miRTarBase - #MIRT023336 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CALU   
Synonyms -
Description calumenin
Transcript NM_001130674   
Other Transcripts NM_001219   
Expression
Putative miRNA Targets on CALU
3'UTR of CALU
(miRNA target sites are highlighted)
>CALU|NM_001130674|3'UTR
   1 GCTACGGAGGAACCCTCATTTCCTCAAAAGTAATTTATTTTTACAGCTTCTGGTTTCACATGAAATTGTTTGCGCTACTG
  81 AGACTGTTACTACAAACTTTTTAAGACATGAAAAGGCGTAATGAAAACCATCCCGTCCCCATTCCTCCTCCTCTCTGAGG
 161 GACTGGAGGGAAGCCGTGCTTCTGAGGAACAACTCTAATTAGTACACTTGTGTTTGTAGATTTACACTTTGTATTATGTA
 241 TTAACATGGCGTGTTTATTTTTGTATTTTTCTCTGGTTGGGAGTATGATATGAAGGATCAAGATCCTCAACTCACACATG
 321 TAGACAAACATTAGCTCTTTACTCTTTCTCAACCCCTTTTATGATTTTAATAATTCTCACTTAACTAATTTTGTAAGCCT
 401 GAGATCAATAAGAAATGTTCAGGAGAGAGGAAAGAAAAAAAATATATGCTCCACAATTTATATTTAGAGAGAGAACACTT
 481 AGTCTTGCCTGTCAAAAAGTCCAACATTTCATAGGTAGTAGGGGCCACATATTACATTCAGTTGCTATAGGTCCAGCAAC
 561 TGAACCTGCCATTACCTGGGCAAGGAAAGATCCCTTTGCTCTAGGAAAGCTTGGCCCAAATTGATTTTCTTCTTTTTCCC
 641 CCTGTAGGACTGACTGTTGGCTAATTTTGTCAAGCACAGCTGTGGTGGGAAGAGTTAGGGCCAGTGTCTTGAAAATCAAT
 721 CAAGTAGTGAATGTGATCTCTTTGCAGAGCTATAGATAGAAACAGCTGGAAAACTAAAGGAAAAATACAAGTGTTTTCGG
 801 GGCATACATTTTTTTTCTGGGTGTGCATCTGTTGAAATGCTCAAGACTTAATTATTTGCCTTTTGAAATCACTGTAAATG
 881 CCCCCATCCGGTTCCTCTTCTTCCCAGGTGTGCCAAGGAATTAATCTTGGTTTCACTACAATTAAAATTCACTCCTTTCC
 961 AATCATGTCATTGAAAGTGCCTTTAACGAAAGAAATGGTCACTGAATGGGAATTCTCTTAAGAAACCCTGAGATTAAAAA
1041 AAGACTATTTGGATAACTTATAGGAAAGCCTAGAACCTCCCAGTAGAGTGGGGATTTTTTTCTTCTTCCCTTTCTCTTTT
1121 GGACAATAGTTAAATTAGCAGTATTAGTTATGAGTTTGGTTGCAGTGTTCTTATCTTGTGGGCTGATTTCCAAAAACCAC
1201 ATGCTGCTGAATTTACCAGGGATCCTCATACCTCACAATGCAAACCACTTACTACCAGGCCTTTTTCTGTGTCCACTGGA
1281 GAGCTTGAGCTCACACTCAAAGATCAGAGGACCTACAGAGAGGGCTCTTTGGTTTGAGGACCATGGCTTACCTTTCCTGC
1361 CTTTGACCCATCACACCCCATTTCCTCCTCTTTCCCTCTCCCCGCTGCCAAAAAAAAAAAAAAAGGAAACGTTTATCATG
1441 AATCAACAGGGTTTCAGTCCTTATCAAAGAGAGATGTGGAAAGAGCTAAAGAAACCACCCTTTGTTCCCAACTCCACTTT
1521 ACCCATATTTTATGCAACACAAACACTGTCCTTTTGGGTCCCTTTCTTACAGATGGACCTCTTGAGAAGAATTATCGTAT
1601 TCCACGTTTTTAGCCCTCAGGTTACCAAGATAAATATATGTATATATAACCTTTATTATTGCTATATCTTTGTGGATAAT
1681 ACATTCAGGTGGTGCTGGGTGATTTATTATAATCTGAACCTAGGTATATCCTTTGGTCTTCCACAGTCATGTTGAGGTGG
1761 GCTCCCTGGTATGGTAAAAAGCCAGGTATAATGTAACTTCACCCCAGCCTTTGTACTAAGCTCTTGATAGTGGATATACT
1841 CTTTTAAGTTTAGCCCCAATATAGGGTAATGGAAATTTCCTGCCCTCTGGGTTCCCCATTTTTACTATTAAGAAGACCAG
1921 TGATAATTTAATAATGCCACCAACTCTGGCTTAGTTAAGTGAGAGTGTGAACTGTGTGGCAAGAGAGCCTCACACCTCAC
2001 TAGGTGCAGAGAGCCCAGGCCTTATGTTAAAATCATGCACTTGAAAAGCAAACCTTAATCTGCAAAGACAGCAGCAAGCA
2081 TTATACGGTCATCTTGAATGATCCCTTTGAAATTTTTTTTTTGTTTGTTTGTTTAAATCAAGCCTGAGGCTGGTGAACAG
2161 TAGCTACACACCCATATTGTGTGTTCTGTGAATGCTAGCTCTCTTGAATTTGGATATTGGTTATTTTTTATAGAGTGTAA
2241 ACCAAGTTTTATATTCTGCAATGCGAACAGGTACCTATCTGTTTCTAAATAAAACTGTTTACATTCATTATGGGGTATGT
2321 ATGACCTTCATTTTCCAAGAAATAGAACTCTAGCTTAGAATTATGGATGCTCTAAAATGTCAGAATGGGAACTCTCCTCG
2401 AAGTTCTCCCAAACTCAGAGACAGCACTGCCTTCTCCTAAATGATTATTCTTTTCTCCCTGTTTTCTGGTATTTTCTAGC
2481 ATCCTTCTCACCACAGCCATAACCCTTTTTTACTTCCATTAGGCCGTATAACTGGAGAGACCTGCTGCTCGTTATATAAT
2561 TATCTGATACCAAACACAAGCGATTCTGAATGTACACACACGTTTATCTATAGAGCATAAGGTAAAACAATTTTGTTTAA
2641 CATTTTGGTATTGTTTACAAATGTTATTAAAACATGCAAATTCATTTTGAGAACCTCGAGAGAATTAAACTATTAACTTT
2721 AGTAAACACACAGTTTAAGACAAATATAAAGGTTTAGCCAAATGCAACGGGGAGGAAGCACCTGGAATAATTTGTGCTTG
2801 CTCAGGGGCTTGTGGACATGGCTGTTCCTGCCAAAGCTGTAGCAGTTATCCAAAAGTTCTTTCAAACTCATATTTGGGGC
2881 CACTGAGTTTTTTTTGTTTTTTTTTTTGTTTTGTTTTGTTTTTTCTTTATGTCTCTCCCATTTCTAAAGTGTTTTCTTAA
2961 GTTTGTTCTAATTCAGCATATATCATCTCAGAATGGATCCCCAGCAGGAAAAAAAAAAAAAGTTACTAAAAAGGAAAGTA
3041 TCCATACACTGAAAACTTAAAGCATATTCCTTTTTGGTTGCCTTGTATGTAGAAATCAGTTCTCCAAGTGCTGTGAATGG
3121 TGCCACTTAGGAGTAGAAACTGATGATTGTTGAAATGGCCTTTGGGTGGTCTGAAATAGACCAGTGGAAACAGTAGCTTT
3201 GTAGGCAAGAAGGCAATAGTAAGAAAATGAAAAATTGACTCCCCAAACTGCCATCACTCCTTTTACCATCTTTTTTGTGT
3281 TTTTAGTAGTTTGGTTTCTGACGGAGACAATAGAAACTTACTTAAAAGTAAAATTTAATTCTAGCTGTTGCAAACAGGCC
