miRTarBase - #MIRT023350 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PARP11   
Synonyms ARTD11, C12orf6, MIB006
Description poly(ADP-ribose) polymerase family member 11
Transcript NM_020367   
Expression
Putative miRNA Targets on PARP11
3'UTR of PARP11
(miRNA target sites are highlighted)
>PARP11|NM_020367|3'UTR
   1 TTTCACTTCCAAATCTCGGTGGTCAAGGAAGCTTTATTCTTTTTTGCAGGAAGGTTTGCTCTTCAGTCATCTAGCCACTA
  81 AATGTTAATTATCTGATACTTTTGAAACAGATATGAAAAAAAGTGGCCTCCATATAAAAAGACATACTGACTTCAAGGTT
 161 GGTTTTTGTTGTTTTGTTTTTGCCTGTTTCTTGTAGTCTTGTTTGTTAAAAGTTGATATCATTGATGTTTTAACACATAG
 241 GGGTGAAAGATACCATTCAAAATGGAATCAGCTGAGTCTCAACTAATGTGGTCATTGAGATCTTTAAAGTTTACGTGTGT
 321 GTTATCAGGATAAATGATTTTAGTTTAAATAGACTTATTCGTATAAATGTTGAAAAAAAATACAGACATAAATGTGTCCC
 401 TTTAGAGGAATTGATCCTTTGTAAATTGAATTCAGGTAGTAGTATCATCCACCAATCCATCTGTTGCTTTGTTGGTCTTC
 481 TGAAGGGGGGATTTAAAACTCTGAAACAGTCTGAGCACCTTGAGAGAAATCAGAAACAAGACAATTATTTGCAGTGCTGT
 561 CAAACAAGCCAGAAGGAGAAAATCAAGGTAGAATGCCCCACTTTCCAGTTGCCTTAGGATAGCAGGCTGCAGCCTCAGAC
 641 TTGATCCTGTCATTCTCCTCTGTCTCCCACATCTGAATTGATAATTGCTGCAAAATGTCATTAGCCTACACTTCATCCAT
 721 CAGGGCTCTTGGATTCTTACACCACGACTTGCTGTGCAAGGTGTTTATTGCATCTTCAAAGTGAAACTTTAAATTATTAT
 801 TCAAACATTTATTTTCCTTTTGTTTTAAAAAGAGTCCCTACAATGATCACTTCTAAGATTTTTTTTTACCTTCCCCTCTG
 881 CAGCACACACAGCTATTCAACAATGATTTCTAAAATTCATATTTCAAATTTGTATCTCTCCATTTTGAAACATTATAGAA
 961 AGCATGGGATGCTTGAGACAAATCTGGTTTCTCCTTTGAAGTAGCTGTTGACAACCTACTCTCTTGAAAAGTTAGATATA
1041 ATTCTTAATCATGTTTAGTGGAAATTTGTTTACCTGTTCCATCTGTTTTGCTGTTTCATTGTAAGGAAGATGAGAAGTGT
1121 TGGAACAGCTTCCCTCCCCTAAAGGTATTCTAGCAGAGGCGAGACAGCAACTTGGCGGGCATGTTGCATAGGAGTTAAGT
1201 ACCAGATGGGGAATTGCCCATGTGATGGTGAAGAGTCTCTCACATTGATTTTCTTCCTTTTCTCCTCTTCTCTCCTCCTT
1281 CTCTTCTCTCCTCTTTCTCTTCTCTTCTTTCTCTTCTCTTCTGTCTTCCTCTTCCTCTTCTCTTCCTCTCCTCTTCCTCT
1361 TTCTCTCTCTTCCTTTTTCTCTTCCTCTTTCTCTTTCTCTTTCTCTTCTCTTCTCTCTCTCTTCCTTCCTTCTTTCTTTC
1441 CTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCTTTCCCTCCCTCCCTCCCTCCCTCCTCCCTTTTTCTTTTTCTTT
1521 CTTTTTTTTTGGTTTGGCAGAGTCTTGCTCTGTTGCCCAGGCTGCAGTGCAGTGGTGTGATCTCGGCTCACTGCAACCTC
1601 CACCTCCCGGGTTCAAGCAATTCTCTTGCCTCAGCTTCTCCAGTTACTGGGACTACAGGTGCATACCACCATGCCCGGCT
1681 AATTTTTGTATTTTTAGTAGAGGCGGGGTTTTGTCATGTTGGCCAGGCTGATCTCAAACTCCTGACCTCAGGTGATCCGC
1761 CTGCCTCAGCCTTCCAAAGTGCTGAGATTACAGGCATGAGCCGCTGTACCCGGCCTGATTTTCTATGATTCTGCCTTTAA
1841 AAGACAGCACGTATACCAAGCCTTTTTCAGAAAGCTTTTCTCTTAACTCCTTCTAATGCTGAATTTTCTCTCTATTATCC
1921 TCACCCAATTTTGGCTGAGAGTTAGTGTACACAATTTAACTTCTTAGAAAAATTCCAGTGTCTATGCTTATATTGCTCAC
2001 TTGAATCATTTGAATTAGAAAGGGATCTACAAATAATAAAAGCAAAGAGTGCAGACAGATTAGGGATAGTAATTCTTAAA
2081 GTGCCATCTATCCCAGATTTCCGTTATAGACCAGCATATGTGTAATTGTGCAGTGGGAGGTAAGTAGTACCCAGGACATT
2161 GCATGTACAATACTTTGAAACAAAGTGGCAACAAAGATTTCCTGGCTCAGGTATGCACCCCAGCTGCTGGTTTAGATGAA
2241 GTGCTGAGAATATTTAGAAAAAGCGCTTTAAAAAGCATCTAGAGATTATCATGAAAATAATTGGAGACAAAGTCACTAGG
2321 CTGCTTTGTGAGAGGCAGCATACCATGGCTCTAAACCCGTTCACAAAAAACAATGTTAGAGACATTAGGAATTCAGGTTT
