miRTarBase - #MIRT023348 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLAGL2   
Synonyms ZNF900
Description PLAG1 like zinc finger 2
Transcript NM_002657   
Expression
Putative miRNA Targets on PLAGL2
3'UTR of PLAGL2
(miRNA target sites are highlighted)
>PLAGL2|NM_002657|3'UTR
   1 CCCCCACAGAGGCCCTCAGCTCAGTTTTTGGCTCTGTTATGGAGCCTTAGTACCCACCCCGTCTGTGTCCCCCATGAAGG
  81 CAGCTGAGCTTTCAGAGCTGGGTTCAAAAAAAAAAATTCCAGTGTCTGTATACAGGAGCACTTGGTTTGGGGGTTCAGGC
 161 TCTAGGATCGATTCCAGAAGGAGCCTTGAGCCCCAACCCCGTGAAAAGATCTCATACCGTAGGACTTCAGGTATTATTTA
 241 CTTTTATTTTTTTGACCTGAATCGGGAGCCACACTTGGCCCTCTTCCTCTCCAAAGCGCCAGAACCTCCTTCTCTTTGGA
 321 GAATGGGGAGGCCTCTTGGAGACACAGAGGGTTTCACCTTGGATGACCTCTAGAGAAATTGCCCAAGAAGCCCACCTTCT
 401 GGTCCCAACCTGCAGACCCCACAGCAGTCAGTTGGTCAGGCCCTGCTGTAGAAGGTCACTTGGCTCCATTGCCTGCTTCC
 481 AACCAATGGGCAGGAGAGAAGGCCTTTATTTCTCGCCCACCCATTCCTCCTGTACCAGCACCTCCGTTTTCAGTCAGTGT
 561 TGTCCAGCAACGGTACCGTTTACACAGTCACCTCAGACACACCATTTCACCTCCCTTGCCAAGCTGTTAGCCTTAGAGTG
 641 ATTGCAGTGAACACTGTTTACACACCGTGAATCCATTCCCATCAGTCCATTCCAGTTGGCACCAGCCTGAACCATTTGGT
 721 ACCTGGTGTTAACTGGAGTCCTGTTTACAAGGTGGAGTCGGGGCTTGCTGACTTCTCTTCATTTGAGGTCACATTTTTCC
 801 CCCGTGGGGAAATAAACTGACTTTGGACTGCTTCAGTCTCTGCCATCTTCCATGACTGCATTTGTTCCTGCCTGCCTCGG
 881 CGGTATCCACAGAAGACAGGCAAGAGGATTGGAGCAGTTTTCTCACAGGTCTGCAATTCTGTTTTTCTCCAAGTACATTA
 961 TGACCCCCTCATCCTTCTCTTGAACTGGAGAGGGGAAGAAATGAAAGGCATGCCCACGTCCGTCACCTCCCCATCCCCTA
1041 GTCCCCACCTTGAACATCATGAGCTGTTGTTATTAGTCTTGGAAGCAGAGTCTGGGTTGGTGTGGATAGCAAAGGAGGAA
1121 GTCTGAGCCCCTCATTGGTCTTCCTCCCACCTGTCCCTTTTCCGGGAAGTTGTGGAATTGTTGGAAGAAGAGTTTGCAGA
1201 AGGTTAGGAATGGGTAGATAGCTAAGTCCTAATCTATGGGTACATTGTTGTGTCCCAAACCAAAATTTTCCTTATCCACA
1281 ATGTCCCTTCTGTCTCTTCCACTTTACAGTGGACTCGGCCACTGTGCATAGGCTTCTCTGCTCTCCATCAAATCACTTCC
1361 ACTTTCCTGTGCCCCCACCCCCGCCTCCAGTTTTCCGCTAGTATCCGGCAAGGTTTCTTGCAACAAATGATTAGTTCTTT
1441 TCTTCTGACTCGTGGGGCTCCCTGCTGCAGAGAGCACAGCCCTTGCCTGGAGCCCAGGAACCCCATCCTTGCTTCATCTC
1521 AGTTCTTCATGGGCTTCACTCTTCCCACTCACGGAAGGGAGGTAGCTCAGGGACCTCCACTGTGGGACCCTTGAGACGCT
1601 TCCACTCTGATTCAGAAACACACTTCTACCTCTTTACTGTTAACTCTTAACAGATGCAGTCAGCAGTTTCTGGGCACTTC
1681 TCTCAGTAGGTGCCTCATGCTGACTTCTCCAGTAGGGTTTCAGGACAAACTACCAAGGAATTGCCTCAGCCTCCTACCAG
1761 TCCTCCCTCACCCACCTTCTGTCTAGGTTCACTTGGTTTGTCATCAGGAACTGAGCAGGTCCAGGACTCAGCTTTCTGCT
1841 TCAGCCTAAGCCAGTACTCCTTGTTTGAGGTAAAAGCCTTAAAATTTAGCTCCCTAGCTCTTGATTAGAAGCAATTTGGA
1921 GTAAGTGTGTTTTGATTTAGGCAGGGTAGCTTGGGATACCTTTTTAAAAACACCAGATATTAAAATGTCTGGCAAGGTTA
2001 GAATCAGACTAGATGATTTGCTTCTAAAAATTAGTTTCAGTGAGTCCCAGGGACTAATTAAGGTTTATTTTAAAAAGTGT
2081 CTACCTTGGTACGCAGCCACCTCCTGCATGCTGTGCATGTTATTGGGACTTGTATTATAGGTGATGGTATGTGAGAATCC
2161 AGTTGGGACTCGCTGTTGCCATCCTCTTTGTTGTATCTGGTTTTCATCACTAGACTCAGCAACCCTTCTCACCTTAACTG
2241 CCACCTTCCCTACACTCTCAGTTTACAGAGGCCACTGGGCCTCTGGCTGCAGAATACAAAGTCCCGGGCTGTTAGAGGAG
2321 TCCTTTCCTCTCTGCCTGCCCTTTCCTGTCCCTCCCTCGAATTCTCTCTCCCCGTAAGTGATGCTGGAAAAGTCATAGGA
2401 CTGGCAAAGCAACTGTTTAAACCCTTTGTAACCGGGGCCTTGCCCCCACCTCCTGTCTTTTCTCCTTGCCTTCCCCACTC
2481 CTGTGTCCTCCCATCTATCCTGTCTTTCCTTTCCTCCTCTCAGTGTCCTCAGCACCCACAAGGAATTTTCCTATCACTGT
2561 GAACTTTGCTGGTACAGAGGAATAATATCTGCCTTCACCTTTTTTTTTTTGGACCATAGCTAGCCAGTCATTTCTTAAAC