3361 AATATTGGGTCCTCAGTTGGGGCCAACTTGGGTAGACGAGACAGTAGAAACTTCTGTTTTCTGGGAGCTGCATGTGTCGG
3441 ATTCATCTGTCATGGCCTTCCCACACACCATCTTCATGATGCAAGCTTGGAACTGGAGAGAAAGGTACAATTGGAGATAA
3521 CCTTGGCAGATGAGGAAGTATGGGAAAAAAGACCTTATTCTCTGTATCACCAAAGCCTTGCACAATGCTTTGTACCCAGA
3601 ATGCCCTTAGGTGGTTTTGAATCTATCTTCCCCATCCTGAAAACTATCTAGATTCCAGTCTAGAACTACTCCTGGGTCTA
3681 CGGTAATCCTAAACTGGTCAAGTCTGAGACCTCACTGTTGGTAAATTCACAAACCATCCTGCTTCATAAAAGCACTGTCA
3761 GCAGAGGCCCCTCCATTACTAGCAGGTGCTCCCAGCTGGAAAGGACTGCCAATTCTCTTCTATCCAGGGAGGTTTCAAAT
3841 TAGTTTTGAGTCTACCTCTGGGATTGAGGAAACAATACCATCTGAAAGTAGGGTTTTTGCCACTTAGGGTTTGGTGTTTA
3921 TTAGCTCGGATTTCAGATGGGATAGGAAATCCCCCAGTACCTTCAGATGATAAGATATTTTAGAGATTTTTGCATGTGGT
4001 ATGATTTCTGTGCTTCACACATGCTCGTGCAGGCTAAAAGTTGGAAGGGAAATGATTAAGAAATTATTAAATGCAAGGAC
4081 TGAAAATTGAGAGGAATCTGAGTTTTTATTTTTATTTTTTTAATTTTATTTAAGTTCCAGGATACATGTGCAGGATGTGC
4161 AGGTTTGTTACATAGGTAAACGTGTGCCATGGTGGTTTGCTGCACGAGTTTTTCAATAAAATGCTTTCATTCATCCTGTT
4241 CTTTGGAGCAACTTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC---AGUGUGAGgu 5'
            :| | | |||   ||||||||  
Target 5' tgGAGAGC-TTGAGCTCACACTCaa 3'
1277 - 1300 135.00 -11.80
2
miRNA  3' guuuGUGGUAAC-----AGUGUGAGGu 5'
              ::|| |||     |||||| || 
Target 5' ttccTGCCTTTGACCCATCACACCCCa 3'
1354 - 1380 126.00 -14.50
3
miRNA  3' guUUGUGG----UAACAGU-GUGAGGu 5'
            :|| ||    | || || |||||| 
Target 5' ttGACTCCCCAAACTGCCATCACTCCt 3'
3235 - 3261 126.00 -16.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1167587 3398 ClinVar
1116696 3404 ClinVar
852775 3405 ClinVar
1036080 3408 ClinVar
1130650 3416 ClinVar
1077815 3434 ClinVar
836919 3436 ClinVar
1160419 3440 ClinVar
858901 3480 ClinVar
1121794 3501 ClinVar
1130035 3503 ClinVar
COSN2200971 4 COSMIC
COSN168196 5 COSMIC
COSN32059420 7 COSMIC
COSN30463003 10 COSMIC
COSN30462928 11 COSMIC
COSN30506433 19 COSMIC
COSN20087166 30 COSMIC
COSN30167281 51 COSMIC
COSN31581268 119 COSMIC
COSN29856453 777 COSMIC
COSN28720993 805 COSMIC
COSN31596623 834 COSMIC
COSN31607731 891 COSMIC
COSN28763192 988 COSMIC
COSN26465379 1005 COSMIC
COSN8515396 1017 COSMIC
COSN4921125 1097 COSMIC
COSN20104764 1425 COSMIC
COSN15200878 1466 COSMIC
COSN17182179 1522 COSMIC
COSN28758838 1536 COSMIC
COSN21516741 1567 COSMIC
COSN23347054 1596 COSMIC
COSN21516083 1619 COSMIC
COSN31565028 1649 COSMIC
COSN26602690 1834 COSMIC
COSN5647634 1926 COSMIC
COSN29461256 2124 COSMIC
COSN31516215 2126 COSMIC
COSN1342353 2254 COSMIC
COSM744636 3380 COSMIC
COSM3877950 3398 COSMIC
COSM9885412 3405 COSMIC
COSM6245040 3417 COSMIC
COSM9087788 3431 COSMIC
COSM1447908 3439 COSMIC
COSM7840896 3441 COSMIC
COSM1218474 3460 COSMIC
COSM163089 3473 COSMIC
COSM3831830 3473 COSMIC
COSN18731771 3648 COSMIC
COSN7959550 3929 COSMIC
COSN19467924 4058 COSMIC
COSN20720845 4168 COSMIC
rs1043595 792 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs11545531 1 dbSNP
rs1043550 5 dbSNP
rs542402496 6 dbSNP
rs757119279 7 dbSNP
rs748650579 12 dbSNP
rs746162690 15 dbSNP
rs756419950 17 dbSNP
rs780217565 19 dbSNP
rs1171207756 20 dbSNP
rs749411084 38 dbSNP
rs772603098 38 dbSNP
rs1401000395 40 dbSNP
rs1297170389 43 dbSNP
rs1008631429 59 dbSNP
rs1313802011 61 dbSNP
rs760700810 63 dbSNP
rs1428358889 71 dbSNP
rs1043168590 74 dbSNP
rs750840024 78 dbSNP
rs924710135 84 dbSNP
rs1390175793 85 dbSNP
rs1435922194 87 dbSNP
rs1452922446 89 dbSNP
rs183512762 91 dbSNP
rs934734528 92 dbSNP
rs575644561 96 dbSNP
rs1421819299 97 dbSNP
rs1432900055 98 dbSNP
rs901137038 98 dbSNP
rs1183189091 101 dbSNP
rs756414740 109 dbSNP
rs1364272503 113 dbSNP
rs996806876 114 dbSNP
rs545884540 118 dbSNP
rs888316205 119 dbSNP
rs1266536476 121 dbSNP
rs920810519 122 dbSNP
rs1005780123 123 dbSNP
rs1015397444 124 dbSNP
rs1357704799 133 dbSNP
rs961426022 135 dbSNP
rs908029347 136 dbSNP
rs1339847949 138 dbSNP
rs1366780438 145 dbSNP
rs1292735439 148 dbSNP
rs1224619762 154 dbSNP
rs1381592142 155 dbSNP
rs939461462 160 dbSNP