2401 TGAAAATCTTTTTTTCGATTTATTTGTAATTTACATACCAAAAAACCACATTAAAATAGTCCTCCCTTCAACATGGCTAT
2481 CTTTTTTCAAGTTTTATATGCATAGCTCTCTCAGCACTTGAATGGAAAAACTGTTACAGCATTTGGGAGTTGTTTTTCTT
2561 TTAGACTTTGCAGATCTTATCTCAAGGTGACTAGGAACCCAGAGCTAAGTATCTGTGAGGCAATCTCTGCGAACGCTGAA
2641 CTTACCTAGTTGGTTTCTATGAAATATGTAGAATGCACTGCAGTAGCCATTGTAAGAAGGTACTATACCGGTTTTTTGGG
2721 GCTTGTTGTTGTTGTTTGGTCTGAGAATGTACTGCCAACCCCTCTTTTATAAGAGAGAACTGATTTTGATACATATTTTA
2801 AAATATGATAGTACAGAGTTAATGGATGTTAAAATTTTATTTCTTTGTTTTGGTAAGTAGATTAAATCGAGAATCATATA
2881 ATCAGTACATTTGAGAATTATATAACCAGTATATAATAATACTGGACACAACCATTTGCCATCTTTTCCTGTTATCATCC
2961 CATAGAGTGGGTGGGGAGAATGAATAGACATAAACCTAGAATAATGATAAATGGTTTTTAAAACTCTATATTGAATACAT
3041 TCCAGCTGATAATGACTTTTCTTTTTCACCTTGGTGATATCAGCCTCAGGGTAAAAAAAAAAGTTTCATAAATCTTTTAG
3121 TTATAAACAGGAAAGTTTTATATTAGTGTGTCATTTCATTTCTAGACTGTTGATGGTGATGATGATAAAGAATTTGGAGC
3201 CAATTTTGATATATGAATGTATTGCTTTTACATGTGATGATTAAAGCTCTCCATTAGCAGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAA-CAG-UGUGAGGu 5'
            ||:::|||| | | |||||:| 
Target 5' aaAATGTCATTAGCCTACACTTCa 3'
692 - 715 148.00 -16.60
2
miRNA  3' guUUGUG--GUAAC-AGUGUGAGGu 5'
            ||| |  :||||  :|||:||| 
Target 5' aaAACTCTATATTGAATACATTCCa 3'
3020 - 3044 142.00 -15.50
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             | :|:: | ||| ||||| 
Target 5' gccAGGCTGATCTCAAACTCCt 3'
1722 - 1743 127.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30707148 2 COSMIC
COSN30506928 18 COSMIC
COSN31522058 36 COSMIC
COSN30508702 54 COSMIC
COSN30180254 58 COSMIC
COSN26423607 60 COSMIC
COSN30157158 64 COSMIC
COSN30104930 105 COSMIC
COSN20077577 169 COSMIC
COSN30127444 220 COSMIC
COSN32076348 224 COSMIC
COSN30363420 308 COSMIC
COSN31600354 382 COSMIC
COSN29939244 503 COSMIC
COSN29593813 859 COSMIC
COSN22536181 987 COSMIC
COSN22143505 1007 COSMIC
COSN7369026 1086 COSMIC
COSN1571393 1142 COSMIC
COSN24009346 1208 COSMIC
COSN4729535 1216 COSMIC
COSN16704515 1303 COSMIC
COSN20077680 1437 COSMIC
COSN9558990 1453 COSMIC
COSN16239262 1469 COSMIC
COSN23924151 1482 COSMIC
COSN32087519 1538 COSMIC
COSN24330425 1709 COSMIC
COSN9083428 1781 COSMIC
COSN16839370 1818 COSMIC
COSN5942219 1855 COSMIC
COSN1571392 1893 COSMIC
COSN1571391 1917 COSMIC
COSN22794813 2052 COSMIC
COSN20109083 2566 COSMIC
COSN22807121 2694 COSMIC
COSN20109081 2765 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1020979240 4 dbSNP
rs1045994485 6 dbSNP
rs372013391 8 dbSNP
rs1202881262 14 dbSNP
rs376688161 17 dbSNP
rs372123433 18 dbSNP
rs764323931 23 dbSNP
rs1181394671 25 dbSNP
rs1319070450 29 dbSNP
rs1242651337 31 dbSNP
rs760832367 33 dbSNP
rs1404247760 34 dbSNP
rs1289899667 35 dbSNP
rs1175935375 38 dbSNP
rs530122146 39 dbSNP
rs1470401648 40 dbSNP
rs1314733040 42 dbSNP
rs753294512 42 dbSNP
rs561096087 46 dbSNP
rs759839723 50 dbSNP
rs925784430 54 dbSNP
rs186432451 59 dbSNP
rs1281787574 71 dbSNP
rs1403383213 75 dbSNP
rs1170073838 82 dbSNP
rs1326463181 84 dbSNP
rs1351787318 88 dbSNP
rs1409977527 91 dbSNP
rs145096701 102 dbSNP
rs1343620214 104 dbSNP
