miRTarBase - #MIRT023329 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PIP4K2A   
Synonyms PI5P4KA, PIP5K2A, PIP5KII-alpha, PIP5KIIA, PIPK
Description phosphatidylinositol-5-phosphate 4-kinase type 2 alpha
Transcript NM_005028   
Expression
Putative miRNA Targets on PIP4K2A
3'UTR of PIP4K2A
(miRNA target sites are highlighted)
>PIP4K2A|NM_005028|3'UTR
   1 CCTCCTGCGCAGCCTCGGACAGACATGAACATTGGATGGACAGAGGTGGCTTCGGTGTAGGAAAAATGAAAACCAAACTC
  81 AGTGAAGTACTCATCTTGCAGGAAGCAAACCTCCTTGTTTACATCTTCAGGCCAAGATGACTGATTTGGGGGCTACTCGC
 161 TTTACAGCTACCTGATTTTCCCAGCATCGTTCTAGCTATTTCTGACTTTGTGTATATGTGTGTGTGTGTGTGTTGGGGGG
 241 GGGTGAGTGTGTGCGCGCGTGTGCATTTTAAAAGTCATAAATTAATTAAAACAGATCCACTTCGGTCAGTATGTGTCCCA
 321 ACAAAGACCCTTTGATTCCAGCTATGGCCGAATGAATGAGTGAGTGAGTGAGTGAGTGAATGAACACACGTGTGGGGGAG
 401 GGGAGAAGGAAGTGCATGATGTCAGGCACCGTGTTGGCATCACACAACAAACTGTGGATCAGTTTTTTTTTTTTTTTTTT
 481 TTTTTTGGAGTTGAAAGATGTGAGACAGTATTCAGAATAATGAAGATAATAATGATGATTATTATAATAATGATGATGAT
 561 TCCAAGGAAAAAACCTACAGCGAATGTTCCATTTCTACCCCGCACGCAGACACTCTCCCTAACACTGATAACCTGAGCCC
 641 CCAGCACTGGACGGAAGAATGCTGGCGTCTCCGTGTGTACTGGTTCAGGGTTCTGGCCCCAGCCTTGTCAGGACCCCCTG
 721 GTGTCCAGAGCCCCCACCCCTCCCGCAACAAGCAGCTGATGCCCCAGTGATTCTCTATACATTTTTCACCTCGGCCAATA
 801 TGTCCAGGAAAACTGCTTACTTCTCTTTTCTTGCCTGGAGCCTTCATTGTTCACCCTTACGTTGCAATATAGGAATTAAT
 881 GCTACAAAATAAAAGTAAAGCTTACCTGAAAAGTGCATAGTTTGGGGCAATGGTATCTACATCTCCCACTGTGGGAAAAC
 961 CAGCAAAGCATCAAAACTCTCAATTCTCCTGTTACCAAATGCAGATCTGAATTATAAGATGTTTATGTTTGACCATTGTT
1041 TCAACAATGGGATTTTGTTACGAATTATCCCTTTAACTGAAACCCTCAGTTTTACTGTTTACATTATTAGGAAAACAGGG
1121 ATATCTTTTGAATCTAAAAATTTGATGTACAGCATGTGATTTTTGAAGTTTACATGTAAAGTCACAGTATAGGTGAAATA
1201 ACGTTTGTCATATTTTGAGACGTATCCTGCAGCCATGTTTTTACGTGAGTGTTTTAGTCAAAGTACATGGTAGACAGTCT
1281 TTCACAATAAAAGGAAAAGGATTTTTTTTTCCTCCAAATGTACATTTATCAACCTAATGATTGATTTTTTTAAAAAGAGA
1361 TTTCGCCCCAGTCTGGTTTATGAAAGTTCATTGCCCTAAACTGTGCTGATTGTTTTTAATCAAGTTATAAATTTCCAACC
1441 TAGATCATGTATCTACCAACTCTCCTGCATTTTCCAAAAGGCATTGAGCTTAAATATTAGTCTTGCTTAGAGTAGGTTAT
1521 CCACTTACATGCTGCGCTAAAGCCATGCCTTTGAAACTCCTTGTTTAAAACATGATATGATTTTTGTGGGCAGTTTCAGA
1601 AAAGAAAACAAACAAACAAAAATCGACCCTTTAATTATTACTTGCAACTCAACAGATCTCCCTGCCGTACTGCCTTTTCC
1681 AGGAACTTTACTTCAGGGCTGTCCAGATTGCAGCTGTGCCCCGTGTATGTGGATCTAGTTCACAGAGTCTTTGGAAGCCA
1761 GCAGTCGTGCCCTCCGTATACTGTCCACTCATTTTATGTAGATTTGGTATCCTCAGCAGCCAGTGTTAACACCACTGTCA
1841 CGTAGTGTACAGATTCATCTTTTATGTATTTAAAGTAATCCATACTATGATTTGGTTTTTCCCTGCACCATTAATTCTGG
1921 CATCAGATCAGTTTTTGTGTTGTGAAGTTCTACTGTGGTTTGACCCAAGACCACAACCATGAGACCCTGAAGTAAAGATA
2001 AGGTACACATACATTATTTGAGTAACTGTTTCCTTGGGGGCCAATCTGTGTATGCTTTTAGAAGTTTACAGAATGCTTTT
