-->
miRTarBase - #MIRT023351 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAZ   
Synonyms PUR1, Pur-1, SAF-1, SAF-2, SAF-3, ZF87, ZNF801, Zif87
Description MYC associated zinc finger protein
Transcript NM_001042539   
Other Transcripts NM_002383   
Expression
Putative miRNA Targets on MAZ
3'UTR of MAZ
(miRNA target sites are highlighted)		 
>MAZ|NM_001042539|3'UTR
   1 GGGGGACCCCCGCACCCACCAGGTACTGGTGAGGTTTGTCCAATGGCGGCGGCAGCGGCAGCGGCGGCAGCGGCAGCAGC
  81 GGCAGCAGTAGCAGCCCCTCCCACAGCTGTGGGCTCCCTCTCGGGGGCGGAGGGGGTGCCTGTGAGCTCTCAGCCACTTC
 161 CCTCCCAACCCTGGTGAGCTCCAAGTTGGTTGCGGGGGAGAGGGGAGAATGGAGTAGAGTCCCTTGGTACAAGCTCCTCT
 241 CCCCCCTCTTTTCCCACCAACTCCTATTTCCCTACCAACCAAGGAGCCTCCAGAAGGAAAGGAGGAAGAAATGTTTTCTT
 321 AGGGGAATTCGCTAGGTTTTAACGATTTGTTTCTCCTGCTCCTCTTCTATCAGACCTGACCCCACACAAACCTGTCCCCT
 401 CGGTTGTGTTGAAGTCCCCTGGACAGTGGGCAGGGGTGGCAGAGGACACGAGCAGCCACTGCCCGTACCCCCTCTCCTCT
 481 CTGTAAGCCCATGCCCTGTCTTCCCAGGGACTTGTGAGCCTCTTCCCTCGACGGTCCTCTTCTCTCCTTCCAGTCCTCTC
 561 CCCCTGCTGTCTGCAGCCCCTCCCCGGGGAGTTGGTGCTTTCTTTTCCTTTTTTTTTTTTTTCCAGGGGGAGGGAGGAGA
 641 GGAAGGAGGGGGATCAGAGCTGTCCCAAAGAGGGAAAGCGGTGAGGTTTGAGGAGGGGCAGAAGCAGGGCCGGCAAAGGT
 721 TGTACCTTCATAAGGTGGTATGGGGGGTTGGGGTCAGGCCCTGAACATCGTCCTACTTGAGAATCTGTCAGGGGAAAAAG
 801 TCAAGGGGAGCAGGAGGAAGAGCCAGGAGGGCCAGAGGCAGAGAAGAGATGGAGTCTTAGGGGCCAGGGTGAGCGAGGGG
 881 TCCAGGGCCTAGAGGTGCTTCCTGGGGGCGGGGGAATGCAGCCAGTGTCCCCCTCCCCTCTTCCACCCCAGCTCCAGCCC
 961 TGGTCTTGTCTTTTCATCCCTCTTCCCCACGACAGAAGAAGTTGTGGCCCTGGCCATGTCATCGTGTTCCTGTGTCCCCT
1041 GCATGTACCCCACCCTCCACCCCTTCCTTTTGCGCGGACCCCATTACAATAAATTTTAAATAAAATCCTGTTTCTGGCTC
1121 TGGATTGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1 
miRNA  3' guuuguGGUAACAGUGU--GAGGu 5'
                || ||| :|||  |||| 
Target 5' tagagtCCCTTGGTACAAGCTCCt 3'
 		215 - 238 120.00 -10.80
2 
miRNA  3' guuugugGUAACA----GUGUGAGGu 5'
                 || |||    ||| |||| 
Target 5' tcccctgCA-TGTACCCCACCCTCCa 3'
 		1035 - 1059 116.00 -13.30
3 
miRNA  3' guuuGUGGUAACAGUG--UGAGGu 5'
              | |: ||  |||  ||||| 
Target 5' ccccCTCTTTTCCCACCAACTCCt 3'
 		242 - 265 114.00 -10.01
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26983870 158 COSMIC
COSN16132056 203 COSMIC
COSN26983867 236 COSMIC
COSN13664810 272 COSMIC
COSN26983869 275 COSMIC
COSN509338 293 COSMIC
COSN13664812 303 COSMIC
COSN31494403 316 COSMIC
COSM1629860 328 COSMIC
COSM8155619 330 COSMIC
COSM7861430 335 COSMIC
COSM1588370 360 COSMIC
COSM6708947 361 COSMIC
COSM435074 363 COSMIC
COSM6708954 364 COSMIC
COSM3765885 367 COSMIC
COSM5713274 367 COSMIC
COSM5220006 372 COSMIC
COSM6144181 372 COSMIC
COSM5178395 373 COSMIC
COSM6708956 375 COSMIC
COSM1377258 376 COSMIC
COSM4771538 376 COSMIC
COSM1377259 379 COSMIC
COSM3414579 379 COSMIC
COSM8171190 379 COSMIC
COSM7658401 382 COSMIC
COSM7284702 388 COSMIC
COSM7452843 391 COSMIC