rs964584361 105 dbSNP
rs1420737828 108 dbSNP
rs1235360977 111 dbSNP
rs1054648541 113 dbSNP
rs1006603747 114 dbSNP
rs1161813092 115 dbSNP
rs1018790471 116 dbSNP
rs889545559 118 dbSNP
rs3214323 123 dbSNP
rs397818975 123 dbSNP
rs768260458 123 dbSNP
rs1008835736 124 dbSNP
rs950397814 128 dbSNP
rs1182029615 132 dbSNP
rs918490638 133 dbSNP
rs1458829294 134 dbSNP
rs1025988708 144 dbSNP
rs1359705180 145 dbSNP
rs1235769626 153 dbSNP
rs1201652247 154 dbSNP
rs1378515912 155 dbSNP
rs1475326357 159 dbSNP
rs1372069940 161 dbSNP
rs1429804721 162 dbSNP
rs1301940915 163 dbSNP
rs1363207844 166 dbSNP
rs1388374024 168 dbSNP
rs941302635 171 dbSNP
rs994987852 176 dbSNP
rs1325623542 182 dbSNP
rs565225831 186 dbSNP
rs1295636188 196 dbSNP
rs1344640486 199 dbSNP
rs1038529527 203 dbSNP
rs1468859274 208 dbSNP
rs1292018174 216 dbSNP
rs1001674445 219 dbSNP
rs1487554485 237 dbSNP
rs990671597 240 dbSNP
rs183780981 242 dbSNP
rs1046365981 250 dbSNP
rs1446755960 255 dbSNP
rs1279957501 278 dbSNP
rs1241394118 280 dbSNP
rs1374958718 284 dbSNP
rs766444832 287 dbSNP
rs1330755808 290 dbSNP
rs1441809928 293 dbSNP
rs576191476 302 dbSNP
rs1322185398 314 dbSNP
rs564700843 315 dbSNP
rs542331465 324 dbSNP
rs1384211954 325 dbSNP
rs1380287865 333 dbSNP
rs573661609 334 dbSNP
rs1322241805 337 dbSNP
rs891781194 353 dbSNP
rs1053162684 358 dbSNP
rs191518200 360 dbSNP
rs1441087223 368 dbSNP
rs533775103 370 dbSNP
rs578033029 372 dbSNP
rs1020295934 381 dbSNP
rs971398519 381 dbSNP
rs1465638729 383 dbSNP
rs974813183 383 dbSNP
rs1182578146 389 dbSNP
rs763148637 392 dbSNP
rs943184347 394 dbSNP
rs1248358546 403 dbSNP
rs911734966 421 dbSNP
rs1007095167 423 dbSNP
rs1451489564 426 dbSNP
rs1450990319 430 dbSNP
rs558037652 436 dbSNP
rs987762079 438 dbSNP
rs1451731081 441 dbSNP
rs1336285399 444 dbSNP
rs950697416 447 dbSNP
rs538047204 453 dbSNP
rs1398026344 463 dbSNP
rs1050856218 469 dbSNP
rs997840456 470 dbSNP
rs896788840 491 dbSNP
rs1163379574 498 dbSNP
rs1270643693 500 dbSNP
rs1203480075 503 dbSNP
rs1330242180 503 dbSNP
rs1308861301 504 dbSNP
rs1253865033 506 dbSNP
rs749243412 507 dbSNP
rs1036720866 508 dbSNP
rs1235075874 515 dbSNP
rs569038824 530 dbSNP
rs909808026 531 dbSNP
rs1054877735 536 dbSNP
rs1173632529 539 dbSNP
rs1273177034 543 dbSNP
rs780194925 544 dbSNP
rs1303654392 559 dbSNP
rs1372690244 568 dbSNP
rs1408155514 568 dbSNP
rs74703324 570 dbSNP
rs1351702908 576 dbSNP
rs1223465040 582 dbSNP
rs1033405063 583 dbSNP
rs1320691287 599 dbSNP
rs1418319069 600 dbSNP
rs1001955827 604 dbSNP
rs1481768210 609 dbSNP
rs1206740235 612 dbSNP
rs971472118 618 dbSNP
rs71534270 629 dbSNP
rs1434986238 634 dbSNP
rs1189401264 637 dbSNP
rs988833411 643 dbSNP
rs1426930308 646 dbSNP
rs1433612712 648 dbSNP
rs186652380 657 dbSNP
rs1370233390 661 dbSNP
rs1426603888 661 dbSNP
rs1024510601 666 dbSNP
rs1014916644 670 dbSNP
rs892068454 673 dbSNP
rs1053514853 684 dbSNP
rs573042467 693 dbSNP
rs527672838 697 dbSNP
rs116668113 702 dbSNP
rs551626829 710 dbSNP
rs997914173 712 dbSNP
rs1294379414 716 dbSNP