2081 ATTTTTGTCTATAACAAACAGTCTGTCATTTATTTCTGTTGATAAACCATTTGGACAGAGTGAGGACGTTTGCCCTGTTA
2161 TCTCCTAGTGCTAACAATACACTCCAGTCATGAGCCGGGCTTTACAAATAAAGCACTTTTGATGACTCACAAGATGAATC
2241 CTTTTTTCCTCTGTCCCAATTGTGTGTCTCTGTTCCAAACACATTTTAAATACTCGGTCCTGACAGTGTCTTTAGCTAAT
2321 CCTTGAAGAAATGAAAGTGGAATTGAATCTTTTTAGTTTCTAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:::|:|    :||||||| 
Target 5' ctAGTGCTAACAATACACTCCa 3'
2165 - 2186 148.00 -16.00
2
miRNA  3' guUUGUGGUA---ACAGUGUGAGGu 5'
            || :||||   | | | ||||| 
Target 5' ctAAAGCCATGCCTTTGAAACTCCt 3'
1537 - 1561 128.00 -10.06
3
miRNA  3' guUUGUGGUAACA-GUGUGAGgu 5'
            |||| |||| |  |:||||  
Target 5' caAACA-CATTTTAAATACTCgg 3'
2276 - 2297 127.00 -13.44
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31514484 8 COSMIC
COSN13266748 16 COSMIC
COSN13266747 17 COSMIC
COSN31546210 18 COSMIC
COSN31578735 22 COSMIC
COSN18734890 37 COSMIC
COSN30145153 67 COSMIC
COSN26562688 92 COSMIC
COSN30690705 100 COSMIC
COSN31550327 132 COSMIC
COSN31588359 144 COSMIC
COSN31483732 204 COSMIC
COSN31562880 218 COSMIC
COSN31556385 222 COSMIC
COSN19663564 235 COSMIC
COSN20354167 235 COSMIC
COSN16127808 257 COSMIC
COSN30538316 259 COSMIC
COSN22449045 294 COSMIC
COSN20531090 471 COSMIC
COSN6963880 476 COSMIC
COSN20106966 841 COSMIC
COSN6065781 1104 COSMIC
COSN20106960 1302 COSMIC
COSN16690786 1351 COSMIC
COSN15732661 1622 COSMIC
COSN16749375 1810 COSMIC
COSN31960455 1881 COSMIC
COSN20092067 2039 COSMIC
COSN21319146 2086 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774726450 1 dbSNP
rs1193383291 2 dbSNP
rs1319128154 3 dbSNP
rs372647772 4 dbSNP
rs914556068 5 dbSNP
rs1438341145 7 dbSNP
rs377425892 8 dbSNP
rs758795926 9 dbSNP
rs780341100 11 dbSNP
rs756622792 12 dbSNP
rs768734073 12 dbSNP
rs1412877667 13 dbSNP
rs369363968 16 dbSNP
rs552667872 17 dbSNP
rs1455416020 18 dbSNP
rs964466299 21 dbSNP
rs1245893491 23 dbSNP
rs1171247414 24 dbSNP
rs1187707298 25 dbSNP
rs1486123849 30 dbSNP
rs796911026 31 dbSNP
rs1053454 37 dbSNP
rs566982299 39 dbSNP
rs1330038506 41 dbSNP
rs764862706 45 dbSNP
rs754640918 46 dbSNP
rs753641881 48 dbSNP
rs766127096 49 dbSNP
rs187712490 53 dbSNP
rs182726505 54 dbSNP
rs1005726517 56 dbSNP
rs1330219564 58 dbSNP
rs890030689 59 dbSNP
rs77536949 61 dbSNP
rs1464169035 75 dbSNP
rs1271719645 76 dbSNP
rs1339951821 77 dbSNP
rs995371536 81 dbSNP
rs775797235 82 dbSNP
rs1431686687 85 dbSNP
rs962625853 86 dbSNP
rs1177353974 87 dbSNP
rs1432850226 90 dbSNP
rs998181316 92 dbSNP
rs1451262671 94 dbSNP
rs1197115808 109 dbSNP
rs113138010 111 dbSNP
rs1478405364 116 dbSNP
rs763750601 116 dbSNP
rs1178737456 117 dbSNP
rs1422156563 120 dbSNP
rs1398776882 124 dbSNP
rs1470461940 125 dbSNP