rs1290573670 161 dbSNP
rs1422555932 163 dbSNP
rs1056536278 164 dbSNP
rs916605081 172 dbSNP
rs948008621 176 dbSNP
rs1218654295 177 dbSNP
rs1191196988 180 dbSNP
rs1243377815 181 dbSNP
rs1003254959 185 dbSNP
rs1044344376 189 dbSNP
rs1449645291 193 dbSNP
rs1187591761 196 dbSNP
rs1489968388 196 dbSNP
rs1205436143 200 dbSNP
rs1343783196 220 dbSNP
rs116822773 228 dbSNP
rs537258411 229 dbSNP
rs1331149177 231 dbSNP
rs1165494965 246 dbSNP
rs1402968820 247 dbSNP
rs1344667729 249 dbSNP
rs991728295 251 dbSNP
rs916143378 252 dbSNP
rs1398997742 254 dbSNP
rs1166343987 258 dbSNP
rs968975498 259 dbSNP
rs1378225899 267 dbSNP
rs1321630685 272 dbSNP
rs1390957268 275 dbSNP
rs1479705557 278 dbSNP
rs979353176 286 dbSNP
rs1009081821 292 dbSNP
rs1320215660 297 dbSNP
rs1248026721 301 dbSNP
rs924771989 311 dbSNP
rs1362748522 312 dbSNP
rs1221612644 313 dbSNP
rs964353056 316 dbSNP
rs185226621 320 dbSNP
rs995760141 331 dbSNP
rs934746505 333 dbSNP
rs1288907462 336 dbSNP
rs1247819586 357 dbSNP
rs11653 360 dbSNP
rs1355503773 362 dbSNP
rs922632015 364 dbSNP
rs932627238 371 dbSNP
rs755116292 373 dbSNP
rs545230900 382 dbSNP
rs983708364 387 dbSNP
rs559205753 389 dbSNP
rs1245875293 390 dbSNP
rs888373729 409 dbSNP
rs1801995 418 dbSNP
rs1429284344 421 dbSNP
rs1160512960 423 dbSNP
rs1471388974 424 dbSNP
rs1005432840 425 dbSNP
rs1189975820 426 dbSNP
rs1238449246 430 dbSNP
rs1472730585 431 dbSNP
rs960883169 435 dbSNP
rs992258621 435 dbSNP
rs1037274128 436 dbSNP
rs529888427 447 dbSNP
rs1268752090 448 dbSNP
rs1230102148 451 dbSNP
rs1348316537 456 dbSNP
rs1801994 468 dbSNP
rs1278670288 483 dbSNP
rs754227883 486 dbSNP
rs1341356935 489 dbSNP
rs548318829 492 dbSNP
rs1338937629 496 dbSNP
rs1457886871 506 dbSNP
rs925293345 519 dbSNP
rs1158532955 525 dbSNP
rs935937704 533 dbSNP
rs1053018057 538 dbSNP
rs1383264392 546 dbSNP
rs1034716576 548 dbSNP
rs1386752097 553 dbSNP
rs974446248 553 dbSNP
rs376276417 556 dbSNP
rs1181350447 559 dbSNP
rs1443509108 560 dbSNP
rs914866234 565 dbSNP
rs1248062430 570 dbSNP
rs959053869 572 dbSNP
rs1011884553 577 dbSNP
rs1021889451 582 dbSNP
rs1445153655 585 dbSNP
rs1283462161 592 dbSNP
rs1210277996 596 dbSNP
rs1358161017 600 dbSNP
rs779081559 602 dbSNP
rs900300743 612 dbSNP
rs145125201 614 dbSNP
rs1433515828 633 dbSNP
rs1027306853 638 dbSNP
rs138943011 640 dbSNP
rs1005567380 642 dbSNP
rs956225037 643 dbSNP
rs1227183917 645 dbSNP
rs976863403 647 dbSNP
rs922664257 649 dbSNP
rs961170110 651 dbSNP
rs932700695 653 dbSNP
rs1474137253 657 dbSNP
rs551909537 660 dbSNP
rs149442178 662 dbSNP
rs41274230 670 dbSNP
rs1220539044 672 dbSNP
rs1358920354 675 dbSNP
rs925293935 678 dbSNP
rs1216447386 686 dbSNP
rs935317482 691 dbSNP
rs989141641 706 dbSNP
rs1270156112 708 dbSNP
rs550012024 714 dbSNP
rs572511367 720 dbSNP
rs1036943278 724 dbSNP
rs944624674 739 dbSNP
rs1370859579 750 dbSNP
rs1040219773 751 dbSNP
rs1254519447 755 dbSNP
rs1407760030 759 dbSNP
rs11545534 765 dbSNP
rs897006846 770 dbSNP
rs553746157 786 dbSNP
rs1043595 792 dbSNP
rs1266522340 797 dbSNP
rs1409877299 799 dbSNP
rs1483256609 800 dbSNP
rs1208057137 808 dbSNP
rs1048776729 809 dbSNP
rs1305873325 809 dbSNP
rs1272296675 814 dbSNP
rs1467752240 818 dbSNP
rs535671195 827 dbSNP
rs1326354883 829 dbSNP
rs1011918844 836 dbSNP
rs751679870 839 dbSNP
rs769562900 846 dbSNP
rs1299548194 847 dbSNP
rs339042 851 dbSNP
rs903518569 855 dbSNP
rs1470660919 859 dbSNP
rs1013830934 860 dbSNP
rs1175593788 861 dbSNP
rs1023830242 878 dbSNP
rs969519498 882 dbSNP
rs148087928 887 dbSNP
rs1031910238 890 dbSNP
rs375432304 891 dbSNP
rs1285857993 894 dbSNP
rs1332370133 896 dbSNP
rs1336090951 912 dbSNP
rs1462688003 940 dbSNP
rs1233483083 941 dbSNP
rs976937238 963 dbSNP
rs1203533956 969 dbSNP
rs191113826 970 dbSNP
rs116878240 972 dbSNP
rs1342451536 975 dbSNP
rs1309519757 982 dbSNP
rs1199019391 985 dbSNP
rs1372226350 987 dbSNP
rs773873112 988 dbSNP
rs1277245692 989 dbSNP
rs1454152460 995 dbSNP
rs572934824 1004 dbSNP
rs941356360 1009 dbSNP