COSM4448806 393 COSMIC
COSM6708955 394 COSMIC
COSM8306853 397 COSMIC
COSM4610825 401 COSMIC
COSM6144180 402 COSMIC
COSM7767504 402 COSMIC
COSM7767519 403 COSMIC
COSM9750815 410 COSMIC
COSM8500530 435 COSMIC
COSM3937024 438 COSMIC
COSM8223990 441 COSMIC
COSM4128949 444 COSMIC
COSM1478768 464 COSMIC
COSN30153067 491 COSMIC
COSN31490006 513 COSMIC
COSN31975186 536 COSMIC
COSN31975176 614 COSMIC
COSN26676758 743 COSMIC
COSN20046498 762 COSMIC
COSN28866055 777 COSMIC
COSN26647764 800 COSMIC
COSN24305734 804 COSMIC
COSN30561252 825 COSMIC
COSN26505787 842 COSMIC
COSN31591524 898 COSMIC
COSN27214146 935 COSMIC
COSN20873715 1036 COSMIC
COSN14998895 1094 COSMIC
COSN15380881 1251 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1425437290 1 dbSNP
rs759560918 6 dbSNP
rs1367902197 7 dbSNP
rs745871236 8 dbSNP
rs1322795411 11 dbSNP
rs528647449 12 dbSNP
rs767355862 12 dbSNP
rs1379449526 13 dbSNP
rs757888792 16 dbSNP
rs1434780242 17 dbSNP
rs974606989 18 dbSNP
rs779586971 21 dbSNP
rs1476775605 24 dbSNP
rs1187859847 26 dbSNP
rs1229348692 30 dbSNP
rs1312814638 36 dbSNP
rs1320528954 37 dbSNP
rs987108614 42 dbSNP
rs1482928044 43 dbSNP
rs752569552 43 dbSNP
rs1329670616 49 dbSNP
rs911570738 50 dbSNP
rs1219412229 55 dbSNP
rs1458544361 55 dbSNP
rs964624454 56 dbSNP
rs975068231 60 dbSNP
rs546902943 61 dbSNP
rs925806142 67 dbSNP
rs571590965 68 dbSNP
rs935865702 70 dbSNP
rs1054200457 73 dbSNP
rs893934784 74 dbSNP
rs950151234 76 dbSNP
rs1045675853 79 dbSNP
rs905863997 87 dbSNP
rs1354800411 88 dbSNP
rs190003392 89 dbSNP
rs945447399 92 dbSNP
rs1368833063 93 dbSNP
rs937607663 96 dbSNP
rs1274884453 97 dbSNP
rs1322105204 98 dbSNP
rs1042401495 101 dbSNP
rs550957792 103 dbSNP
rs12929524 105 dbSNP
rs906490080 111 dbSNP
rs1488673644 116 dbSNP
rs1214556654 118 dbSNP
rs368565899 119 dbSNP
rs1033959646 122 dbSNP
rs1358843091 123 dbSNP
rs760225176 133 dbSNP
rs765736478 134 dbSNP
rs1279515953 142 dbSNP
rs1475206036 143 dbSNP
rs994766227 144 dbSNP
rs537152646 146 dbSNP
rs1407026284 148 dbSNP
rs1391166210 149 dbSNP
rs540323579 153 dbSNP
rs771332085 154 dbSNP
rs1173137477 156 dbSNP
rs1027817256 158 dbSNP
rs1008657059 162 dbSNP
rs1420405236 166 dbSNP
rs1191650295 167 dbSNP
rs1018582388 170 dbSNP
rs1268458655 172 dbSNP
rs1209670939 178 dbSNP
rs1333175810 180 dbSNP
rs964771400 181 dbSNP
rs1424783093 185 dbSNP
rs1218867313 189 dbSNP
rs1316683501 195 dbSNP
rs950504577 197 dbSNP
rs1438514911 200 dbSNP
rs1331646625 203 dbSNP
rs1322620653 205 dbSNP
rs1033366878 207 dbSNP
rs974679396 207 dbSNP
rs182392729 208 dbSNP
rs988575316 210 dbSNP
rs1166271401 211 dbSNP
rs1455394973 215 dbSNP
rs1378669369 216 dbSNP
rs573796724 217 dbSNP
rs534795432 218 dbSNP
rs1018630388 220 dbSNP
rs1240425761 221 dbSNP
rs1198865931 228 dbSNP
rs72798129 233 dbSNP
rs186431278 236 dbSNP
rs974368473 246 dbSNP
rs921876597 248 dbSNP
