199 1625 dbSNP
rs1354858819 1628 dbSNP
rs1334456560 1629 dbSNP
rs1198144069 1634 dbSNP
rs1259285622 1636 dbSNP
rs1457546624 1637 dbSNP
rs1177194796 1640 dbSNP
rs1245145926 1656 dbSNP
rs914135849 1660 dbSNP
rs574474975 1663 dbSNP
rs920746006 1666 dbSNP
rs554639248 1668 dbSNP
rs940770898 1669 dbSNP
rs1399496707 1673 dbSNP
rs868810999 1674 dbSNP
rs911933100 1678 dbSNP
rs1338510313 1692 dbSNP
rs1294831805 1698 dbSNP
rs955544906 1702 dbSNP
rs988368233 1702 dbSNP
rs550046031 1704 dbSNP
rs922744092 1707 dbSNP
rs1327620993 1710 dbSNP
rs975486505 1714 dbSNP
rs1279346988 1718 dbSNP
rs964077681 1720 dbSNP
rs1387265210 1727 dbSNP
rs1369191383 1728 dbSNP
rs1016918116 1734 dbSNP
rs1265432463 1735 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Yang F; Zhang L; Wang F; Wang Y; Huo XS; et al.
- Neoplasia (New York, N.Y.), 2011
The loss of microRNA-122 (miR-122) expression correlates to many characteristic properties of hepatocellular carcinoma (HCC) cells, including clonogenic survival, anchorage-independent growth, migration, invasion, epithelial-mesenchymal transition, and tumorigenesis. However, all of these findings do not sufficiently explain the oncogenic potential of miR-122. In the current study, we used two-dimensional differential in-gel electrophoresis to measure changes in the expression of thousands of proteins in response to the inhibition of miR-122 in human hepatoma cells. Several proteins that were upregulated on miR-122 inhibition were involved in the unfolded protein response (UPR) pathway. The overexpression of miR-122 resulted in the repression of UPR pathway activation. Therefore, miR-122 may act as an inhibitor of the chaperone gene expression and negatively regulate the UPR pathway in HCC. We further showed that the miR-122 inhibitor enhanced the stability of the 26S proteasome non-ATPase regulatory subunit 10 (PSMD10) through the up-regulation of its target gene cyclin-dependent kinase 4 (CDK4). This process may activate the UPR pathway to prevent chemotherapy-mediated tumor cell apoptosis. The current study suggests that miR-122 negatively regulates the UPR through the CDK4-PSMD10 pathway. The down-regulation of miR-122 activated the CDK4-PSMD10-UPR pathway to decrease tumor cell anticancer drug-mediated apoptosis. We identified a new HCC therapeutic target and proclaimed the potential risk of the therapeutic use of miR-122 silencing.
LinkOut: [PMID: 21750653]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.228 3.5e-2 -0.177 8.1e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.324 6.6e-2 0.105 3.2e-1 23 Click to see details
GSE32688 Pancreatic cancer 0.258 7.7e-2 0.377 1.7e-2 32 Click to see details
GSE28544 Breast cancer -0.28 9.3e-2 -0.215 1.6e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.29 1.1e-1 0.188 2.1e-1 20 Click to see details
GSE38226 Liver fibrosis 0.281 1.1e-1 0.319 7.9e-2 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.23 1.3e-1 0.081 3.5e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.164 2.2e-1 0.153 2.3e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.152 2.4e-1 -0.262 1.1e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.152 3.2e-1 0.455 6.9e-2 12 Click to see details
GSE14794 Lymphoblastoid cells 0.043 3.4e-1 0.054 3.1e-1 90 Click to see details
GSE17498 Multiple myeloma 0.057 3.6e-1 -0.016 4.6e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.08 4.0e-1 -0.044 4.4e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.036 4.5e-1 -0.038 4.4e-1 16 Click to see details
GSE17306 Multiple myeloma 0.018 4.5e-1 0.070 3.2e-1 49 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.06 4.6e-1 -0.257 3.1e-1 6 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.06 4.6e-1 -0.257 3.1e-1 6 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.428 0 0.348 0.01 49 Click to see details
STAD 0.712 0.02 0.619 0.05 8 Click to see details
KIRP -0.636 0.03 -0.383 0.15 9 Click to see details
KIRC -0.241 0.1 -0.273 0.08 29 Click to see details
THCA 0.559 0.16 0.800 0.05 5 Click to see details
CHOL -0.333 0.19 -0.250 0.26 9 Click to see details
HNSC -0.774 0.22 -1.000 0.5 3 Click to see details
KICH -0.121 0.39 -0.167 0.35 8 Click to see details
ESCA -0.068 0.46 0.000 0.5 5 Click to see details
ESCA -0.068 0.46 0.000 0.5 5 Click to see details
ESCA -0.068 0.46 0.000 0.5 5 Click to see details
ESCA -0.068 0.46 0.000 0.5 5 Click to see details
ESCA -0.068 0.46 0.000 0.5 5 Click to see details
ESCA -0.068 0.46 0.000 0.5 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
Error report submission
MIRT ID*
Your e-Mail*
Memo*