2641 CTCCCTTCCTAAAATCTGGGGGGTCGGGGGGAAAGAAAAAAAAAGCCTTAGTGGCCTGGTTGTTCAAAGGATAAGAATAG
2721 CTTTATCCTGCACTCAGTACCCGAACTCACTTCAGTATGCTTACTGAGGCCATGAGAACCTGAGGGGCATCTGCCCAGGA
2801 CAGGAGCCATGGCATATGACAAAGACCAATGAGGGACCAGGAAAAAAAGTGATGTCCCCTTTCCCTGCCACCTCCAGCCT
2881 CTGCCAGCAATGAGCTGTCCCCCTCCCACCCTACACAGTAGCTGGTCAGGGCTGAGTACAGTCCTGGGGGTAAGGGGATG
2961 ACATGCCCAGGTGTCAGCTCAAAGGATCTCTGCATCATCTTGAGGTGGGAGGCAGGGAAAGGAGCGCCAATGAGGTTCCC
3041 TGCAACCCCCGCCCTCCAGCCCACCGCCCAACCTTTTACAAATGGCATTTTCTTAATTGAAAATCCGGGAAGCAGGTGTG
3121 ATTACTTTTTTGCTCGTAGATATTGTCCTAAGTTGGAATTCTCCCACTGCCCTAAAACTTTCCCTAGTAGTCCTTTAAAC
3201 TCCCCCCTCCCTTTTTGGTAGCTGTTTTCTCCGTCCTCTCTCCACCTGCCCTCTTATCTAGGAGCTGTTTGTAAGCACGA
3281 TTTTTTTAACAGGTTATATTGTACAGGATCAATATTTTGCTTTTTAACAAGGATATTTATGTAATAAGAAACTTTGCCTT
3361 AGGCAGGTGTTGGCCAGAAAAGTCCAGATTCCTCTGGGATCCCACCCTGGCCTCTCCTGGAACTCTGAACCTGCTGTGGA
3441 AGGAATTGGCCATGACCTTCACCTCTGGAGAGTAGGGTCTATGGCGAGGGAAAAGGGTGTTCACCATGATAACCTAGTGC
3521 CTCCATAGAGGGGTTTGGAAAAATTCCAGTCCGATTTCTTTGTGTGTCAGCTGACTTCCTTAGCTGATTGTTCCCACTTG
3601 CACCTCTCCACCTTTGGCACTAGAACTCCTGAGACACCACTTCTCATGCTTCTCCCTCCCTACCAGCGGTCAAGGCTTTG
3681 GAGCCACTCTTTTGTAACTCCAGATTATTTAAAGAGAAAAGTACAAGACAGAAATCTTCTAGCACTTTGTAAACACAGTG
3761 AATAACCTCTTGGAGTATTTTTGGCTTTATATAAAACAAGGTTTTTAATTGTAAAGTATAAGTGCCATTAGAAAATGCAC
3841 AGGGCATATCTTTGTTAAAGTAGATTTTTCAATGTTTTACAGAATTACATTTTCAAAAAAAGGTTTTTATAATGAAGTTG
3921 TTTATTAAAAACTTCTGAATGATGTGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              |||| |   :||||||: 
Target 5' ctgcCACCTTCCCTACACTCTc 3'
2238 - 2259 138.00 -14.30
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |||||::|  |:|||| || 
Target 5' tgAACACTGT--TTACACACCg 3'
648 - 667 136.00 -15.10
3
miRNA  3' guUUGUGGU-AACAGUGUGAGGu 5'
            :|||||| || |||::||:| 
Target 5' gaGACACCACTTCTCATGCTTCt 3'
3631 - 3653 132.00 -16.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30455122 3 COSMIC
COSN29438189 7 COSMIC
COSN29438208 9 COSMIC
COSN20085989 22 COSMIC
COSN30470029 34 COSMIC
COSN31532530 48 COSMIC
COSN19633040 56 COSMIC
COSN30179054 59 COSMIC
COSN31531892 60 COSMIC
COSN30458275 71 COSMIC
COSN1247528 101 COSMIC
COSN28843096 106 COSMIC
COSN17167852 117 COSMIC
COSN31501993 134 COSMIC
COSN31532462 218 COSMIC
COSN30545247 264 COSMIC
COSN25412228 531 COSMIC
COSN26259458 534 COSMIC
COSN5968699 599 COSMIC
COSN31488004 608 COSMIC
COSN26649410 610 COSMIC
COSN28135690 683 COSMIC
COSN31519070 803 COSMIC
COSN31566062 881 COSMIC
COSN9125727 917 COSMIC
COSN5865461 1163 COSMIC
COSN16428665 1166 COSMIC
COSN18723880 1174 COSMIC
COSN28663389 1382 COSMIC
COSN31488026 1451 COSMIC
COSN31487998 1520 COSMIC
COSN30176003 1528 COSMIC
COSN21154602 1544 COSMIC
COSN31557357 1553 COSMIC
COSN31561951 1579 COSMIC
COSN30538225 1586 COSMIC
COSN26554401 1623 COSMIC
COSN30544535 1661 COSMIC
COSN19656821 1712 COSMIC
COSN5133762 1746 COSMIC
COSN31600927 1753 COSMIC
COSN31523421 1797 COSMIC
COSN31488013 1829 COSMIC
COSN31528925 2009 COSMIC
COSN31571076 2074 COSMIC
COSN29893940 2195 COSMIC
COSN28196177 2332 COSMIC
COSN8345799 2339 COSMIC
COSN31549877 2450 COSMIC
COSN31565258 2504 COSMIC
COSN22475984 2514 COSMIC