rs1232011286 253 dbSNP
rs937369181 257 dbSNP
rs545462192 258 dbSNP
rs1223030324 259 dbSNP
rs557337334 262 dbSNP
rs1354216908 264 dbSNP
rs575499777 270 dbSNP
rs1304374371 271 dbSNP
rs1403006127 271 dbSNP
rs62056368 273 dbSNP
rs1172444556 274 dbSNP
rs543126643 279 dbSNP
rs1453177037 283 dbSNP
rs561189671 284 dbSNP
rs746633277 286 dbSNP
rs376283545 287 dbSNP
rs930222352 289 dbSNP
rs776161723 290 dbSNP
rs749602122 293 dbSNP
rs114187022 294 dbSNP
rs774988277 297 dbSNP
rs760172433 298 dbSNP
rs767677100 301 dbSNP
rs775675641 303 dbSNP
rs760856908 305 dbSNP
rs1324826819 306 dbSNP
rs764316091 307 dbSNP
rs757372201 311 dbSNP
rs1277933676 312 dbSNP
rs1377892815 313 dbSNP
rs1450480598 314 dbSNP
rs754009031 315 dbSNP
rs757068152 316 dbSNP
rs1329474255 322 dbSNP
rs1227325898 323 dbSNP
rs764997424 324 dbSNP
rs750337656 325 dbSNP
rs1363055330 327 dbSNP
rs779989772 328 dbSNP
rs746465612 329 dbSNP
rs1419414283 330 dbSNP
rs1482344440 336 dbSNP
rs1434429811 338 dbSNP
rs1184464182 339 dbSNP
rs754452531 342 dbSNP
rs780895243 344 dbSNP
rs189662522 348 dbSNP
rs1180212794 353 dbSNP
rs540404753 354 dbSNP
rs771307171 356 dbSNP
rs1215813000 357 dbSNP
rs750443159 357 dbSNP
rs779249242 357 dbSNP
rs780528070 357 dbSNP
rs1291830445 358 dbSNP
rs530039776 358 dbSNP
rs748595015 358 dbSNP
rs769299247 358 dbSNP
rs772983529 358 dbSNP
rs774900228 360 dbSNP
rs1405571648 361 dbSNP
rs370462022 361 dbSNP
rs565282629 361 dbSNP
rs759507460 361 dbSNP
rs767513620 361 dbSNP
rs746270470 363 dbSNP
rs532656391 364 dbSNP
rs750704529 364 dbSNP
rs760562143 364 dbSNP
rs765375529 364 dbSNP
rs1192838105 365 dbSNP
rs201662748 367 dbSNP
rs751657896 367 dbSNP
rs780065474 367 dbSNP
rs368894015 368 dbSNP
rs1432128240 369 dbSNP
rs756557743 370 dbSNP
rs772653230 370 dbSNP
rs1491100286 372 dbSNP
rs374878500 373 dbSNP
rs748884875 373 dbSNP
rs75194070 373 dbSNP
rs773951708 373 dbSNP
rs1309321339 374 dbSNP
rs776150016 375 dbSNP
rs199924629 376 dbSNP
rs760377330 376 dbSNP
rs767330698 376 dbSNP
rs775568236 376 dbSNP
rs1408905850 377 dbSNP
rs760738918 378 dbSNP
rs776438719 378 dbSNP
rs370548510 379 dbSNP
rs753879391 379 dbSNP
rs755151761 379 dbSNP
rs763109290 379 dbSNP
rs768682223 380 dbSNP
rs372208027 382 dbSNP
rs368361570 383 dbSNP
rs1004648374 384 dbSNP
rs1020884273 385 dbSNP
rs1220330648 385 dbSNP
rs753188781 385 dbSNP
rs767895242 385 dbSNP
rs769828163 385 dbSNP
rs1019139343 386 dbSNP
rs756584785 387 dbSNP
rs775555489 387 dbSNP
rs372438870 388 dbSNP
rs778245134 388 dbSNP
rs376973791 390 dbSNP
rs370120877 391 dbSNP
rs766238922 392 dbSNP
rs756947585 393 dbSNP
rs778752334 393 dbSNP
rs957294195 393 dbSNP
rs1440104073 394 dbSNP
rs745370728 394 dbSNP
rs751565808 394 dbSNP
rs771673066 396 dbSNP
rs1479666096 397 dbSNP
rs774879174 397 dbSNP
rs1210321496 398 dbSNP
rs1191013795 399 dbSNP
rs746921314 400 dbSNP