rs1457645075 1017 dbSNP
rs988198271 1018 dbSNP
rs182826791 1028 dbSNP
rs540223106 1034 dbSNP
rs559226411 1035 dbSNP
rs188295181 1040 dbSNP
rs1407584758 1044 dbSNP
rs761198325 1047 dbSNP
rs1446543465 1049 dbSNP
rs912547215 1052 dbSNP
rs939240504 1058 dbSNP
rs143898751 1062 dbSNP
rs1486444030 1087 dbSNP
rs1263003839 1095 dbSNP
rs12984 1102 dbSNP
rs894945022 1109 dbSNP
rs1214175036 1111 dbSNP
rs1377226261 1127 dbSNP
rs563471786 1128 dbSNP
rs1292083993 1137 dbSNP
rs1801996 1148 dbSNP
rs1477165127 1155 dbSNP
rs975954021 1168 dbSNP
rs147276629 1189 dbSNP
rs921786451 1202 dbSNP
rs1043477686 1219 dbSNP
rs903545451 1220 dbSNP
rs192800780 1236 dbSNP
rs879673514 1242 dbSNP
rs1392260876 1247 dbSNP
rs1386786987 1253 dbSNP
rs1164482115 1262 dbSNP
rs908924379 1270 dbSNP
rs940434276 1276 dbSNP
rs1036055275 1285 dbSNP
rs796566560 1291 dbSNP
rs1185264193 1296 dbSNP
rs1485765235 1299 dbSNP
rs1269967570 1300 dbSNP
rs772686249 1303 dbSNP
rs1356902238 1307 dbSNP
rs1290579146 1309 dbSNP
rs1230185059 1313 dbSNP
rs892066448 1339 dbSNP
rs1227574145 1341 dbSNP
rs1308729113 1353 dbSNP
rs1045312817 1354 dbSNP
rs1345914490 1356 dbSNP
rs905368807 1360 dbSNP
rs773580445 1362 dbSNP
rs1364019571 1372 dbSNP
rs1162858295 1375 dbSNP
rs978281746 1376 dbSNP
rs564158343 1386 dbSNP
rs923685553 1387 dbSNP
rs939171294 1390 dbSNP
rs8899 1394 dbSNP
rs1032919913 1395 dbSNP
rs1056278060 1398 dbSNP
rs916515055 1400 dbSNP
rs1202135212 1402 dbSNP
rs758873681 1403 dbSNP
rs1489763001 1404 dbSNP
rs368736970 1405 dbSNP
rs1210441210 1407 dbSNP
rs1195973844 1408 dbSNP
rs1481344667 1408 dbSNP
rs1226616672 1410 dbSNP
rs1392114359 1410 dbSNP
rs1398745239 1410 dbSNP
rs35355395 1410 dbSNP
rs956847238 1410 dbSNP
rs62479592 1411 dbSNP
rs370251766 1414 dbSNP
rs1019636104 1415 dbSNP
rs1430667276 1421 dbSNP
rs1029875365 1422 dbSNP
rs1450038421 1426 dbSNP
rs965327086 1427 dbSNP
rs1390529743 1431 dbSNP
rs954184947 1432 dbSNP
rs1007415112 1439 dbSNP
rs6949995 1459 dbSNP
rs1016999624 1460 dbSNP
rs1370048112 1474 dbSNP
rs975986947 1478 dbSNP
rs1458373711 1484 dbSNP
rs1194799823 1487 dbSNP
rs1461352892 1489 dbSNP
rs1292384960 1495 dbSNP
rs963092130 1497 dbSNP
rs1388009979 1499 dbSNP
rs1201636030 1501 dbSNP
rs1322566374 1505 dbSNP
rs1279860826 1508 dbSNP
rs182860656 1510 dbSNP
rs568672290 1512 dbSNP
rs1337826030 1515 dbSNP
rs1305099563 1518 dbSNP
rs953218014 1520 dbSNP
rs4566976 1521 dbSNP
rs960616703 1522 dbSNP
rs745537897 1531 dbSNP
rs992036672 1539 dbSNP
rs1159563558 1555 dbSNP
rs1293887988 1558 dbSNP
rs1323990172 1559 dbSNP
rs1251562866 1570 dbSNP
rs1361745587 1576 dbSNP
rs916452279 1582 dbSNP
rs940474120 1595 dbSNP
rs150783498 1596 dbSNP
rs1244399699 1597 dbSNP
rs766786549 1598 dbSNP
rs187489274 1604 dbSNP
rs1043890480 1606 dbSNP
rs1036496305 1614 dbSNP
rs925076148 1626 dbSNP
rs148562448 1627 dbSNP
rs935047361 1629 dbSNP
rs1259212198 1631 dbSNP
rs1239648397 1632 dbSNP
rs1383619382 1635 dbSNP
rs1317174817 1639 dbSNP
rs1319520532 1641 dbSNP
rs1340464739 1641 dbSNP
rs1402857916 1645 dbSNP
rs1248946765 1647 dbSNP
rs1157708942 1651 dbSNP
rs539629394 1656 dbSNP
rs1386696563 1657 dbSNP
rs1161204013 1660 dbSNP
rs1472161082 1671 dbSNP
rs1242686053 1676 dbSNP
rs755627384 1681 dbSNP
rs34448193 1686 dbSNP
rs1445101178 1688 dbSNP
rs1045343178 1689 dbSNP
rs1216175729 1690 dbSNP
rs139193450 1708 dbSNP
rs149959220 1711 dbSNP
rs1360508125 1717 dbSNP
rs1294206894 1719 dbSNP
rs1186392548 1727 dbSNP
rs549257472 1730 dbSNP
rs901505272 1733 dbSNP
rs144879508 1735 dbSNP
rs867040671 1737 dbSNP
rs1366195437 1738 dbSNP
rs41274233 1744 dbSNP
rs1007074808 1751 dbSNP
rs1367095194 1763 dbSNP
rs1387372280 1765 dbSNP
rs574665286 1770 dbSNP
rs12536765 1782 dbSNP
rs6954415 1788 dbSNP
rs1287438858 1790 dbSNP
rs1381863315 1791 dbSNP
rs1019629115 1798 dbSNP
rs962833450 1801 dbSNP
rs765260789 1802 dbSNP
rs994621125 1805 dbSNP
rs1474354075 1806 dbSNP
rs965359832 1812 dbSNP
rs1199961652 1815 dbSNP
rs1490769408 1816 dbSNP