rs896908271 726 dbSNP
rs1015641652 735 dbSNP
rs1274642506 738 dbSNP
rs1490046617 740 dbSNP
rs181099684 740 dbSNP
rs1005252469 744 dbSNP
rs1285080792 745 dbSNP
rs987361672 746 dbSNP
rs76530375 749 dbSNP
rs1388117206 752 dbSNP
rs1054990323 756 dbSNP
rs562970612 759 dbSNP
rs973335999 761 dbSNP
rs781161198 767 dbSNP
rs1280704664 770 dbSNP
rs1033353011 772 dbSNP
rs1437833622 773 dbSNP
rs76536944 781 dbSNP
rs980508130 807 dbSNP
rs1340255211 832 dbSNP
rs142803197 838 dbSNP
rs148495129 843 dbSNP
rs1358097064 845 dbSNP
rs913347799 860 dbSNP
rs1014451776 867 dbSNP
rs936038284 868 dbSNP
rs989213322 868 dbSNP
rs75966484 872 dbSNP
rs147876615 876 dbSNP
rs1245897267 886 dbSNP
rs1466099148 891 dbSNP
rs777189680 892 dbSNP
rs1190741472 900 dbSNP
rs1173324852 903 dbSNP
rs1472496529 904 dbSNP
rs1161484522 921 dbSNP
rs1416090611 929 dbSNP
rs1406390555 932 dbSNP
rs1159087762 940 dbSNP
rs1386889745 942 dbSNP
rs1413457112 947 dbSNP
rs1031900704 958 dbSNP
rs1000408968 962 dbSNP
rs561017256 964 dbSNP
rs1445391245 965 dbSNP
rs1039047217 967 dbSNP
rs1379271154 977 dbSNP
rs80345845 979 dbSNP
rs577672539 997 dbSNP
rs768911034 998 dbSNP
rs1330947845 1006 dbSNP
rs890568262 1007 dbSNP
rs1262303106 1010 dbSNP
rs1442016402 1012 dbSNP
rs1262129663 1014 dbSNP
rs1052021317 1018 dbSNP
rs1188394082 1020 dbSNP
rs747480896 1021 dbSNP
rs1473198512 1032 dbSNP
rs1484358168 1035 dbSNP
rs929126950 1039 dbSNP
rs1236005198 1055 dbSNP
rs1209479932 1056 dbSNP
rs1459139455 1058 dbSNP
rs1308195845 1064 dbSNP
rs1160305055 1066 dbSNP
rs1260115843 1067 dbSNP
rs1335796710 1070 dbSNP
rs763640495 1079 dbSNP
rs1317857943 1081 dbSNP
rs79208366 1085 dbSNP
rs1286348590 1093 dbSNP
rs1015384258 1096 dbSNP
rs1005613155 1097 dbSNP
rs1228961922 1101 dbSNP
rs764170775 1109 dbSNP
rs1342628490 1123 dbSNP
rs926274114 1124 dbSNP
rs980455529 1134 dbSNP
rs970868199 1135 dbSNP
rs1281070357 1136 dbSNP
rs1486020252 1152 dbSNP
rs1230442220 1154 dbSNP
rs917645094 1160 dbSNP
rs1473836513 1161 dbSNP
rs538110371 1171 dbSNP
rs1446871949 1175 dbSNP
rs140596160 1176 dbSNP
rs748840668 1177 dbSNP
rs1173965092 1180 dbSNP
rs1402522553 1197 dbSNP
rs1031810730 1199 dbSNP
rs906467783 1206 dbSNP
rs1046205554 1207 dbSNP
rs1410295655 1210 dbSNP
rs1322875226 1227 dbSNP
rs1463937448 1236 dbSNP
rs11612988 1237 dbSNP
rs968984301 1239 dbSNP
rs1276803004 1244 dbSNP
rs1348813684 1250 dbSNP
rs1017541709 1260 dbSNP
rs147200625 1262 dbSNP
rs1272488660 1265 dbSNP
rs890466026 1268 dbSNP
rs1484086587 1269 dbSNP
rs1425387144 1272 dbSNP
rs1051815848 1280 dbSNP
rs1267350872 1281 dbSNP
rs1053235853 1283 dbSNP
rs993995339 1284 dbSNP
rs897649863 1286 dbSNP
rs1181457063 1288 dbSNP
rs936099452 1289 dbSNP
rs1481097274 1290 dbSNP
rs1017986695 1294 dbSNP
rs575688066 1294 dbSNP
rs1429908012 1295 dbSNP
rs985463837 1296 dbSNP
rs1240044629 1299 dbSNP
rs1196839655 1301 dbSNP
rs1008318726 1306 dbSNP
rs1364202484 1309 dbSNP
rs1274402892 1316 dbSNP
rs189748062 1317 dbSNP
rs1228295320 1323 dbSNP
rs1295752738 1323 dbSNP