rs754499405 400 dbSNP
rs780618980 402 dbSNP
rs549096750 403 dbSNP
rs768497936 403 dbSNP
rs567229805 404 dbSNP
rs777594577 409 dbSNP
rs1370712370 410 dbSNP
rs746173841 411 dbSNP
rs967643384 414 dbSNP
rs1305763010 415 dbSNP
rs772566942 416 dbSNP
rs1351276649 419 dbSNP
rs1436697766 420 dbSNP
rs373402143 421 dbSNP
rs1368438982 426 dbSNP
rs780700096 427 dbSNP
rs1477284061 432 dbSNP
rs776384645 435 dbSNP
rs995948460 435 dbSNP
rs11559001 436 dbSNP
rs761982940 438 dbSNP
rs769946168 440 dbSNP
rs773428203 441 dbSNP
rs766218374 442 dbSNP
rs892845397 443 dbSNP
rs751490326 445 dbSNP
rs534860404 446 dbSNP
rs1466529001 447 dbSNP
rs767517958 448 dbSNP
rs1189828169 449 dbSNP
rs752095106 450 dbSNP
rs375977133 451 dbSNP
rs1165680570 452 dbSNP
rs753614733 453 dbSNP
rs1405605780 455 dbSNP
rs758824918 459 dbSNP
rs1392105660 463 dbSNP
rs1436968886 466 dbSNP
rs1321193669 468 dbSNP
rs553191934 473 dbSNP
rs1219433476 474 dbSNP
rs747521777 475 dbSNP
rs1286044407 479 dbSNP
rs1357127424 482 dbSNP
rs1055136588 483 dbSNP
rs769004925 484 dbSNP
rs1271477973 486 dbSNP
rs1020188455 489 dbSNP
rs781733910 491 dbSNP
rs748109676 496 dbSNP
rs775395310 498 dbSNP
rs1353027526 499 dbSNP
rs761632809 500 dbSNP
rs1034198691 502 dbSNP
rs1238757887 503 dbSNP
rs1451866850 505 dbSNP
rs571424053 506 dbSNP
rs1165960511 507 dbSNP
rs749558904 507 dbSNP
rs770678682 508 dbSNP
rs773974748 509 dbSNP
rs766582798 510 dbSNP
rs1159638388 511 dbSNP
rs759393681 512 dbSNP
rs1255506677 513 dbSNP
rs974185960 514 dbSNP
rs1398939574 518 dbSNP
rs767295661 520 dbSNP
rs775506722 523 dbSNP
rs1447365482 524 dbSNP
rs1261445121 525 dbSNP
rs760260462 526 dbSNP
rs1352599766 529 dbSNP
rs372944944 532 dbSNP
rs1267903101 533 dbSNP
rs753520716 534 dbSNP
rs757012577 535 dbSNP
rs751939187 536 dbSNP
rs757752682 543 dbSNP
rs764973702 545 dbSNP
rs781720902 546 dbSNP
rs912841120 547 dbSNP
rs538935150 549 dbSNP
rs1040243716 551 dbSNP
rs1316159423 552 dbSNP
rs556951388 552 dbSNP
rs1206888470 553 dbSNP
rs774614496 553 dbSNP
rs755374540 554 dbSNP
rs746296561 555 dbSNP
rs781545846 556 dbSNP
rs748746338 557 dbSNP
rs555439055 558 dbSNP
rs542642543 559 dbSNP
rs555074923 560 dbSNP
rs1041384519 564 dbSNP
rs572999070 566 dbSNP
rs1011463811 567 dbSNP
rs1334394720 568 dbSNP
rs560118092 569 dbSNP
rs1275760170 571 dbSNP
rs1344961993 572 dbSNP
rs967316888 574 dbSNP
rs1034555690 576 dbSNP
rs1466888762 577 dbSNP
rs759688540 577 dbSNP
rs981714014 583 dbSNP
rs1035493156 584 dbSNP
rs180957182 585 dbSNP
rs1205479519 587 dbSNP
rs1268275170 593 dbSNP
rs990879786 595 dbSNP
rs916596834 596 dbSNP
rs1371441800 597 dbSNP
rs1302489447 599 dbSNP
rs763668867 601 dbSNP
rs951341715 602 dbSNP
rs1416892675 603 dbSNP
rs1392498689 606 dbSNP
rs1200779397 609 dbSNP
rs776242295 610 dbSNP
rs1453734125 614 dbSNP
rs761430632 617 dbSNP
rs878904177 618 dbSNP
rs1193454057 621 dbSNP