rs1271382279 1826 dbSNP
rs1219587609 1840 dbSNP
rs1451140285 1845 dbSNP
rs996766551 1853 dbSNP
rs1316668909 1855 dbSNP
rs113619493 1859 dbSNP
rs6972005 1860 dbSNP
rs953331306 1865 dbSNP
rs960689415 1867 dbSNP
rs1347724297 1872 dbSNP
rs1230230091 1883 dbSNP
rs992067737 1883 dbSNP
rs758383067 1884 dbSNP
rs916479852 1892 dbSNP
rs909063587 1897 dbSNP
rs969686872 1899 dbSNP
rs962156402 1908 dbSNP
rs1399504412 1910 dbSNP
rs979302790 1950 dbSNP
rs1213973747 1956 dbSNP
rs1257508405 1960 dbSNP
rs1483492358 1963 dbSNP
rs781245470 1964 dbSNP
rs1426893078 1965 dbSNP
rs192409862 1967 dbSNP
rs1477788500 1980 dbSNP
rs917633931 1989 dbSNP
rs1473534858 1994 dbSNP
rs1456482358 1995 dbSNP
rs755906267 2007 dbSNP
rs1204826526 2022 dbSNP
rs998696276 2022 dbSNP
rs1299575219 2033 dbSNP
rs935133237 2036 dbSNP
rs1052604677 2037 dbSNP
rs1443995151 2054 dbSNP
rs80070830 2058 dbSNP
rs1337345859 2081 dbSNP
rs866649019 2085 dbSNP
rs768618192 2087 dbSNP
rs546015528 2088 dbSNP
rs890052509 2094 dbSNP
rs1175181579 2096 dbSNP
rs1007518423 2103 dbSNP
rs62479593 2111 dbSNP
rs1179119976 2113 dbSNP
rs199936795 2113 dbSNP
rs79642300 2120 dbSNP
rs901306708 2120 dbSNP
rs996880073 2120 dbSNP
rs1028302156 2121 dbSNP
rs3211119 2124 dbSNP
rs1209904811 2126 dbSNP
rs1289040056 2128 dbSNP
rs888419758 2130 dbSNP
rs1349990188 2131 dbSNP
rs1222276366 2132 dbSNP
rs1303750222 2135 dbSNP
rs866283144 2140 dbSNP
rs994299855 2143 dbSNP
rs1016559525 2146 dbSNP
rs1375523526 2156 dbSNP
rs1315066819 2164 dbSNP
rs546636253 2170 dbSNP
rs780427395 2177 dbSNP
rs528519937 2182 dbSNP
rs1302172493 2187 dbSNP
rs1483968524 2192 dbSNP
rs961906018 2193 dbSNP
rs561699616 2194 dbSNP
rs528863815 2197 dbSNP
rs1161564543 2199 dbSNP
rs8597 2202 dbSNP
rs1468217858 2220 dbSNP
rs970493889 2224 dbSNP
rs1164372231 2229 dbSNP
rs1023563851 2231 dbSNP
rs1425369366 2244 dbSNP
rs1254741615 2252 dbSNP
rs1044203 2257 dbSNP
rs980499712 2259 dbSNP
rs1175733580 2262 dbSNP
rs1244127734 2265 dbSNP
rs969341434 2266 dbSNP
rs1374074679 2269 dbSNP
rs1214020159 2274 dbSNP
rs979754256 2278 dbSNP
rs1292013840 2282 dbSNP
rs1432132981 2285 dbSNP
rs1247598614 2290 dbSNP
rs1032208995 2301 dbSNP
rs187496860 2304 dbSNP
rs956732040 2311 dbSNP
rs569441928 2314 dbSNP
rs539691664 2316 dbSNP
rs1399164368 2322 dbSNP
rs987912800 2346 dbSNP
rs1303956856 2347 dbSNP
rs1459528384 2355 dbSNP
rs923031354 2356 dbSNP
rs914103175 2364 dbSNP
rs1429566138 2371 dbSNP
rs1370011294 2384 dbSNP
rs933026629 2386 dbSNP
rs1041232967 2387 dbSNP
rs985799368 2393 dbSNP
rs1269182133 2395 dbSNP
rs1044226 2400 dbSNP
rs192738917 2401 dbSNP
rs943006539 2403 dbSNP
rs932755194 2407 dbSNP
rs1218886994 2411 dbSNP
rs771480184 2413 dbSNP
rs1344095394 2419 dbSNP
rs1217832673 2420 dbSNP
rs1229051286 2426 dbSNP
rs184569676 2432 dbSNP
rs1388671633 2442 dbSNP
rs1388683639 2445 dbSNP
rs1293075713 2448 dbSNP
rs930120042 2458 dbSNP
rs1005924251 2466 dbSNP
rs1436026750 2469 dbSNP
rs557613321 2470 dbSNP
rs1169103706 2476 dbSNP
rs1477718542 2481 dbSNP
rs1430338832 2484 dbSNP
rs199787815 2494 dbSNP
rs76549052 2504 dbSNP
rs1431154345 2506 dbSNP
rs1024838308 2514 dbSNP
rs970526685 2523 dbSNP
rs574011378 2526 dbSNP
rs771448709 2527 dbSNP
rs1197885131 2531 dbSNP
rs777099740 2541 dbSNP
rs537840591 2542 dbSNP
rs1230774123 2549 dbSNP
rs1393650187 2551 dbSNP
rs1032654680 2552 dbSNP
rs1169636860 2555 dbSNP
rs1392060026 2556 dbSNP
rs1419345129 2562 dbSNP
rs1408745705 2569 dbSNP
rs956626048 2571 dbSNP
rs1033813359 2582 dbSNP
rs1350591008 2583 dbSNP
rs957731720 2586 dbSNP
rs369130036 2589 dbSNP
rs1324218762 2593 dbSNP
rs1464835566 2596 dbSNP
rs987983409 2598 dbSNP
rs759945318 2602 dbSNP
rs114872200 2603 dbSNP
rs1235755885 2606 dbSNP
rs1177945334 2611 dbSNP
rs1461756455 2612 dbSNP
rs1264921908 2623 dbSNP
rs752847166 2643 dbSNP
rs1435475696 2647 dbSNP
rs763157452 2649 dbSNP
rs985876234 2651 dbSNP
rs764011519 2662 dbSNP
rs1296611897 2668 dbSNP
rs910254165 2670 dbSNP
rs111484600 2676 dbSNP