rs1344406004 1323 dbSNP
rs1265350875 1325 dbSNP
rs922883802 1328 dbSNP
rs1247396876 1332 dbSNP
rs58675636 1335 dbSNP
rs961591826 1336 dbSNP
rs139643894 1341 dbSNP
rs765782221 1347 dbSNP
rs1186271677 1350 dbSNP
rs1227326422 1351 dbSNP
rs1428567920 1361 dbSNP
rs1163399369 1362 dbSNP
rs983863664 1363 dbSNP
rs533950061 1364 dbSNP
rs1265101275 1365 dbSNP
rs1310804362 1371 dbSNP
rs748542647 1371 dbSNP
rs1444014399 1372 dbSNP
rs1318752299 1373 dbSNP
rs1455506579 1373 dbSNP
rs1399432136 1375 dbSNP
rs149503127 1376 dbSNP
rs908275331 1379 dbSNP
rs1338789345 1380 dbSNP
rs1247608863 1381 dbSNP
rs926553181 1384 dbSNP
rs1328870598 1387 dbSNP
rs144584425 1389 dbSNP
rs771668498 1389 dbSNP
rs1270440579 1390 dbSNP
rs1347857594 1390 dbSNP
rs386375431 1390 dbSNP
rs1163828562 1395 dbSNP
rs1180933626 1395 dbSNP
rs1253394169 1395 dbSNP
rs1425102001 1396 dbSNP
rs1188566011 1399 dbSNP
rs1001858798 1401 dbSNP
rs1471476299 1401 dbSNP
rs1382473034 1402 dbSNP
rs1176828736 1403 dbSNP
rs1439203315 1404 dbSNP
rs200307166 1407 dbSNP
rs11283159 1408 dbSNP
rs1161045536 1408 dbSNP
rs372072975 1408 dbSNP
rs753791259 1408 dbSNP
rs754300764 1408 dbSNP
rs773955924 1408 dbSNP
rs970614287 1408 dbSNP
rs1024869757 1411 dbSNP
rs1009800369 1413 dbSNP
rs1211041950 1413 dbSNP
rs1250457949 1413 dbSNP
rs1253950263 1413 dbSNP
rs1483929745 1413 dbSNP
rs10687780 1417 dbSNP
rs202176088 1417 dbSNP
rs377332040 1417 dbSNP
rs1253735751 1419 dbSNP
rs1432450366 1421 dbSNP
rs892268726 1421 dbSNP
rs1054049422 1423 dbSNP
rs200174142 1423 dbSNP
rs57062061 1423 dbSNP
rs1487799418 1424 dbSNP
rs57860326 1424 dbSNP
rs1441148732 1428 dbSNP
rs868411198 1429 dbSNP
rs57460078 1433 dbSNP
rs949055200 1436 dbSNP
rs866648804 1437 dbSNP
rs1217038245 1438 dbSNP
rs1298711152 1440 dbSNP
rs1234612515 1441 dbSNP
rs1353953922 1441 dbSNP
rs866289418 1441 dbSNP
rs59300625 1442 dbSNP
rs1481819380 1443 dbSNP
rs1233425811 1444 dbSNP
rs1287780365 1444 dbSNP
rs7137256 1445 dbSNP
rs1237287915 1447 dbSNP
rs57172968 1447 dbSNP
rs1375469188 1448 dbSNP
rs1269235597 1449 dbSNP
rs7137255 1449 dbSNP
rs1174513917 1450 dbSNP
rs1388390759 1453 dbSNP
rs1389620032 1453 dbSNP
rs185225123 1453 dbSNP
rs1173129141 1457 dbSNP
rs968928983 1457 dbSNP
rs1365417216 1458 dbSNP
rs1017784283 1461 dbSNP
rs1292728523 1465 dbSNP
rs1420142700 1469 dbSNP
rs759864572 1470 dbSNP
rs201254913 1473 dbSNP
rs776931096 1474 dbSNP
rs1362653499 1475 dbSNP
rs1157037981 1476 dbSNP
rs1219284693 1477 dbSNP
rs1230038252 1477 dbSNP
rs1273120982 1477 dbSNP
rs1319444846 1477 dbSNP
rs1321001631 1477 dbSNP
rs1468795983 1477 dbSNP
rs201143468 1477 dbSNP
rs71061135 1477 dbSNP
rs7308661 1477 dbSNP
rs202091846 1478 dbSNP
rs749183855 1478 dbSNP
rs767675997 1478 dbSNP
rs1419348366 1479 dbSNP
rs1432492313 1479 dbSNP
rs1270203153 1481 dbSNP
rs146383802 1481 dbSNP
rs147407807 1482 dbSNP
rs1201097352 1483 dbSNP
rs1431939692 1484 dbSNP
rs1292026829 1485 dbSNP
rs879370249 1485 dbSNP
rs1218220876 1486 dbSNP
rs1251388851 1486 dbSNP
rs1266036013 1486 dbSNP
rs1463681105 1486 dbSNP