rs1333246765 623 dbSNP
rs1452988281 625 dbSNP
rs984791748 626 dbSNP
rs965580330 628 dbSNP
rs764739057 631 dbSNP
rs1309925633 634 dbSNP
rs940945408 636 dbSNP
rs565146645 639 dbSNP
rs1324621071 641 dbSNP
rs921426429 643 dbSNP
rs1232827739 645 dbSNP
rs1040953126 649 dbSNP
rs1231757491 649 dbSNP
rs1378848125 654 dbSNP
rs755283700 656 dbSNP
rs936885966 657 dbSNP
rs1250229686 666 dbSNP
rs768840220 667 dbSNP
rs767972392 668 dbSNP
rs945811630 669 dbSNP
rs1281937517 671 dbSNP
rs1326979748 671 dbSNP
rs1267861617 672 dbSNP
rs1467862312 673 dbSNP
rs532539344 674 dbSNP
rs1158769851 675 dbSNP
rs906877565 675 dbSNP
rs1449948805 677 dbSNP
rs1169867296 680 dbSNP
rs1239337300 681 dbSNP
rs2516825 682 dbSNP
rs1459694397 686 dbSNP
rs185172960 687 dbSNP
rs530554798 688 dbSNP
rs749304106 689 dbSNP
rs1322913573 691 dbSNP
rs757358362 693 dbSNP
rs761585819 694 dbSNP
rs1294254484 695 dbSNP
rs1350295879 696 dbSNP
rs1305239733 697 dbSNP
rs779002750 698 dbSNP
rs1265630354 699 dbSNP
rs1333951285 703 dbSNP
rs1211611570 705 dbSNP
rs1172254947 708 dbSNP
rs11559000 709 dbSNP
rs573562358 710 dbSNP
rs1185799414 711 dbSNP
rs1259824057 714 dbSNP
rs1425600158 715 dbSNP
rs779941779 721 dbSNP
rs1417443868 722 dbSNP
rs767565120 723 dbSNP
rs1161833929 724 dbSNP
rs746832741 727 dbSNP
rs1331885126 729 dbSNP
rs1453753849 731 dbSNP
rs1475218783 734 dbSNP
rs1287623965 738 dbSNP
rs903105023 738 dbSNP
rs768666235 739 dbSNP
rs1185706859 743 dbSNP
rs1489254488 744 dbSNP
rs549133607 748 dbSNP
rs1026837821 749 dbSNP
rs528201798 751 dbSNP
rs1354459438 752 dbSNP
rs1304968420 754 dbSNP
rs1231004379 755 dbSNP
rs546668737 758 dbSNP
rs760467318 762 dbSNP
rs1035950201 763 dbSNP
rs1258873117 769 dbSNP
rs1019625002 770 dbSNP
rs1290003580 772 dbSNP
rs34646740 774 dbSNP
rs1182553486 775 dbSNP
rs761345010 776 dbSNP
rs1343820406 777 dbSNP
rs776723157 778 dbSNP
rs958498339 779 dbSNP
rs1184602894 780 dbSNP
rs991306903 781 dbSNP
rs1418826306 782 dbSNP
rs1474270510 783 dbSNP
rs865866085 783 dbSNP
rs571491685 785 dbSNP
rs1361426043 786 dbSNP
rs1466967174 789 dbSNP
rs1312961122 792 dbSNP
rs1374261627 794 dbSNP
rs958552004 795 dbSNP
rs1211840920 796 dbSNP
rs754944046 797 dbSNP
rs867586858 799 dbSNP
rs1289800512 801 dbSNP
rs769403121 802 dbSNP
rs1214564057 803 dbSNP
rs11144 806 dbSNP
rs1304551460 807 dbSNP
rs1313888930 809 dbSNP
rs1210661783 811 dbSNP
rs1279781319 812 dbSNP
rs1433876788 816 dbSNP
rs1393218208 821 dbSNP
rs1484731612 824 dbSNP
rs1323515779 825 dbSNP
rs762705656 828 dbSNP
rs1252779347 832 dbSNP
rs1480400861 833 dbSNP
rs945759315 834 dbSNP
rs907837149 835 dbSNP
rs1427617638 836 dbSNP
rs1434267710 837 dbSNP
rs1173546880 838 dbSNP
rs765975427 840 dbSNP
rs550888984 842 dbSNP
rs928293818 843 dbSNP
rs1309267107 844 dbSNP
rs1354785963 845 dbSNP
rs940944269 846 dbSNP
rs1296257783 849 dbSNP
rs1056099675 850 dbSNP