rs1230004229 2692 dbSNP
rs1307251290 2693 dbSNP
rs1446127544 2694 dbSNP
rs922783551 2698 dbSNP
rs1336698105 2708 dbSNP
rs546033905 2713 dbSNP
rs932786359 2713 dbSNP
rs1158788331 2721 dbSNP
rs1378083754 2726 dbSNP
rs557953115 2726 dbSNP
rs572998608 2731 dbSNP
rs540359523 2732 dbSNP
rs930199885 2734 dbSNP
rs561614444 2740 dbSNP
rs1241917640 2741 dbSNP
rs1262098330 2745 dbSNP
rs897135784 2748 dbSNP
rs1165551760 2753 dbSNP
rs1284112815 2759 dbSNP
rs896620201 2760 dbSNP
rs1414625626 2764 dbSNP
rs1461043748 2766 dbSNP
rs1046319185 2769 dbSNP
rs528924328 2770 dbSNP
rs567199131 2773 dbSNP
rs1402236344 2776 dbSNP
rs1045542242 2777 dbSNP
rs543861744 2782 dbSNP
rs760895013 2786 dbSNP
rs1424782457 2795 dbSNP
rs1010645390 2803 dbSNP
rs1161406744 2807 dbSNP
rs1324503919 2808 dbSNP
rs1373572335 2817 dbSNP
rs1021065970 2818 dbSNP
rs1450119219 2825 dbSNP
rs966319254 2830 dbSNP
rs1216108953 2835 dbSNP
rs1452256438 2840 dbSNP
rs1227483350 2845 dbSNP
rs1292041280 2850 dbSNP
rs1208121985 2854 dbSNP
rs905215582 2860 dbSNP
rs1271254011 2861 dbSNP
rs1338838738 2866 dbSNP
rs766650499 2866 dbSNP
rs1277186100 2870 dbSNP
rs922816273 2871 dbSNP
rs1031665436 2872 dbSNP
rs985626956 2877 dbSNP
rs1404212620 2881 dbSNP
rs1378364993 2882 dbSNP
rs1172674982 2884 dbSNP
rs1230850351 2887 dbSNP
rs1248665520 2888 dbSNP
rs1286393955 2888 dbSNP
rs1422565162 2888 dbSNP
rs1476739003 2888 dbSNP
rs1478510710 2888 dbSNP
rs201424020 2888 dbSNP
rs1491266747 2889 dbSNP
rs910037881 2889 dbSNP
rs199836652 2890 dbSNP
rs1207769654 2891 dbSNP
rs1451085320 2891 dbSNP
rs1180508217 2892 dbSNP
rs796706020 2892 dbSNP
rs1201000299 2893 dbSNP
rs553708996 2893 dbSNP
rs1220174502 2894 dbSNP
rs1369337389 2894 dbSNP
rs941465658 2894 dbSNP
rs1435163591 2895 dbSNP
rs1688906 2895 dbSNP
rs1053761845 2896 dbSNP
rs369353008 2896 dbSNP
rs536238594 2896 dbSNP
rs1189642485 2897 dbSNP
rs1415927310 2897 dbSNP
rs1427585427 2897 dbSNP
rs1688905 2897 dbSNP
rs763113986 2897 dbSNP
rs1037095751 2898 dbSNP
rs373779393 2898 dbSNP
rs1238500692 2899 dbSNP
rs1238807419 2900 dbSNP
rs1475172328 2901 dbSNP
rs1211328461 2902 dbSNP
rs886484839 2902 dbSNP
rs918596435 2902 dbSNP
rs1314262560 2903 dbSNP
rs1218212465 2904 dbSNP
rs1353810697 2904 dbSNP
rs533412722 2904 dbSNP
rs1185853271 2905 dbSNP
rs1443926260 2906 dbSNP
rs567056336 2906 dbSNP
rs747271530 2906 dbSNP
rs760006990 2906 dbSNP
rs1457934240 2907 dbSNP
rs535320358 2907 dbSNP
rs767050270 2907 dbSNP
rs1449979808 2908 dbSNP
rs58253064 2908 dbSNP
rs1160576814 2909 dbSNP
rs1381149153 2909 dbSNP
rs1437884441 2909 dbSNP
rs2402937 2909 dbSNP
rs7792925 2910 dbSNP
rs1046350049 2911 dbSNP
rs1158276411 2912 dbSNP
rs565571318 2913 dbSNP
rs62479594 2914 dbSNP
rs906490405 2914 dbSNP
rs1415900103 2917 dbSNP
rs1334569366 2918 dbSNP
rs965006208 2919 dbSNP
rs1002114779 2922 dbSNP
rs1289656027 2923 dbSNP
rs1350615685 2926 dbSNP
rs1227396532 2930 dbSNP
rs1277472340 2932 dbSNP
rs1346704261 2934 dbSNP
rs1313386547 2936 dbSNP
rs1202478216 2956 dbSNP
rs1229894576 2957 dbSNP
rs1279824059 2962 dbSNP
rs1302115574 2966 dbSNP
rs1400351136 2978 dbSNP
rs1361471157 2979 dbSNP
rs1485605632 2985 dbSNP
rs1417975994 2992 dbSNP
rs1055399682 2995 dbSNP
rs1166122112 2997 dbSNP
rs893624857 2998 dbSNP
rs1412262809 3001 dbSNP
rs1209401534 3005 dbSNP
rs1181682102 3006 dbSNP
rs1254060017 3007 dbSNP
rs1478341633 3007 dbSNP
rs1472991138 3008 dbSNP
rs1223121251 3009 dbSNP
rs200681363 3009 dbSNP
rs397748997 3009 dbSNP
rs534495056 3009 dbSNP
rs1311889439 3010 dbSNP
rs36090779 3010 dbSNP
rs1219032016 3018 dbSNP
rs892382986 3025 dbSNP
rs1181191965 3028 dbSNP
rs1280338545 3035 dbSNP
rs1398317142 3036 dbSNP
rs1362207663 3045 dbSNP
rs1384514044 3049 dbSNP
rs1294265332 3051 dbSNP
rs1009445760 3061 dbSNP
rs1479145904 3063 dbSNP
rs566674140 3065 dbSNP
rs1348700092 3069 dbSNP
rs1164775570 3076 dbSNP
rs1394303506 3077 dbSNP
rs1432751290 3078 dbSNP
rs954520767 3079 dbSNP
rs1007346947 3081 dbSNP