COSN31544988 2551 COSMIC
COSN31485172 2589 COSMIC
COSN32061506 2600 COSMIC
COSN21234052 2903 COSMIC
COSN4969524 2967 COSMIC
COSN29662656 3224 COSMIC
COSN31543284 3294 COSMIC
COSN25709966 3310 COSMIC
COSN28687568 3438 COSMIC
COSN31483239 3486 COSMIC
COSN31512938 3490 COSMIC
COSN1869701 3613 COSMIC
COSN31569437 3733 COSMIC
COSN31570569 3903 COSMIC
COSN15708090 3922 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs763604569 1 dbSNP
rs1357989193 2 dbSNP
rs866242401 3 dbSNP
rs1317668854 5 dbSNP
rs1488742279 8 dbSNP
rs542362578 12 dbSNP
rs752325485 17 dbSNP
rs1310546306 25 dbSNP
rs1192724248 28 dbSNP
rs377544501 29 dbSNP
rs759582997 32 dbSNP
rs1328270431 34 dbSNP
rs776718663 36 dbSNP
rs753625392 37 dbSNP
rs373466759 40 dbSNP
rs1423722861 42 dbSNP
rs1380849642 44 dbSNP
rs1381065601 46 dbSNP
rs1180369901 49 dbSNP
rs760890444 50 dbSNP
rs1464964073 52 dbSNP
rs933707154 55 dbSNP
rs1392614030 57 dbSNP
rs891582508 60 dbSNP
rs1052764193 61 dbSNP
rs1437747769 61 dbSNP
rs1295667247 65 dbSNP
rs1365921718 67 dbSNP
rs574848750 72 dbSNP
rs553438388 75 dbSNP
rs935694185 80 dbSNP
rs1355277279 90 dbSNP
rs561331389 93 dbSNP
rs1189879865 95 dbSNP
rs1056775 98 dbSNP
rs1282878971 105 dbSNP
rs1322266845 106 dbSNP
rs541310066 107 dbSNP
rs925644462 114 dbSNP
rs1442743384 115 dbSNP
rs1244836638 116 dbSNP
rs1193297526 117 dbSNP
rs1488029233 117 dbSNP
rs980394564 120 dbSNP
rs1198561475 121 dbSNP
rs1441736805 122 dbSNP
rs1176881497 136 dbSNP
rs1344227281 152 dbSNP
rs1406527851 153 dbSNP
rs577113246 159 dbSNP
rs758014074 164 dbSNP
rs1275338466 169 dbSNP
rs948677731 170 dbSNP
rs1332411717 181 dbSNP
rs1378681718 188 dbSNP
rs1444039935 190 dbSNP
rs1226955593 192 dbSNP
rs1379262125 196 dbSNP
rs558461313 200 dbSNP
rs537203540 201 dbSNP
rs1333948071 202 dbSNP
rs1199073069 211 dbSNP
rs1448330312 213 dbSNP
rs950794891 219 dbSNP
rs6087832 222 dbSNP
rs1339555759 223 dbSNP
rs6089210 230 dbSNP
rs1473154329 233 dbSNP
rs1184150688 239 dbSNP
rs1026395334 244 dbSNP
rs1475137521 246 dbSNP
rs1171845643 248 dbSNP
rs1402819495 257 dbSNP
rs1333886025 263 dbSNP
rs973460931 264 dbSNP
rs746350331 279 dbSNP
rs1359290335 280 dbSNP
rs781775818 282 dbSNP
rs1281885500 286 dbSNP
rs538293873 293 dbSNP
rs569773268 297 dbSNP
rs752349851 298 dbSNP
rs1279863936 305 dbSNP
rs1315820488 307 dbSNP
rs1194342039 309 dbSNP
rs1372932522 311 dbSNP
rs963672405 314 dbSNP
rs1212361992 319 dbSNP
rs1255415767 326 dbSNP
rs1485631481 331 dbSNP
rs28396287 336 dbSNP
rs1426310675 344 dbSNP
rs754725678 347 dbSNP
rs1388429052 353 dbSNP
rs183165940 357 dbSNP
rs565317257 361 dbSNP
rs1030905737 377 dbSNP
rs1331641672 386 dbSNP
rs1009775296 394 dbSNP
rs1165165469 396 dbSNP
rs1400609794 401 dbSNP
rs750738417 407 dbSNP
rs1299934485 415 dbSNP
rs1473233579 427 dbSNP
rs1226463183 430 dbSNP
rs6089209 439 dbSNP
rs1275169847 455 dbSNP
rs1345988997 460 dbSNP
rs767935571 463 dbSNP
rs1052817433 474 dbSNP
rs935745050 477 dbSNP
rs1483922960 479 dbSNP
rs1265937546 482 dbSNP
rs904159528 486 dbSNP
rs1192948736 492 dbSNP
rs1044086205 514 dbSNP
rs547038364 515 dbSNP
rs1481758602 520 dbSNP
rs1394003776 530 dbSNP
rs1291374543 531 dbSNP