rs1369453900 852 dbSNP
rs544593057 853 dbSNP
rs931236001 854 dbSNP
rs1345876015 856 dbSNP
rs1230727473 857 dbSNP
rs753357322 860 dbSNP
rs1048219563 861 dbSNP
rs1202623457 862 dbSNP
rs1248877216 863 dbSNP
rs923457051 864 dbSNP
rs932182974 866 dbSNP
rs1050549472 868 dbSNP
rs1019741734 869 dbSNP
rs759302895 871 dbSNP
rs1297139351 872 dbSNP
rs1451840079 873 dbSNP
rs370477486 877 dbSNP
rs1419537141 879 dbSNP
rs1409072760 880 dbSNP
rs191275763 883 dbSNP
rs1295259007 887 dbSNP
rs1041777380 891 dbSNP
rs112725079 892 dbSNP
rs1393107373 893 dbSNP
rs1441330794 894 dbSNP
rs902824870 895 dbSNP
rs1421149737 896 dbSNP
rs1251310510 898 dbSNP
rs1011114388 899 dbSNP
rs1482133473 901 dbSNP
rs1009543588 903 dbSNP
rs1260144052 910 dbSNP
rs1437102712 911 dbSNP
rs561443477 914 dbSNP
rs1338810669 915 dbSNP
rs1471579465 920 dbSNP
rs966881867 920 dbSNP
rs1313397389 921 dbSNP
rs1317195671 921 dbSNP
rs1389132840 921 dbSNP
rs1414165397 921 dbSNP
rs71650270 921 dbSNP
rs779312440 921 dbSNP
rs1373361928 925 dbSNP
rs977126788 929 dbSNP
rs1454143804 933 dbSNP
rs1158664715 935 dbSNP
rs1160090742 935 dbSNP
rs1380325078 936 dbSNP
rs11558997 937 dbSNP
rs1189258693 940 dbSNP
rs1022324699 944 dbSNP
rs1254481601 947 dbSNP
rs1312774764 947 dbSNP
rs968352260 948 dbSNP
rs1398145925 949 dbSNP
rs1335359004 951 dbSNP
rs1335555772 953 dbSNP
rs1440224415 956 dbSNP
rs928426456 963 dbSNP
rs1354449302 964 dbSNP
rs960078084 965 dbSNP
rs1232581448 969 dbSNP
rs1353437354 977 dbSNP
rs1003215218 978 dbSNP
rs1382512222 980 dbSNP
rs1057099164 992 dbSNP
rs894378576 994 dbSNP
rs1455904492 1004 dbSNP
rs1396744293 1007 dbSNP
rs915565115 1008 dbSNP
rs1367193326 1010 dbSNP
rs1195957359 1011 dbSNP
rs1012796363 1012 dbSNP
rs1347108310 1015 dbSNP
rs2516826 1017 dbSNP
rs1261555313 1020 dbSNP
rs1206406210 1023 dbSNP
rs1026812342 1024 dbSNP
rs536699471 1025 dbSNP
rs952117313 1026 dbSNP
rs1200815758 1030 dbSNP
rs1249474094 1035 dbSNP
rs554657364 1039 dbSNP
rs1048377702 1040 dbSNP
rs1252944852 1044 dbSNP
rs1015358651 1048 dbSNP
rs962044563 1049 dbSNP
rs572861238 1050 dbSNP
rs1208789712 1054 dbSNP
rs1293220775 1055 dbSNP
rs976478602 1057 dbSNP
rs1326863400 1060 dbSNP
rs1460924181 1062 dbSNP
rs1453245375 1065 dbSNP
rs1170145886 1067 dbSNP
rs901230898 1072 dbSNP
rs1462982197 1079 dbSNP
rs373923095 1082 dbSNP
rs1376426973 1083 dbSNP
rs531989184 1085 dbSNP
rs1455882116 1097 dbSNP
rs1253173579 1098 dbSNP
rs1173690668 1102 dbSNP
rs1449361280 1106 dbSNP
rs1049707735 1107 dbSNP
rs183032385 1107 dbSNP
rs558591934 1114 dbSNP
rs953620249 1118 dbSNP
rs1272419559 1120 dbSNP
rs1445064231 1121 dbSNP
rs1348326971 1123 dbSNP
rs368413691 1123 dbSNP
rs796911804 1123 dbSNP
rs1436115259 1124 dbSNP
rs1377985782 1127 dbSNP
rs1440243071 1128 dbSNP
rs986269437 1129 dbSNP
rs145590189 1133 dbSNP
rs914701960 1135 dbSNP
rs1043917 1136 dbSNP