rs1370624570 3082 dbSNP
rs1390257452 3083 dbSNP
rs1326289965 3086 dbSNP
rs1332427882 3092 dbSNP
rs1192475420 3093 dbSNP
rs181395003 3096 dbSNP
rs1017755707 3108 dbSNP
rs1487189621 3113 dbSNP
rs1233554778 3118 dbSNP
rs963137310 3126 dbSNP
rs1199115515 3138 dbSNP
rs1304580633 3144 dbSNP
rs549495079 3160 dbSNP
rs567648628 3163 dbSNP
rs1217785636 3167 dbSNP
rs552655829 3170 dbSNP
rs1302222245 3183 dbSNP
rs1388619014 3185 dbSNP
rs1365530616 3213 dbSNP
rs997844792 3220 dbSNP
rs1029275642 3230 dbSNP
rs1232721266 3240 dbSNP
rs1169037555 3244 dbSNP
rs982994363 3247 dbSNP
rs747692132 3252 dbSNP
rs1377863847 3257 dbSNP
rs572974798 3268 dbSNP
rs777103121 3270 dbSNP
rs1195261268 3271 dbSNP
rs985711425 3271 dbSNP
rs949534641 3278 dbSNP
rs1045209880 3279 dbSNP
rs556241656 3286 dbSNP
rs569192851 3289 dbSNP
rs1394248426 3294 dbSNP
rs1197835815 3308 dbSNP
rs1345396513 3310 dbSNP
rs926710590 3312 dbSNP
rs759581967 3317 dbSNP
rs766373331 3320 dbSNP
rs1407999379 3323 dbSNP
rs773423213 3324 dbSNP
rs918636307 3334 dbSNP
rs1406268333 3336 dbSNP
rs769238341 3339 dbSNP
rs1330454745 3341 dbSNP
rs775045727 3342 dbSNP
rs1262328678 3343 dbSNP
rs748430460 3347 dbSNP
rs981477585 3348 dbSNP
rs1302844693 3352 dbSNP
rs1335956271 3353 dbSNP
rs1379824951 3356 dbSNP
rs1217670344 3358 dbSNP
rs1285549649 3360 dbSNP
rs371632717 3363 dbSNP
rs1201718523 3364 dbSNP
rs747346814 3367 dbSNP
rs771228886 3371 dbSNP
rs772553185 3373 dbSNP
rs776133013 3378 dbSNP
rs759166292 3385 dbSNP
rs747624901 3394 dbSNP
rs140568559 3398 dbSNP
rs558064192 3399 dbSNP
rs1426092236 3400 dbSNP
rs1464280173 3402 dbSNP
rs1303243754 3403 dbSNP
rs1389369635 3404 dbSNP
rs376418066 3408 dbSNP
rs763991421 3411 dbSNP
rs1336176040 3416 dbSNP
rs1239181192 3423 dbSNP
rs1315875835 3424 dbSNP
rs1306753275 3425 dbSNP
rs1351782596 3426 dbSNP
rs1224995349 3427 dbSNP
rs753174022 3429 dbSNP
rs150426624 3433 dbSNP
rs374287355 3434 dbSNP
rs1208633947 3435 dbSNP
rs750190072 3436 dbSNP
rs545093905 3439 dbSNP
rs368257791 3440 dbSNP
rs780447000 3448 dbSNP
rs753945979 3451 dbSNP
rs755147227 3452 dbSNP
rs1367423732 3461 dbSNP
rs1455912387 3465 dbSNP
rs946529537 3466 dbSNP
rs779283336 3471 dbSNP
rs143205154 3472 dbSNP
rs1240992962 3473 dbSNP
rs1329058691 3478 dbSNP
rs201497890 3480 dbSNP
rs778128511 3486 dbSNP
rs371754125 3487 dbSNP
rs540420837 3489 dbSNP
rs200091747 3490 dbSNP
rs1054197675 3491 dbSNP
rs771601968 3494 dbSNP
rs892468343 3498 dbSNP
rs374687514 3501 dbSNP
rs768216743 3503 dbSNP
rs777251068 3508 dbSNP
rs367791096 3511 dbSNP
rs1236804194 3512 dbSNP
rs761743897 3519 dbSNP
rs767387479 3520 dbSNP
rs371641480 3525 dbSNP
rs1051668886 3537 dbSNP
rs184461423 3539 dbSNP
rs1029306637 3549 dbSNP
rs1007417450 3555 dbSNP
rs1473119037 3570 dbSNP
rs1370114333 3572 dbSNP
rs1467319715 3577 dbSNP
rs12112071 3586 dbSNP
rs544210051 3595 dbSNP
rs1017152521 3598 dbSNP
rs963468545 3602 dbSNP
rs558800220 3603 dbSNP
rs1369694353 3613 dbSNP
rs1457912915 3615 dbSNP
rs994559503 3620 dbSNP
rs575492398 3624 dbSNP
rs972966718 3626 dbSNP
rs752037361 3633 dbSNP
rs1026440721 3634 dbSNP
rs1337946540 3637 dbSNP
rs950373249 3638 dbSNP
rs1405413794 3644 dbSNP
rs1025811761 3647 dbSNP
rs562316580 3648 dbSNP
rs755815438 3663 dbSNP
rs770046613 3670 dbSNP
rs779623213 3671 dbSNP
rs1363153400 3677 dbSNP
rs1423995963 3680 dbSNP
rs1382143104 3682 dbSNP
rs1478961191 3692 dbSNP
rs1240540694 3704 dbSNP
rs1294142182 3705 dbSNP
rs1452207884 3705 dbSNP
rs1292683810 3711 dbSNP
rs1212295545 3712 dbSNP
rs1334627046 3714 dbSNP
rs1259177500 3720 dbSNP
rs918185091 3723 dbSNP
rs1315724633 3728 dbSNP
rs764287739 3736 dbSNP
rs981508849 3741 dbSNP
rs1332252487 3760 dbSNP
rs1868774 3762 dbSNP
rs1332898152 3767 dbSNP
rs926772265 3771 dbSNP
rs1181984863 3774 dbSNP
rs1400934316 3775 dbSNP
rs1172601489 3780 dbSNP
rs113569143 3781 dbSNP
rs545326925 3789 dbSNP
rs991143850 3794 dbSNP
rs1261066788 3810 dbSNP
rs372058528 3813 dbSNP
rs1485462569 3817 dbSNP
rs561231344 3818 dbSNP