rs1228436712 532 dbSNP
rs139944806 535 dbSNP
rs1282127180 538 dbSNP
rs1231779380 539 dbSNP
rs1352715560 544 dbSNP
rs762157186 545 dbSNP
rs992617384 546 dbSNP
rs150691096 557 dbSNP
rs919098373 571 dbSNP
rs552596692 574 dbSNP
rs973428403 577 dbSNP
rs752089635 578 dbSNP
rs6142635 596 dbSNP
rs986176572 600 dbSNP
rs1413274346 603 dbSNP
rs1288199283 611 dbSNP
rs1349180343 613 dbSNP
rs1204992630 619 dbSNP
rs1291125594 636 dbSNP
rs1453673388 646 dbSNP
rs1191402210 649 dbSNP
rs1252021383 658 dbSNP
rs531103212 666 dbSNP
rs765284977 666 dbSNP
rs563884544 667 dbSNP
rs1412467470 671 dbSNP
rs1009827430 683 dbSNP
rs1163756874 690 dbSNP
rs1392675479 702 dbSNP
rs956825717 718 dbSNP
rs1324929702 719 dbSNP
rs542327709 723 dbSNP
rs1447726377 736 dbSNP
rs764108067 743 dbSNP
rs1334055019 749 dbSNP
rs762994078 759 dbSNP
rs1285268110 760 dbSNP
rs1359028100 764 dbSNP
rs1212235269 767 dbSNP
rs1272881519 775 dbSNP
rs1044445581 777 dbSNP
rs1200130335 778 dbSNP
rs1012623479 779 dbSNP
rs1247874255 781 dbSNP
rs1417975318 782 dbSNP
rs895472895 789 dbSNP
rs1056943454 793 dbSNP
rs1474159503 798 dbSNP
rs929236282 799 dbSNP
rs1400675821 802 dbSNP
rs1466398671 803 dbSNP
rs919067204 804 dbSNP
rs1394485291 809 dbSNP
rs1037517872 827 dbSNP
rs1313467625 833 dbSNP
rs1342795228 834 dbSNP
rs942094490 851 dbSNP
rs1293129576 852 dbSNP
rs1319013835 856 dbSNP
rs1220140432 857 dbSNP
rs1249226159 859 dbSNP
rs1480086031 868 dbSNP
rs530245712 871 dbSNP
rs1289347165 878 dbSNP
rs910673944 881 dbSNP
rs541691098 882 dbSNP
rs923276727 889 dbSNP
rs988364414 908 dbSNP
rs1371575762 918 dbSNP
rs1461619039 922 dbSNP
rs956962624 934 dbSNP
rs1377344919 936 dbSNP
rs1437204909 936 dbSNP
rs1312779393 939 dbSNP
rs1341561677 940 dbSNP
rs1032495140 941 dbSNP
rs1321776952 947 dbSNP
rs1458998492 957 dbSNP
rs1001070770 959 dbSNP
rs1389713306 965 dbSNP
rs968869156 966 dbSNP
rs1345104188 967 dbSNP
rs1455495646 973 dbSNP
rs1210140782 974 dbSNP
rs1022673000 976 dbSNP
rs1427105892 987 dbSNP
rs759863240 994 dbSNP
rs1184573789 997 dbSNP
rs559779061 1001 dbSNP
rs541477335 1009 dbSNP
rs1428210696 1013 dbSNP
rs1177036273 1016 dbSNP
rs1013087519 1017 dbSNP
rs143001183 1018 dbSNP
rs1361762673 1021 dbSNP
rs1244496595 1022 dbSNP
rs1433436356 1037 dbSNP
rs1056740806 1041 dbSNP
rs1465067614 1044 dbSNP
rs1387052066 1045 dbSNP
rs1305147310 1048 dbSNP
rs574660921 1055 dbSNP
rs1232955354 1060 dbSNP
rs1208439792 1063 dbSNP
rs993354333 1066 dbSNP
rs1315513914 1069 dbSNP
rs897773545 1072 dbSNP
rs555939080 1073 dbSNP
rs1037487227 1075 dbSNP
rs1281301077 1075 dbSNP
rs941914468 1077 dbSNP
rs558788412 1088 dbSNP
rs1367577475 1094 dbSNP
rs1301300524 1100 dbSNP
rs933414836 1103 dbSNP
rs923243939 1105 dbSNP
rs552683601 1108 dbSNP
rs1403026270 1112 dbSNP
rs1157541265 1120 dbSNP
rs1345021892 1126 dbSNP
rs866427504 1134 dbSNP
rs935556994 1135 dbSNP
rs1391851174 1138 dbSNP
rs770765578 1144 dbSNP
rs1360711926 1153 dbSNP
rs1374858481 1154 dbSNP
rs373861654 1155 dbSNP
rs980093839 1163 dbSNP
rs190783562 1164 dbSNP
rs1413813006 1167 dbSNP
rs1423020440 1192 dbSNP
rs1215356334 1196 dbSNP
rs1270978035 1206 dbSNP
rs1024236234 1213 dbSNP
rs1449563677 1215 dbSNP
rs991228023 1224 dbSNP