rs896150907 127 dbSNP
rs1042447343 131 dbSNP
rs1293665807 136 dbSNP
rs1389484002 137 dbSNP
rs1384748400 138 dbSNP
rs755655638 140 dbSNP
rs1237540528 143 dbSNP
rs1411142787 149 dbSNP
rs1056180603 152 dbSNP
rs1276225532 157 dbSNP
rs1196191053 158 dbSNP
rs1247016567 159 dbSNP
rs1266110399 160 dbSNP
rs1488254791 163 dbSNP
rs945471964 165 dbSNP
rs913034462 167 dbSNP
rs1264184058 171 dbSNP
rs1054281712 183 dbSNP
rs1263257744 184 dbSNP
rs1488802959 186 dbSNP
rs1193480551 188 dbSNP
rs935858665 189 dbSNP
rs1053456 192 dbSNP
rs532721808 198 dbSNP
rs1041930478 206 dbSNP
rs927176482 210 dbSNP
rs1367407526 214 dbSNP
rs560861305 216 dbSNP
rs113961927 218 dbSNP
rs1491006528 218 dbSNP
rs1491286942 218 dbSNP
rs759985967 218 dbSNP
rs34780922 219 dbSNP
rs1310089966 225 dbSNP
rs971057184 228 dbSNP
rs546640878 230 dbSNP
rs3750705 232 dbSNP
rs113320823 233 dbSNP
rs199721901 233 dbSNP
rs1242749775 234 dbSNP
rs1313466003 234 dbSNP
rs1491175259 234 dbSNP
rs1491418030 234 dbSNP
rs557580749 234 dbSNP
rs1284365022 235 dbSNP
rs201549385 235 dbSNP
rs760739381 235 dbSNP
rs1256120374 236 dbSNP
rs1378257771 236 dbSNP
rs1421541355 236 dbSNP
rs146827323 236 dbSNP
rs746085957 236 dbSNP
rs796222323 236 dbSNP
rs1309237309 237 dbSNP
rs1380472824 237 dbSNP
rs914862532 238 dbSNP
rs1377066858 239 dbSNP
rs386741820 239 dbSNP
rs1040366466 241 dbSNP
rs1302159787 242 dbSNP
rs1376969871 243 dbSNP
rs1239724888 244 dbSNP
rs1394351061 244 dbSNP
rs1404550438 244 dbSNP
rs397897465 244 dbSNP
rs45627240 244 dbSNP
rs1284207055 245 dbSNP
rs1010859436 246 dbSNP
rs1211350408 246 dbSNP
rs1255912546 253 dbSNP
rs147836406 254 dbSNP
rs1482572986 254 dbSNP
rs961427877 255 dbSNP
rs1016675688 256 dbSNP
rs1005674350 257 dbSNP
rs954237860 258 dbSNP
rs561315773 259 dbSNP
rs1161010006 260 dbSNP
rs1433549280 260 dbSNP
rs998857676 261 dbSNP
rs1357299213 270 dbSNP
rs1463466642 272 dbSNP
rs1333392992 274 dbSNP
rs1401096302 277 dbSNP
rs369599863 277 dbSNP
rs1446185991 281 dbSNP
rs1401127507 283 dbSNP
rs973917512 283 dbSNP
rs1220122681 288 dbSNP
rs1379482451 290 dbSNP
rs962596289 298 dbSNP
rs1221023608 303 dbSNP
rs901150725 304 dbSNP
rs1259321772 311 dbSNP
rs555614797 314 dbSNP
rs766984800 323 dbSNP
rs1456906141 326 dbSNP
rs1196282013 329 dbSNP
rs1248078651 337 dbSNP
rs1446376515 338 dbSNP
rs1190346106 339 dbSNP
rs1042786072 341 dbSNP
rs1012583003 344 dbSNP
rs545362133 348 dbSNP
rs1009603848 349 dbSNP
rs759944853 350 dbSNP
rs1351769854 352 dbSNP
rs544760403 354 dbSNP
rs935806513 356 dbSNP
rs1279380497 360 dbSNP
rs192272662 360 dbSNP
rs902301371 360 dbSNP
rs533072479 361 dbSNP
rs575498205 364 dbSNP
rs796268964 368 dbSNP
rs551075555 372 dbSNP