rs1053866380 3822 dbSNP
rs560402413 3823 dbSNP
rs1184569362 3825 dbSNP
rs1258113518 3842 dbSNP
rs1271857705 3850 dbSNP
rs1219386821 3853 dbSNP
rs527925248 3860 dbSNP
rs1186555825 3861 dbSNP
rs902336163 3863 dbSNP
rs552779996 3865 dbSNP
rs570956146 3874 dbSNP
rs889458779 3875 dbSNP
rs1444350900 3877 dbSNP
rs1353640447 3878 dbSNP
rs1051744572 3881 dbSNP
rs890391366 3884 dbSNP
rs1159519578 3887 dbSNP
rs943269594 3903 dbSNP
rs1017010080 3905 dbSNP
rs1039284074 3908 dbSNP
rs898997484 3909 dbSNP
rs754481273 3927 dbSNP
rs898783225 3928 dbSNP
rs1453410563 3929 dbSNP
rs200879306 3937 dbSNP
rs1250060539 3945 dbSNP
rs146689090 3949 dbSNP
rs1415968241 3955 dbSNP
rs1443824859 3957 dbSNP
rs1277718562 3958 dbSNP
rs1209553908 3961 dbSNP
rs778864031 3963 dbSNP
rs748052675 3964 dbSNP
rs1353691447 3975 dbSNP
rs531679811 3979 dbSNP
rs971535232 3994 dbSNP
rs1316572513 4000 dbSNP
rs761859824 4004 dbSNP
rs886163971 4009 dbSNP
rs1449918988 4015 dbSNP
rs1002973888 4018 dbSNP
rs117607581 4027 dbSNP
rs959037998 4028 dbSNP
rs1023889275 4037 dbSNP
rs189168873 4038 dbSNP
rs543011966 4041 dbSNP
rs1254758654 4043 dbSNP
rs1483788657 4047 dbSNP
rs970956245 4049 dbSNP
rs968015469 4063 dbSNP
rs1473948973 4073 dbSNP
rs116699212 4088 dbSNP
rs1186702195 4089 dbSNP
rs1034297456 4091 dbSNP
rs567527479 4092 dbSNP
rs1488341131 4099 dbSNP
rs1287616541 4103 dbSNP
rs551741211 4106 dbSNP
rs566770860 4107 dbSNP
rs958218193 4113 dbSNP
rs923789160 4115 dbSNP
rs1229845308 4116 dbSNP
rs1353257377 4121 dbSNP
rs865904747 4122 dbSNP
rs1379770030 4123 dbSNP
rs1341354989 4127 dbSNP
rs181833432 4129 dbSNP
rs1312862913 4140 dbSNP
rs945414933 4151 dbSNP
rs1411678271 4157 dbSNP
rs911014417 4160 dbSNP
rs987479796 4161 dbSNP
rs1159633203 4163 dbSNP
rs1038070219 4170 dbSNP
rs1416072539 4170 dbSNP
rs911858679 4180 dbSNP
rs1187669065 4182 dbSNP
rs943322435 4183 dbSNP
rs1264842990 4184 dbSNP
rs1038943956 4188 dbSNP
rs1485232656 4190 dbSNP
rs753772247 4195 dbSNP
rs1222325216 4196 dbSNP
rs1247250965 4202 dbSNP
rs1223598265 4205 dbSNP
rs899016738 4206 dbSNP
rs930510002 4207 dbSNP
rs1348397895 4217 dbSNP
rs1218980603 4225 dbSNP
rs555231478 4234 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Yang F; Zhang L; Wang F; Wang Y; Huo XS; et al.
- Neoplasia (New York, N.Y.), 2011
The loss of microRNA-122 (miR-122) expression correlates to many characteristic properties of hepatocellular carcinoma (HCC) cells, including clonogenic survival, anchorage-independent growth, migration, invasion, epithelial-mesenchymal transition, and tumorigenesis. However, all of these findings do not sufficiently explain the oncogenic potential of miR-122. In the current study, we used two-dimensional differential in-gel electrophoresis to measure changes in the expression of thousands of proteins in response to the inhibition of miR-122 in human hepatoma cells. Several proteins that were upregulated on miR-122 inhibition were involved in the unfolded protein response (UPR) pathway. The overexpression of miR-122 resulted in the repression of UPR pathway activation. Therefore, miR-122 may act as an inhibitor of the chaperone gene expression and negatively regulate the UPR pathway in HCC. We further showed that the miR-122 inhibitor enhanced the stability of the 26S proteasome non-ATPase regulatory subunit 10 (PSMD10) through the up-regulation of its target gene cyclin-dependent kinase 4 (CDK4). This process may activate the UPR pathway to prevent chemotherapy-mediated tumor cell apoptosis. The current study suggests that miR-122 negatively regulates the UPR through the CDK4-PSMD10 pathway. The down-regulation of miR-122 activated the CDK4-PSMD10-UPR pathway to decrease tumor cell anticancer drug-mediated apoptosis. We identified a new HCC therapeutic target and proclaimed the potential risk of the therapeutic use of miR-122 silencing.
LinkOut: [PMID: 21750653]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*