rs1238935036 1226 dbSNP
rs1471187550 1236 dbSNP
rs1176027672 1243 dbSNP
rs1246962945 1244 dbSNP
rs746904269 1246 dbSNP
rs773305858 1251 dbSNP
rs1427745303 1265 dbSNP
rs1331578035 1271 dbSNP
rs959803878 1281 dbSNP
rs1439428413 1290 dbSNP
rs1297057828 1292 dbSNP
rs1379826278 1307 dbSNP
rs1035303921 1310 dbSNP
rs185939685 1316 dbSNP
rs1485069891 1317 dbSNP
rs897745779 1318 dbSNP
rs1016145276 1321 dbSNP
rs1273939896 1327 dbSNP
rs1006561088 1347 dbSNP
rs554374230 1354 dbSNP
rs1312119366 1355 dbSNP
rs1232306972 1356 dbSNP
rs535942715 1357 dbSNP
rs1483902207 1358 dbSNP
rs182750639 1360 dbSNP
rs747656516 1367 dbSNP
rs778543182 1372 dbSNP
rs754528299 1376 dbSNP
rs909851065 1377 dbSNP
rs553462428 1378 dbSNP
rs1297089068 1382 dbSNP
rs1359234993 1383 dbSNP
rs1416608854 1386 dbSNP
rs1310975004 1389 dbSNP
rs1354626324 1396 dbSNP
rs1380764134 1397 dbSNP
rs1400420194 1397 dbSNP
rs191207152 1398 dbSNP
rs534298194 1400 dbSNP
rs148502714 1403 dbSNP
rs1272450763 1406 dbSNP
rs764550044 1407 dbSNP
rs1213686051 1413 dbSNP
rs1256056606 1421 dbSNP
rs901958314 1426 dbSNP
rs1194359641 1428 dbSNP
rs758975499 1429 dbSNP
rs1244131719 1431 dbSNP
rs1474261532 1434 dbSNP
rs552798375 1437 dbSNP
rs531140981 1439 dbSNP
rs1373492813 1445 dbSNP
rs1425322961 1451 dbSNP
rs1052427960 1452 dbSNP
rs935278895 1460 dbSNP
rs570241030 1485 dbSNP
rs925280115 1486 dbSNP
rs1420171503 1487 dbSNP
rs1320118052 1489 dbSNP
rs1324452126 1505 dbSNP
rs1428941541 1508 dbSNP
rs1269791351 1515 dbSNP
rs1371948534 1532 dbSNP
rs1236613172 1535 dbSNP
rs979678737 1540 dbSNP
rs1347792496 1545 dbSNP
rs948322919 1548 dbSNP
rs916734215 1552 dbSNP
rs992762832 1553 dbSNP
rs548846292 1559 dbSNP
rs959772928 1571 dbSNP
rs1035441841 1573 dbSNP
rs1393888695 1577 dbSNP
rs1470503666 1586 dbSNP
rs971792504 1590 dbSNP
rs116786142 1597 dbSNP
rs1016358659 1598 dbSNP
rs1323912411 1600 dbSNP
rs1395507954 1612 dbSNP
rs1443292943 1619 dbSNP
rs557891368 1620 dbSNP
rs1483135953 1621 dbSNP
rs764647764 1628 dbSNP
rs1207958927 1637 dbSNP
rs1240450570 1642 dbSNP
rs1483393428 1654 dbSNP
rs889055238 1657 dbSNP
rs1028814498 1676 dbSNP
rs997386078 1677 dbSNP
rs901678684 1678 dbSNP
rs11537739 1680 dbSNP
rs144698294 1685 dbSNP
rs1313725302 1686 dbSNP
rs1251886460 1687 dbSNP
rs1437870134 1689 dbSNP
rs1183292296 1690 dbSNP
rs765375770 1697 dbSNP
rs1353365873 1700 dbSNP
rs935416006 1711 dbSNP
rs1056776 1712 dbSNP
rs1410338489 1713 dbSNP
rs1044137484 1714 dbSNP
rs374103646 1727 dbSNP
rs867727459 1743 dbSNP
rs916850672 1745 dbSNP
rs1392068490 1746 dbSNP
rs1459046544 1749 dbSNP
rs776945055 1756 dbSNP
rs1334528373 1769 dbSNP
rs1238881653 1777 dbSNP
rs532504119 1784 dbSNP
rs766607856 1787 dbSNP
rs1231113725 1803 dbSNP
rs1272182244 1829 dbSNP
rs918764242 1833 dbSNP
rs142002524 1836 dbSNP
rs543683353 1843 dbSNP
rs1416171027 1844 dbSNP
rs766041117 1846 dbSNP
rs961790467 1853 dbSNP
rs908860518 1854 dbSNP
rs1474086015 1865 dbSNP
rs1163891949 1882 dbSNP
rs984892869 1892 dbSNP
rs760525774 1893 dbSNP
rs1194133167 1894 dbSNP
rs953314543 1902 dbSNP
rs1394418738 1903 dbSNP
rs1409798405 1904 dbSNP
rs1313982904 1914 dbSNP
rs1029365760 1918 dbSNP
rs1413343100 1918 dbSNP