rs1472547109 1486 dbSNP
rs1180590186 1490 dbSNP
rs1221210960 1490 dbSNP
rs1420713731 1491 dbSNP
rs1475832865 1495 dbSNP
rs1158833032 1499 dbSNP
rs1331163628 1502 dbSNP
rs1386909530 1502 dbSNP
rs202053396 1502 dbSNP
rs747954256 1502 dbSNP
rs1445230665 1503 dbSNP
rs775358304 1504 dbSNP
rs1355959568 1506 dbSNP
rs1388056360 1507 dbSNP
rs1227742692 1511 dbSNP
rs1489499903 1516 dbSNP
rs1352591286 1517 dbSNP
rs1207112787 1521 dbSNP
rs1285266901 1523 dbSNP
rs1284365121 1525 dbSNP
rs904617988 1526 dbSNP
rs1182104248 1531 dbSNP
rs1259732865 1531 dbSNP
rs1486245091 1531 dbSNP
rs1292645406 1532 dbSNP
rs1410193655 1537 dbSNP
rs551342241 1550 dbSNP
rs1158760090 1555 dbSNP
rs771212735 1584 dbSNP
rs1352548986 1585 dbSNP
rs1375526596 1588 dbSNP
rs1409079187 1589 dbSNP
rs1306169959 1594 dbSNP
rs1256009389 1596 dbSNP
rs1239562243 1598 dbSNP
rs761459663 1599 dbSNP
rs1344531540 1602 dbSNP
rs1232370835 1608 dbSNP
rs138547609 1609 dbSNP
rs1348760300 1611 dbSNP
rs12424076 1620 dbSNP
rs1250302109 1623 dbSNP
rs1439900963 1630 dbSNP
rs180822067 1632 dbSNP
rs1400568055 1638 dbSNP
rs1246522394 1641 dbSNP
rs1476799484 1642 dbSNP
rs1175143964 1643 dbSNP
rs748796233 1650 dbSNP
rs1167946278 1655 dbSNP
rs1041329171 1662 dbSNP
rs1166615270 1663 dbSNP
rs1398482281 1670 dbSNP
rs1391925837 1674 dbSNP
rs529442847 1676 dbSNP
rs1329144952 1690 dbSNP
rs905043188 1694 dbSNP
rs1296124726 1696 dbSNP
rs1044961955 1697 dbSNP
rs1227833331 1699 dbSNP
rs560715948 1704 dbSNP
rs560000835 1705 dbSNP
rs1021741556 1709 dbSNP
rs540295253 1718 dbSNP
rs532978726 1722 dbSNP
rs564097052 1729 dbSNP
rs926412018 1743 dbSNP
rs935079285 1750 dbSNP
rs1253290381 1751 dbSNP
rs925062795 1752 dbSNP
rs979164229 1759 dbSNP
rs1186078972 1765 dbSNP
rs1374297173 1766 dbSNP
rs1462378410 1767 dbSNP
rs754761526 1779 dbSNP
rs544210410 1782 dbSNP
rs553478324 1786 dbSNP
rs189427708 1802 dbSNP
rs1371942056 1803 dbSNP
rs555630252 1807 dbSNP
rs1009464811 1811 dbSNP
rs1328291179 1812 dbSNP
rs541659500 1825 dbSNP
rs986391029 1832 dbSNP
rs1256494235 1834 dbSNP
rs1284198128 1835 dbSNP
rs1333118812 1845 dbSNP
rs1215890019 1847 dbSNP
rs1274232055 1849 dbSNP
rs375159867 1850 dbSNP
rs955168991 1851 dbSNP
rs1263197753 1853 dbSNP
rs1030313957 1854 dbSNP
rs1415649325 1857 dbSNP
rs1032143616 1859 dbSNP
rs572949722 1861 dbSNP
rs1287398177 1863 dbSNP
rs1481964786 1869 dbSNP
rs1254922801 1881 dbSNP
rs962049890 1887 dbSNP
rs1354067955 1894 dbSNP
rs1235682868 1895 dbSNP
rs553999018 1898 dbSNP
rs1016331288 1912 dbSNP
rs1195712442 1922 dbSNP
rs1219100705 1924 dbSNP
rs1262162154 1928 dbSNP
rs1006311096 1934 dbSNP
rs1049863152 1935 dbSNP
rs1254821844 1936 dbSNP
rs904994041 1940 dbSNP
rs1217844223 1945 dbSNP
rs1410940751 1948 dbSNP
rs1417156744 1950 dbSNP
rs1023925765 1953 dbSNP
rs769333662 1953 dbSNP
rs996838142 1954 dbSNP
rs901146813 1966 dbSNP
rs1041444294 1973 dbSNP
rs1373719869 1982 dbSNP
rs534895061 1984 dbSNP
rs745826050 1987 dbSNP
rs1350219710 1990 dbSNP
rs896420077 1992 dbSNP
rs908820953 1995 dbSNP