rs1332910838 1137 dbSNP
rs1172619066 1138 dbSNP
rs1043920 1140 dbSNP
rs947142270 1142 dbSNP
rs1041436862 1143 dbSNP
rs544455831 1144 dbSNP
rs1250713585 1147 dbSNP
rs1234090514 1148 dbSNP
rs1181835780 1150 dbSNP
rs1043927 1156 dbSNP
rs1043929 1159 dbSNP
rs563240749 1162 dbSNP
rs938383635 1164 dbSNP
rs1200359298 1166 dbSNP
rs1258291468 1170 dbSNP
rs966831022 1174 dbSNP
rs1056816288 1175 dbSNP
rs1188730779 1176 dbSNP
rs749983586 1179 dbSNP
rs894431151 1180 dbSNP
rs575020721 1182 dbSNP
rs542465986 1188 dbSNP
rs1048261962 1192 dbSNP
rs1191370326 1193 dbSNP
rs1281523451 1200 dbSNP
rs1043958 1205 dbSNP
rs1006731596 1213 dbSNP
rs1239781047 1214 dbSNP
rs1349968546 1215 dbSNP
rs1213099790 1216 dbSNP
rs1306707636 1218 dbSNP
rs1015040741 1219 dbSNP
rs1292265983 1221 dbSNP
rs1035610825 1222 dbSNP
rs1335663442 1222 dbSNP
rs959782336 1223 dbSNP
rs1271590184 1225 dbSNP
rs116687647 1226 dbSNP
rs1218931088 1227 dbSNP
rs991687867 1229 dbSNP
rs1189940560 1232 dbSNP
rs915571251 1240 dbSNP
rs756596520 1241 dbSNP
rs1256746394 1242 dbSNP
rs1242266733 1243 dbSNP
rs1474779294 1244 dbSNP
rs952386560 1246 dbSNP
rs962421983 1248 dbSNP
rs1461599536 1249 dbSNP
rs1163948943 1251 dbSNP
rs754413025 1253 dbSNP
rs560867162 1254 dbSNP
rs1030252361 1256 dbSNP
rs908436991 1260 dbSNP
rs1209321418 1261 dbSNP
rs1318883966 1262 dbSNP
rs528061657 1263 dbSNP
rs546735865 1264 dbSNP
rs939935903 1265 dbSNP
rs1456438291 1267 dbSNP
rs1385781904 1269 dbSNP
rs953631651 1270 dbSNP
rs986320405 1271 dbSNP
rs750581979 1272 dbSNP
rs1166408827 1275 dbSNP
rs1475267067 1276 dbSNP
rs1232842162 1278 dbSNP
rs188467095 1280 dbSNP
rs1331659880 1281 dbSNP
rs1242559172 1283 dbSNP
rs532367221 1283 dbSNP
rs764746927 1285 dbSNP
rs1284161149 1287 dbSNP
rs1266490248 1288 dbSNP
rs922429052 1289 dbSNP
rs550500316 1290 dbSNP
rs531758080 1291 dbSNP
rs1213068903 1292 dbSNP
rs1050302089 1293 dbSNP
rs1258919191 1295 dbSNP
rs1475336842 1297 dbSNP
rs1186763750 1298 dbSNP
rs1434858438 1299 dbSNP
rs968941262 1300 dbSNP
rs1473432146 1301 dbSNP
rs1158880848 1303 dbSNP
rs1327508228 1306 dbSNP
rs1384204551 1306 dbSNP
rs893792025 1310 dbSNP
rs1044086 1311 dbSNP
rs1376128667 1312 dbSNP
rs1414464896 1313 dbSNP
rs569174270 1314 dbSNP
rs1352763084 1318 dbSNP
rs752039044 1321 dbSNP
rs1279300638 1322 dbSNP
rs924423932 1323 dbSNP
rs1221381847 1325 dbSNP
rs902744487 1326 dbSNP
rs757647079 1327 dbSNP
rs374571060 1329 dbSNP
rs1291276971 1330 dbSNP
rs1035192971 1334 dbSNP
rs1209760626 1341 dbSNP
rs781262586 1343 dbSNP
rs536165720 1349 dbSNP
rs769154222 1350 dbSNP
rs1340499874 1352 dbSNP
rs1305162237 1357 dbSNP
rs895338004 1361 dbSNP
rs1362949267 1362 dbSNP
rs1056826491 1363 dbSNP
rs1291338531 1364 dbSNP
rs772737092 1365 dbSNP
rs543837739 1366 dbSNP
rs948636872 1367 dbSNP
rs1311085465 1368 dbSNP
rs1372679926 1369 dbSNP
rs770556854 1370 dbSNP