rs997441736 1921 dbSNP
rs1307721472 1931 dbSNP
rs567867337 1932 dbSNP
rs1229149741 1939 dbSNP
rs965838892 1941 dbSNP
rs1338159202 1947 dbSNP
rs1211560586 1955 dbSNP
rs370309332 1956 dbSNP
rs1030857587 1958 dbSNP
rs999591737 1960 dbSNP
rs1186980511 1967 dbSNP
rs1262089749 1970 dbSNP
rs1221143514 1973 dbSNP
rs1429411771 1985 dbSNP
rs576307964 1987 dbSNP
rs1333029547 2003 dbSNP
rs1195583162 2022 dbSNP
rs1289951204 2038 dbSNP
rs1371446266 2042 dbSNP
rs1429219203 2049 dbSNP
rs60876147 2052 dbSNP
rs542375391 2058 dbSNP
rs1349784336 2063 dbSNP
rs1377813540 2067 dbSNP
rs1433330242 2078 dbSNP
rs115375105 2092 dbSNP
rs1012700058 2093 dbSNP
rs895149965 2099 dbSNP
rs1325447194 2108 dbSNP
rs1367729458 2115 dbSNP
rs1056609732 2123 dbSNP
rs773182655 2133 dbSNP
rs939620205 2138 dbSNP
rs918734645 2141 dbSNP
rs6061216 2142 dbSNP
rs748108155 2143 dbSNP
rs1161815154 2145 dbSNP
rs1486704731 2149 dbSNP
rs1203113622 2150 dbSNP
rs1259938493 2161 dbSNP
rs773666193 2162 dbSNP
rs1449026124 2163 dbSNP
rs1194343310 2166 dbSNP
rs1396962004 2171 dbSNP
rs1453177000 2172 dbSNP
rs768241932 2187 dbSNP
rs1458145988 2192 dbSNP
rs1455705006 2196 dbSNP
rs1287437308 2200 dbSNP
rs908991018 2217 dbSNP
rs984471363 2223 dbSNP
rs1305083052 2224 dbSNP
rs1368137068 2229 dbSNP
rs1218629721 2230 dbSNP
rs953126382 2233 dbSNP
rs1318600351 2238 dbSNP
rs1363664316 2239 dbSNP
rs1236625943 2244 dbSNP
rs1259856617 2254 dbSNP
rs1464669218 2259 dbSNP
rs1180329350 2261 dbSNP
rs921626521 2273 dbSNP
rs975974052 2292 dbSNP
rs1467170260 2295 dbSNP
rs1190647221 2298 dbSNP
rs1268123810 2305 dbSNP
rs538368034 2306 dbSNP
rs1157383246 2309 dbSNP
rs577547676 2319 dbSNP
rs1030824666 2340 dbSNP
rs1193133060 2345 dbSNP
rs377702503 2355 dbSNP
rs1327480503 2356 dbSNP
rs1270318035 2358 dbSNP
rs537745819 2359 dbSNP
rs776877588 2359 dbSNP
rs1221999884 2368 dbSNP
rs1287553177 2370 dbSNP
rs968155858 2372 dbSNP
rs551235571 2373 dbSNP
rs145984555 2374 dbSNP
rs1320094650 2380 dbSNP
rs1220944828 2388 dbSNP
rs1233463878 2390 dbSNP
rs895111543 2394 dbSNP
rs1175979370 2395 dbSNP
rs1056411797 2396 dbSNP
rs536814653 2404 dbSNP
rs1167484699 2405 dbSNP
rs1235355768 2407 dbSNP
rs1415225675 2415 dbSNP
rs566293376 2422 dbSNP
rs1170611076 2428 dbSNP
rs1003734389 2433 dbSNP
rs1439992054 2434 dbSNP
rs1452280750 2437 dbSNP
rs186544427 2447 dbSNP
rs1416416713 2455 dbSNP
rs771253263 2462 dbSNP
rs761275818 2473 dbSNP
rs867441502 2474 dbSNP
rs1486571728 2487 dbSNP
rs373107699 2493 dbSNP
rs888625987 2511 dbSNP
rs1436229445 2520 dbSNP
rs1384734799 2524 dbSNP
rs568305381 2528 dbSNP
rs931767267 2530 dbSNP
rs1203689697 2532 dbSNP
rs921579673 2541 dbSNP
rs1486250773 2544 dbSNP
rs867916977 2545 dbSNP
rs975774677 2553 dbSNP
rs1255838439 2559 dbSNP
rs1472294420 2563 dbSNP
rs1173077645 2567 dbSNP
rs181008422 2574 dbSNP
rs923891635 2578 dbSNP
rs1250061723 2580 dbSNP
rs1189487469 2581 dbSNP
rs1167365593 2587 dbSNP
rs755799656 2588 dbSNP
rs978004051 2589 dbSNP
rs1446163099 2597 dbSNP
rs202143071 2600 dbSNP
rs1447641200 2602 dbSNP
rs1259371503 2609 dbSNP
rs78800481 2610 dbSNP
rs1199130798 2611 dbSNP
rs1226290519 2611 dbSNP
rs1296880449 2611 dbSNP