rs1390074484 1996 dbSNP
rs567881494 1999 dbSNP
rs1232083915 2005 dbSNP
rs1277499448 2012 dbSNP
rs1349498854 2014 dbSNP
rs1211505916 2015 dbSNP
rs1332142065 2024 dbSNP
rs1251044966 2026 dbSNP
rs142272418 2043 dbSNP
rs903548823 2044 dbSNP
rs1178682905 2050 dbSNP
rs184638533 2051 dbSNP
rs1419830661 2058 dbSNP
rs747252921 2066 dbSNP
rs1436703334 2068 dbSNP
rs1170395666 2069 dbSNP
rs910717098 2072 dbSNP
rs1354412356 2075 dbSNP
rs1460947770 2081 dbSNP
rs986726981 2083 dbSNP
rs557773623 2086 dbSNP
rs1374525543 2092 dbSNP
rs923486906 2095 dbSNP
rs972359124 2102 dbSNP
rs961998300 2103 dbSNP
rs1300894012 2106 dbSNP
rs917553801 2107 dbSNP
rs139000351 2111 dbSNP
rs1189130090 2116 dbSNP
rs11062839 2127 dbSNP
rs1305625267 2128 dbSNP
rs984867492 2132 dbSNP
rs549613450 2133 dbSNP
rs1241908518 2147 dbSNP
rs1198798753 2150 dbSNP
rs1032713524 2155 dbSNP
rs143349246 2157 dbSNP
rs1256132624 2158 dbSNP
rs979241440 2164 dbSNP
rs149180300 2168 dbSNP
rs1356740425 2170 dbSNP
rs1285758535 2181 dbSNP
rs1194297879 2188 dbSNP
rs547193705 2191 dbSNP
rs1340101987 2195 dbSNP
rs1355480091 2201 dbSNP
rs1461289756 2205 dbSNP
rs1323456195 2211 dbSNP
rs1023451702 2216 dbSNP
rs1441184446 2225 dbSNP
rs1269017861 2232 dbSNP
rs1359321706 2233 dbSNP
rs1216247351 2236 dbSNP
rs1310078110 2244 dbSNP
rs1013868246 2252 dbSNP
rs547051507 2253 dbSNP
rs960585532 2257 dbSNP
rs901264783 2264 dbSNP
rs533093887 2265 dbSNP
rs145247853 2268 dbSNP
rs999402188 2275 dbSNP
rs1474506231 2279 dbSNP
rs1331311523 2284 dbSNP
rs1019603134 2285 dbSNP
rs1475181945 2301 dbSNP
rs903519662 2303 dbSNP
rs1420486389 2307 dbSNP
rs544270044 2311 dbSNP
rs1317278264 2344 dbSNP
rs887347106 2345 dbSNP
rs776306112 2348 dbSNP
rs1471601714 2351 dbSNP
rs530476298 2358 dbSNP
rs1049148837 2359 dbSNP
rs1354695054 2363 dbSNP
rs561842246 2367 dbSNP
rs1335302273 2371 dbSNP
rs118014543 2373 dbSNP
rs931576588 2379 dbSNP
rs1445335350 2387 dbSNP
rs1217984022 2389 dbSNP
rs1242810370 2397 dbSNP
rs1186494762 2408 dbSNP
rs1420462793 2409 dbSNP
rs1475759876 2416 dbSNP
rs182025699 2416 dbSNP
rs1860617 2417 dbSNP
rs1374337446 2418 dbSNP
rs1412845297 2420 dbSNP
rs755419874 2426 dbSNP
rs545586573 2428 dbSNP
rs1355821147 2435 dbSNP
rs1441276656 2445 dbSNP
rs1180940264 2446 dbSNP
rs923464432 2448 dbSNP
rs1036581319 2454 dbSNP
rs987823922 2461 dbSNP
rs1347326194 2465 dbSNP
rs940957680 2473 dbSNP
rs909211240 2480 dbSNP
rs1209311593 2483 dbSNP
rs1260289513 2488 dbSNP
rs754347469 2499 dbSNP
rs1452122677 2502 dbSNP
rs766759756 2517 dbSNP
rs984815537 2529 dbSNP
rs377153218 2531 dbSNP
rs1393952126 2537 dbSNP
rs145232231 2537 dbSNP
rs1432373470 2540 dbSNP
rs373298041 2565 dbSNP
rs138698498 2566 dbSNP
rs370120924 2566 dbSNP
rs71061134 2567 dbSNP
rs76847394 2567 dbSNP
rs925211433 2574 dbSNP
rs1409338607 2590 dbSNP
rs1242371369 2592 dbSNP
rs1337367981 2593 dbSNP
rs979316411 2598 dbSNP
rs953294542 2610 dbSNP
rs1370304722 2628 dbSNP
rs1308637642 2631 dbSNP
rs916623482 2632 dbSNP
rs1195745434 2634 dbSNP
rs975946461 2635 dbSNP