rs748267127 1371 dbSNP
rs755732205 1373 dbSNP
rs752858264 1376 dbSNP
rs1328622043 1380 dbSNP
rs866965556 1383 dbSNP
rs1048315210 1385 dbSNP
rs888350880 1386 dbSNP
rs1481661557 1388 dbSNP
rs1304767442 1389 dbSNP
rs563214572 1392 dbSNP
rs1232968639 1393 dbSNP
rs1482278553 1394 dbSNP
rs1282966635 1395 dbSNP
rs1037262520 1396 dbSNP
rs1234546477 1398 dbSNP
rs761019513 1400 dbSNP
rs1341053875 1402 dbSNP
rs1298778159 1408 dbSNP
rs1196003437 1409 dbSNP
rs1249636654 1413 dbSNP
rs897915020 1414 dbSNP
rs1195473318 1415 dbSNP
rs1373440054 1416 dbSNP
rs1307322208 1417 dbSNP
rs997516105 1419 dbSNP
rs1453687287 1421 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17306 Multiple myeloma -0.484 2.1e-4 -0.406 1.9e-3 49 Click to see details
GSE28544 Breast cancer 0.599 9.9e-4 0.478 9.1e-3 24 Click to see details
GSE17498 Multiple myeloma -0.359 1.1e-2 -0.396 5.7e-3 40 Click to see details
GSE28260 Renal cortex and medulla -0.48 4.8e-2 -0.352 1.2e-1 13 Click to see details
GSE38226 Liver fibrosis 0.245 1.4e-1 0.451 2.0e-2 21 Click to see details
GSE42095 Differentiated embryonic stem cells -0.194 1.9e-1 -0.245 1.3e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.194 2.1e-1 0.062 4.0e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.189 2.4e-1 -0.174 2.6e-1 16 Click to see details
GSE32688 Pancreatic cancer 0.109 2.8e-1 0.198 1.4e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.122 2.8e-1 -0.105 3.1e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.259 3.1e-1 -0.200 3.5e-1 6 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.088 3.4e-1 0.090 3.3e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.04 3.5e-1 -0.086 2.1e-1 90 Click to see details
GSE21849 B cell lymphoma -0.071 3.6e-1 0.303 5.5e-2 29 Click to see details
GSE19350 CNS germ cell tumors -0.084 4.0e-1 0.024 4.7e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.032 4.0e-1 -0.051 3.4e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.001 5.0e-1 -0.011 4.8e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.176 0.11 -0.189 0.1 49 Click to see details
HNSC 0.935 0.12 1.000 0.5 3 Click to see details
STAD 0.448 0.13 0.381 0.18 8 Click to see details
KICH 0.283 0.25 0.048 0.46 8 Click to see details
KIRP -0.196 0.31 -0.550 0.06 9 Click to see details
THCA -0.281 0.32 -0.800 0.05 5 Click to see details
KIRC -0.078 0.34 0.019 0.46 29 Click to see details
CHOL -0.07 0.43 -0.217 0.29 9 Click to see details
ESCA 0.045 0.47 0.300 0.31 5 Click to see details
ESCA 0.045 0.47 0.300 0.31 5 Click to see details
ESCA 0.045 0.47 0.300 0.31 5 Click to see details
ESCA 0.045 0.47 0.300 0.31 5 Click to see details
ESCA 0.045 0.47 0.300 0.31 5 Click to see details
ESCA 0.045 0.47 0.300 0.31 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
Error report submission
MIRT ID*
Your e-Mail*
Memo*