rs200596837 374 dbSNP
rs1291408294 376 dbSNP
rs893298176 376 dbSNP
rs1321906022 380 dbSNP
rs148835349 380 dbSNP
rs368029006 380 dbSNP
rs368266870 380 dbSNP
rs374960111 380 dbSNP
rs375287830 380 dbSNP
rs535892672 380 dbSNP
rs796642988 380 dbSNP
rs1044294148 383 dbSNP
rs950009362 384 dbSNP
rs562928221 385 dbSNP
rs1166194113 386 dbSNP
rs893297224 386 dbSNP
rs1406070072 388 dbSNP
rs145159810 389 dbSNP
rs1348420956 390 dbSNP
rs942959327 394 dbSNP
rs1340381825 399 dbSNP
rs1398728858 405 dbSNP
rs575736015 415 dbSNP
rs1379223448 421 dbSNP
rs1227307781 422 dbSNP
rs1287285501 423 dbSNP
rs972803718 427 dbSNP
rs545211645 430 dbSNP
rs961069735 431 dbSNP
rs1385635103 436 dbSNP
rs574097032 437 dbSNP
rs1238025504 438 dbSNP
rs1473166442 448 dbSNP
rs1181418726 451 dbSNP
rs1383561767 451 dbSNP
rs1421760187 454 dbSNP
rs1395589305 456 dbSNP
rs1159588544 457 dbSNP
rs1360313321 457 dbSNP
rs1399361520 457 dbSNP
rs1336712949 458 dbSNP
rs1446571477 460 dbSNP
rs1330722786 461 dbSNP
rs1291253661 462 dbSNP
rs1290808658 463 dbSNP
rs1308136269 464 dbSNP
rs1420576267 466 dbSNP
rs1351199595 467 dbSNP
rs1359590579 467 dbSNP
rs1267985864 469 dbSNP
rs1279232898 470 dbSNP
rs1441786128 471 dbSNP
rs912552517 471 dbSNP
rs1290925761 472 dbSNP
rs1468910160 472 dbSNP
rs1156629904 473 dbSNP
rs1414428226 473 dbSNP
rs1051069886 474 dbSNP
rs569947541 474 dbSNP
rs1330266943 475 dbSNP
rs1374277190 475 dbSNP
rs1304297820 476 dbSNP
rs200238710 476 dbSNP
rs67930350 476 dbSNP
rs1458785325 477 dbSNP
rs867338148 477 dbSNP
rs1323914918 478 dbSNP
rs1426462891 479 dbSNP
rs1369053881 481 dbSNP
rs1379881748 481 dbSNP
rs1280001161 482 dbSNP
rs1163425277 483 dbSNP
rs1421595036 484 dbSNP
rs1263248232 485 dbSNP
rs1169296967 487 dbSNP
rs1197789713 487 dbSNP
rs1211832643 487 dbSNP
rs1219255727 487 dbSNP
rs1257535789 487 dbSNP
rs1265907255 487 dbSNP
rs1268362595 487 dbSNP
rs1304507802 487 dbSNP
rs1318528931 487 dbSNP
rs1337637098 487 dbSNP
rs1451393518 487 dbSNP
rs1478438861 487 dbSNP
rs777075795 487 dbSNP
rs1428470824 488 dbSNP
rs1344698882 489 dbSNP
rs1266252579 490 dbSNP
rs1414778689 493 dbSNP
rs1359018382 498 dbSNP
rs573022405 501 dbSNP
rs1220641061 503 dbSNP
rs1288645934 507 dbSNP
rs1186703886 509 dbSNP
rs1485059084 510 dbSNP
rs1260312149 513 dbSNP
rs1425027110 527 dbSNP
rs1487759721 528 dbSNP
rs1262844899 529 dbSNP
rs1442428628 530 dbSNP
rs1160179707 531 dbSNP
rs1048244 534 dbSNP
rs1362210492 537 dbSNP
rs1266584235 539 dbSNP
rs954183401 539 dbSNP
rs150193782 540 dbSNP
rs35641572 540 dbSNP
rs542171278 540 dbSNP
rs1028467291 542 dbSNP
rs1244087073 543 dbSNP
rs998410309 546 dbSNP
rs1311803605 549 dbSNP
rs1354826267 549 dbSNP
rs573348213 552 dbSNP