rs1333396074 2636 dbSNP
rs371309253 2649 dbSNP
rs1182044658 2652 dbSNP
rs1439988992 2652 dbSNP
rs1252044918 2653 dbSNP
rs965488640 2657 dbSNP
rs1194923125 2659 dbSNP
rs1395167857 2666 dbSNP
rs1475011573 2677 dbSNP
rs550174023 2682 dbSNP
rs1398318452 2689 dbSNP
rs774029649 2694 dbSNP
rs1410368448 2699 dbSNP
rs1405190019 2705 dbSNP
rs960784341 2709 dbSNP
rs1393968773 2710 dbSNP
rs1438987786 2710 dbSNP
rs1004201769 2711 dbSNP
rs887076957 2712 dbSNP
rs1227339420 2724 dbSNP
rs1026959128 2725 dbSNP
rs1341883825 2737 dbSNP
rs76011121 2737 dbSNP
rs1272983869 2743 dbSNP
rs1466811967 2748 dbSNP
rs571008786 2757 dbSNP
rs905461621 2762 dbSNP
rs1267429871 2763 dbSNP
rs1445954849 2768 dbSNP
rs3079895 2769 dbSNP
rs1374672852 2773 dbSNP
rs1198121325 2782 dbSNP
rs1377885267 2789 dbSNP
rs879193903 2794 dbSNP
rs764475687 2806 dbSNP
rs1478313561 2808 dbSNP
rs967961015 2811 dbSNP
rs700481 2814 dbSNP
rs769073474 2819 dbSNP
rs1381771361 2826 dbSNP
rs769446842 2827 dbSNP
rs1328670870 2831 dbSNP
rs1196455816 2843 dbSNP
rs1006483861 2845 dbSNP
rs935110102 2851 dbSNP
rs1265709583 2861 dbSNP
rs889475398 2868 dbSNP
rs745738053 2873 dbSNP
rs997950840 2875 dbSNP
rs1187204933 2889 dbSNP
rs1255132780 2893 dbSNP
rs776778536 2908 dbSNP
rs1167150471 2911 dbSNP
rs537860505 2912 dbSNP
rs1369222281 2919 dbSNP
rs532046029 2921 dbSNP
rs921883307 2924 dbSNP
rs1351782581 2932 dbSNP
rs1453364128 2943 dbSNP
rs975895626 2944 dbSNP
rs1387253131 2945 dbSNP
rs1401131670 2957 dbSNP
rs1036573391 2959 dbSNP
rs1219944196 2971 dbSNP
rs113462095 2974 dbSNP
rs940905963 2986 dbSNP
rs909495712 2987 dbSNP
rs758799 2989 dbSNP
rs948026140 3006 dbSNP
rs916588408 3008 dbSNP
rs1236447761 3021 dbSNP
rs1261956359 3023 dbSNP
rs1341467344 3028 dbSNP
rs1300448115 3029 dbSNP
rs992618696 3030 dbSNP
rs1401392787 3036 dbSNP
rs939486536 3045 dbSNP
rs1278167246 3053 dbSNP
rs189890309 3058 dbSNP
rs1486625105 3062 dbSNP
rs746830260 3069 dbSNP
rs1249566107 3074 dbSNP
rs923751336 3076 dbSNP
rs772523908 3080 dbSNP
rs1180006855 3085 dbSNP
rs1382245374 3091 dbSNP
rs1235033337 3100 dbSNP
rs201709805 3101 dbSNP
rs867762763 3101 dbSNP
rs1173111371 3103 dbSNP
rs1437127783 3103 dbSNP
rs34818389 3103 dbSNP
rs397849999 3103 dbSNP
rs967868140 3106 dbSNP
rs1026909960 3110 dbSNP
rs1373129980 3111 dbSNP
rs184904641 3125 dbSNP
rs985344033 3133 dbSNP
rs969612489 3134 dbSNP
rs953807539 3135 dbSNP
rs1029362354 3141 dbSNP
rs1376965497 3144 dbSNP
rs1023868034 3155 dbSNP
rs1480075135 3166 dbSNP
rs1349886617 3175 dbSNP
rs200958133 3176 dbSNP
rs371527388 3176 dbSNP
rs1195657714 3182 dbSNP
rs1479576732 3184 dbSNP
rs896618843 3211 dbSNP
rs1487421539 3213 dbSNP
rs1241792495 3214 dbSNP
rs536173387 3217 dbSNP
rs896928080 3225 dbSNP
rs778025946 3226 dbSNP
rs1005028618 3232 dbSNP
rs542529768 3232 dbSNP
rs887964612 3234 dbSNP
rs1435410364 3237 dbSNP
rs1177508084 3238 dbSNP
rs1049305092 3242 dbSNP
rs3168623 3251 dbSNP
rs1460833282 3254 dbSNP
rs895131432 3257 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*