pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-122 |
Genomic Coordinates | chr18: 58451074 - 58451158 |
Synonyms | MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122 |
Description | Homo sapiens miR-122 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-122-5p | |||||||||||||||||||||
Sequence | 15| UGGAGUGUGACAAUGGUGUUUG |36 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Cloned | |||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
Circulating MicroRNA Expression Profiling | Circulating MicroRNA Expression Profiling |
---|
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | DYNC1H1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | CMT2O, DHC1, DHC1a, DNCH1, DNCL, DNECL, DYHC, Dnchc1, HL-3, SMALED1, p22 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | dynein cytoplasmic 1 heavy chain 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001376 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on DYNC1H1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of DYNC1H1 (miRNA target sites are highlighted) |
>DYNC1H1|NM_001376|3'UTR 1 ACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTG 81 AGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGA 161 AGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCAAAAA 241 AAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Article |
- Grimson A; Farh KK; Johnston WK; et al. - Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
|
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT000012 | CYP7A1 | cytochrome P450 family 7 subfamily A member 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT000364 | IGF1R | insulin like growth factor 1 receptor | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT000365 | SRF | serum response factor | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT000663 | RAC1 | Rac family small GTPase 1 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 2 | |||
MIRT000717 | RHOA | ras homolog family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT003006 | CCNG1 | cyclin G1 | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT003079 | GTF2B | general transcription factor IIB | ![]() |
![]() |
2 | 1 | ||||||
MIRT003080 | GYS1 | glycogen synthase 1 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT003081 | ANK2 | ankyrin 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003082 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003083 | ENTPD4 | ectonucleoside triphosphate diphosphohydrolase 4 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003084 | ANXA11 | annexin A11 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT003085 | ALDOA | aldolase, fructose-bisphosphate A | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT003086 | RAB6B | RAB6B, member RAS oncogene family | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003087 | RAB11FIP1 | RAB11 family interacting protein 1 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT003088 | FOXP1 | forkhead box P1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003089 | MECP2 | methyl-CpG binding protein 2 | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT003090 | NCAM1 | neural cell adhesion molecule 1 | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT003091 | UBAP2 | ubiquitin associated protein 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003092 | TBX19 | T-box 19 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003093 | AACS | acetoacetyl-CoA synthetase | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003094 | DUSP2 | dual specificity phosphatase 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003095 | ATP1A2 | ATPase Na+/K+ transporting subunit alpha 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003097 | MAPK11 | mitogen-activated protein kinase 11 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003098 | FUNDC2 | FUN14 domain containing 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003099 | AKT3 | AKT serine/threonine kinase 3 | ![]() |
![]() |
![]() |
3 | 3 | |||||
MIRT003100 | TPD52L2 | tumor protein D52 like 2 | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT003102 | GALNT10 | polypeptide N-acetylgalactosaminyltransferase 10 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT003103 | G6PC3 | glucose-6-phosphatase catalytic subunit 3 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT003104 | AP3M2 | adaptor related protein complex 3 mu 2 subunit | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003105 | SLC7A1 | solute carrier family 7 member 1 | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT003106 | XPO6 | exportin 6 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003107 | FOXJ3 | forkhead box J3 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003108 | SLC7A11 | solute carrier family 7 member 11 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003109 | TRIB1 | tribbles pseudokinase 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003110 | EGLN3 | egl-9 family hypoxia inducible factor 3 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003111 | NUMBL | NUMB like, endocytic adaptor protein | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003112 | ADAM17 | ADAM metallopeptidase domain 17 | ![]() |
![]() |
![]() |
3 | 5 | |||||
MIRT003727 | DSTYK | dual serine/threonine and tyrosine protein kinase | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT003728 | FAM117B | family with sequence similarity 117 member B | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT004364 | BCL2L2 | BCL2 like 2 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT004527 | PRKAB1 | protein kinase AMP-activated non-catalytic subunit beta 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT004879 | ADAM10 | ADAM metallopeptidase domain 10 | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT005782 | ACVR1C | activin A receptor type 1C | ![]() |
1 | 1 | |||||||
MIRT006123 | PRKRA | protein activator of interferon induced protein kinase EIF2AK2 | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT006421 | WNT1 | Wnt family member 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT007007 | PTPN1 | protein tyrosine phosphatase, non-receptor type 1 | ![]() |
1 | 1 | |||||||
MIRT007081 | NT5C3A | 5'-nucleotidase, cytosolic IIIA | ![]() |
1 | 1 | |||||||
MIRT007082 | P4HA1 | prolyl 4-hydroxylase subunit alpha 1 | ![]() |
1 | 1 | |||||||
MIRT007083 | ZNF395 | zinc finger protein 395 | ![]() |
1 | 1 | |||||||
MIRT007084 | SOCS1 | suppressor of cytokine signaling 1 | ![]() |
1 | 1 | |||||||
MIRT023217 | SSR3 | signal sequence receptor subunit 3 | ![]() |
1 | 1 | |||||||
MIRT023218 | PHOX2A | paired like homeobox 2a | ![]() |
1 | 1 | |||||||
MIRT023219 | DZIP1L | DAZ interacting zinc finger protein 1 like | ![]() |
1 | 1 | |||||||
MIRT023220 | GSTM2 | glutathione S-transferase mu 2 | ![]() |
1 | 1 | |||||||
MIRT023221 | RAI14 | retinoic acid induced 14 | ![]() |
1 | 1 | |||||||
MIRT023222 | STARD13 | StAR related lipid transfer domain containing 13 | ![]() |
1 | 1 | |||||||
MIRT023223 | CNN3 | calponin 3 | ![]() |
1 | 1 | |||||||
MIRT023224 | A2M | alpha-2-macroglobulin | ![]() |
1 | 1 | |||||||
MIRT023225 | EFCAB6 | EF-hand calcium binding domain 6 | ![]() |
1 | 1 | |||||||
MIRT023226 | GLOD4 | glyoxalase domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT023227 | CALR | calreticulin | ![]() |
1 | 1 | |||||||
MIRT023228 | POFUT1 | protein O-fucosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT023229 | PYGO1 | pygopus family PHD finger 1 | ![]() |
1 | 1 | |||||||
MIRT023230 | CDY2B | chromodomain Y-linked 2B | ![]() |
1 | 1 | |||||||