rs58879159 2611 dbSNP
rs1349314307 2612 dbSNP
rs1213625169 2613 dbSNP
rs1277009401 2614 dbSNP
rs1202001831 2615 dbSNP
rs1442172335 2627 dbSNP
rs1345618377 2629 dbSNP
rs1447224384 2630 dbSNP
rs1240238625 2633 dbSNP
rs1187397696 2639 dbSNP
rs1395158098 2641 dbSNP
rs1455579748 2658 dbSNP
rs1022142999 2665 dbSNP
rs1401286729 2666 dbSNP
rs1231359105 2670 dbSNP
rs1343723043 2671 dbSNP
rs1297815660 2672 dbSNP
rs1227187745 2675 dbSNP
rs991290718 2676 dbSNP
rs1320038317 2677 dbSNP
rs959509244 2679 dbSNP
rs1237195087 2684 dbSNP
rs1034973670 2685 dbSNP
rs1224700465 2685 dbSNP
rs1273612732 2685 dbSNP
rs546749298 2686 dbSNP
rs565280925 2697 dbSNP
rs549950532 2710 dbSNP
rs1253144258 2718 dbSNP
rs1312810673 2725 dbSNP
rs1005814108 2732 dbSNP
rs888589163 2738 dbSNP
rs1470431400 2739 dbSNP
rs1049949105 2741 dbSNP
rs931711776 2742 dbSNP
rs1169359497 2743 dbSNP
rs1455886125 2745 dbSNP
rs1475189975 2746 dbSNP
rs1443224353 2750 dbSNP
rs1321608834 2754 dbSNP
rs190936985 2760 dbSNP
rs560805023 2761 dbSNP
rs1040057357 2764 dbSNP
rs1189338396 2772 dbSNP
rs778172254 2785 dbSNP
rs1273464481 2792 dbSNP
rs944314029 2794 dbSNP
rs758848599 2796 dbSNP
rs1266044982 2799 dbSNP
rs142568219 2804 dbSNP
rs1208671454 2809 dbSNP
rs1183872675 2810 dbSNP
rs1249397291 2814 dbSNP
rs1484025013 2824 dbSNP
rs1165316634 2828 dbSNP
rs1274698527 2829 dbSNP
rs946675604 2835 dbSNP
rs11537740 2841 dbSNP
rs185193221 2842 dbSNP
rs1337027408 2844 dbSNP
rs1411066482 2849 dbSNP
rs1331427513 2851 dbSNP
rs1349132879 2858 dbSNP
rs773625583 2860 dbSNP
rs1294233989 2862 dbSNP
rs959441559 2869 dbSNP
rs1242138425 2872 dbSNP
rs1035107461 2875 dbSNP
rs1339434726 2885 dbSNP
rs1341476064 2891 dbSNP
rs560120766 2892 dbSNP
rs1272417905 2894 dbSNP
rs753254539 2895 dbSNP
rs1482654680 2914 dbSNP
rs765193385 2917 dbSNP
rs1188395632 2918 dbSNP
rs1259350551 2921 dbSNP
rs1425840683 2924 dbSNP
rs1185663992 2927 dbSNP
rs1368012197 2940 dbSNP
rs1475802159 2955 dbSNP
rs1170518045 2956 dbSNP
rs982164193 2960 dbSNP
rs1372987835 2963 dbSNP
rs1313927660 2969 dbSNP
rs961327421 2970 dbSNP
rs1393965037 2971 dbSNP
rs1311608456 2986 dbSNP
rs1326600537 2988 dbSNP
rs1228992477 2990 dbSNP
rs1015565435 2993 dbSNP
rs1341455609 3016 dbSNP
rs1006197495 3019 dbSNP
rs953019654 3020 dbSNP
rs1482137044 3023 dbSNP
rs1394525824 3025 dbSNP
rs1028902119 3026 dbSNP
rs116302109 3030 dbSNP
rs901341763 3034 dbSNP
rs12480805 3040 dbSNP
rs1040110899 3046 dbSNP
rs1388383178 3046 dbSNP
rs1416872386 3048 dbSNP
rs755108882 3050 dbSNP
rs753914353 3051 dbSNP
rs6121380 3054 dbSNP
rs1008663448 3065 dbSNP
rs181960920 3066 dbSNP
rs1385227495 3067 dbSNP
rs1056777 3071 dbSNP
rs1252523539 3072 dbSNP
rs6121379 3073 dbSNP
rs1203137534 3080 dbSNP
rs1318022443 3092 dbSNP
rs1363801531 3095 dbSNP
rs1435575308 3097 dbSNP
rs761035518 3099 dbSNP
rs1210085313 3102 dbSNP
rs946613948 3105 dbSNP
rs915198219 3106 dbSNP
rs1333763510 3109 dbSNP
rs537402084 3131 dbSNP
rs750184712 3135 dbSNP
rs937807865 3136 dbSNP
rs1210795317 3138 dbSNP
rs1246303377 3143 dbSNP
rs189305939 3148 dbSNP
rs1231916803 3156 dbSNP
rs1270110725 3168 dbSNP
rs982136716 3172 dbSNP
rs184544786 3181 dbSNP
rs1441479865 3192 dbSNP
rs536981281 3199 dbSNP
rs1458534862 3200 dbSNP
rs1387406118 3202 dbSNP
rs1334087550 3204 dbSNP
rs566256312 3214 dbSNP
rs181587952 3219 dbSNP
rs908525094 3232 dbSNP
rs1406141636 3233 dbSNP
rs1394114820 3236 dbSNP
rs984173288 3237 dbSNP
rs1226300263 3238 dbSNP
rs767423227 3245 dbSNP
rs1458630105 3246 dbSNP
rs1328679126 3259 dbSNP
rs1214400990 3278 dbSNP
rs539116280 3279 dbSNP
rs1487824880 3287 dbSNP
rs1191100856 3288 dbSNP
rs1028533207 3289 dbSNP
rs997513445 3290 dbSNP
rs570183954 3298 dbSNP
rs1199003647 3299 dbSNP
rs571611311 3300 dbSNP
rs1461581592 3301 dbSNP
rs1166382811 3318 dbSNP
rs1467748974 3323 dbSNP
rs1457378841 3326 dbSNP
rs1298707134 3327 dbSNP
rs1352201796 3336 dbSNP
rs550254326 3344 dbSNP
rs1019814077 3345 dbSNP
rs1008634314 3353 dbSNP
rs1212143828 3362 dbSNP
rs902294812 3363 dbSNP
rs1331662679 3379 dbSNP
rs1042442681 3389 dbSNP
rs1285523824 3392 dbSNP
rs1010611138 3398 dbSNP
rs12479895 3399 dbSNP
rs1349215264 3406 dbSNP
rs1203464529 3411 dbSNP
rs1251545681 3423 dbSNP
rs1475366931 3435 dbSNP
rs1183202948 3448 dbSNP
rs1347592314 3450 dbSNP
rs1422747529 3451 dbSNP
rs893465937 3485 dbSNP
rs1276689355 3493 dbSNP
rs1055017668 3503 dbSNP
rs531568182 3506 dbSNP
rs1286206825 3513 dbSNP
rs1046243415 3519 dbSNP
rs368874609 3524 dbSNP
rs1298339563 3525 dbSNP
rs1345025254 3527 dbSNP
rs1370451855 3528 dbSNP
rs940100140 3532 dbSNP
rs1443381428 3541 dbSNP
rs560960110 3546 dbSNP
rs1235395362 3562 dbSNP
rs1304530259 3586 dbSNP
rs1324140924 3589 dbSNP
rs1186665624 3591 dbSNP
rs1391467418 3592 dbSNP
rs1447635810 3593 dbSNP
rs1436958524 3597 dbSNP
rs1167850502 3606 dbSNP
rs1395571292 3608 dbSNP
rs1415984877 3610 dbSNP
rs138055631 3611 dbSNP
rs1158166067 3614 dbSNP
rs1447571240 3616 dbSNP
rs1398846288 3620 dbSNP
rs1226218046 3622 dbSNP
rs984612951 3625 dbSNP
rs1346248893 3631 dbSNP
rs1427265691 3641 dbSNP
rs1276932317 3642 dbSNP
rs1311319261 3646 dbSNP
rs1172641517 3649 dbSNP
rs1208933992 3658 dbSNP
rs1249400934 3659 dbSNP
rs1463177571 3665 dbSNP
rs150375377 3667 dbSNP
rs189749423 3668 dbSNP
rs1478934601 3670 dbSNP
rs6142634 3674 dbSNP
rs369496927 3694 dbSNP
rs1466489157 3700 dbSNP
rs1414156984 3702 dbSNP
rs774926372 3703 dbSNP
rs1160215199 3704 dbSNP
rs745963684 3718 dbSNP
rs1391060476 3724 dbSNP
rs975637300 3730 dbSNP
rs542102775 3736 dbSNP
rs761787076 3744 dbSNP
rs745538068 3750 dbSNP
rs778047619 3774 dbSNP
rs1439217696 3788 dbSNP
rs1273484465 3791 dbSNP
rs1367318066 3800 dbSNP
rs1229341349 3801 dbSNP
rs1269662904 3815 dbSNP
rs1326559830 3816 dbSNP
rs1289951970 3819 dbSNP
rs565178063 3819 dbSNP
rs184828421 3822 dbSNP
rs1020662606 3836 dbSNP
rs1245956672 3857 dbSNP
rs1472816123 3861 dbSNP
rs1183999818 3863 dbSNP
rs1414488003 3870 dbSNP
rs1455833281 3872 dbSNP
rs1347283967 3894 dbSNP
rs140407443 3896 dbSNP
rs1230855055 3901 dbSNP
rs1322172591 3902 dbSNP
rs1330990520 3902 dbSNP
rs772567488 3903 dbSNP
rs1432704720 3904 dbSNP
rs1033785666 3909 dbSNP
rs1227391804 3912 dbSNP
rs772460246 3913 dbSNP
rs148189266 3914 dbSNP
rs1357820794 3931 dbSNP
rs1207515319 3938 dbSNP
rs544341445 3943 dbSNP
rs1288067764 3949 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*