rs918706916 552 dbSNP
rs1484527937 553 dbSNP
rs1200488394 556 dbSNP
rs966004936 557 dbSNP
rs1442287729 558 dbSNP
rs1297827183 560 dbSNP
rs1400780110 561 dbSNP
rs1340197619 566 dbSNP
rs1296112157 572 dbSNP
rs1438832985 575 dbSNP
rs1156689745 577 dbSNP
rs1379233149 580 dbSNP
rs1021244986 581 dbSNP
rs1303455449 582 dbSNP
rs1009964571 585 dbSNP
rs1450596073 587 dbSNP
rs893841148 595 dbSNP
rs111324840 598 dbSNP
rs141467224 601 dbSNP
rs111244668 602 dbSNP
rs1456358333 603 dbSNP
rs1034687380 605 dbSNP
rs762852935 606 dbSNP
rs1170784813 615 dbSNP
rs1238351915 616 dbSNP
rs1480111532 626 dbSNP
rs1175228937 629 dbSNP
rs1477282209 634 dbSNP
rs1055146405 635 dbSNP
rs1421103457 637 dbSNP
rs1048246 638 dbSNP
rs1427197356 642 dbSNP
rs146594118 642 dbSNP
rs1018887377 652 dbSNP
rs1007125215 653 dbSNP
rs891411866 663 dbSNP
rs895720843 666 dbSNP
rs1036976292 667 dbSNP
rs939679428 672 dbSNP
rs909565386 673 dbSNP
rs897167544 675 dbSNP
rs748804871 680 dbSNP
rs539236286 689 dbSNP
rs1219867986 694 dbSNP
rs1243429404 703 dbSNP
rs1258183598 707 dbSNP
rs1317488347 711 dbSNP
rs983812350 712 dbSNP
rs1306512244 714 dbSNP
rs1038396856 715 dbSNP
rs932406112 716 dbSNP
rs1276597843 717 dbSNP
rs921410218 718 dbSNP
rs1420286961 720 dbSNP
rs1409491649 722 dbSNP
rs1331432765 723 dbSNP
rs977321728 724 dbSNP
rs567010710 728 dbSNP
rs1302932264 733 dbSNP
rs1322655615 736 dbSNP
rs965597424 741 dbSNP
rs1384947032 742 dbSNP
rs1344133304 744 dbSNP
rs779751995 745 dbSNP
rs1331429670 746 dbSNP
rs1279444890 753 dbSNP
rs988405306 758 dbSNP
rs957998810 759 dbSNP
rs1212360242 763 dbSNP
rs1397644330 767 dbSNP
rs1291562225 768 dbSNP
rs954062655 771 dbSNP
rs1321964235 772 dbSNP
rs1221406922 773 dbSNP
rs143766959 773 dbSNP
rs1159 777 dbSNP
rs1489175957 777 dbSNP
rs916395689 777 dbSNP
rs542265429 787 dbSNP
rs1378517295 789 dbSNP
rs905269224 792 dbSNP
rs1431943905 793 dbSNP
rs1421951624 798 dbSNP
rs966342721 800 dbSNP
rs1240617537 801 dbSNP
rs1025097379 819 dbSNP
rs1427971732 820 dbSNP
rs1285455596 827 dbSNP
rs1379380766 835 dbSNP
rs1014486783 838 dbSNP
rs989216755 840 dbSNP
rs1312515461 841 dbSNP
rs1158 842 dbSNP
rs3215826 843 dbSNP
rs397719702 843 dbSNP
rs1205731993 845 dbSNP
rs1018442449 846 dbSNP
rs567701965 847 dbSNP
rs1445212260 849 dbSNP
rs895679749 849 dbSNP
rs891303620 855 dbSNP
rs1239311298 860 dbSNP
rs1461871907 860 dbSNP
rs1037327890 861 dbSNP
rs939961424 862 dbSNP
rs745636639 869 dbSNP
rs1159525380 877 dbSNP
rs1407811435 879 dbSNP
rs1274011207 881 dbSNP
rs1230873822 894 dbSNP
rs994399355 901 dbSNP
rs1399487182 906 dbSNP
rs888076386 918 dbSNP
rs1309945005 920 dbSNP
rs1445995042 922 dbSNP
rs1373930487 923 dbSNP
rs1338153845 927 dbSNP
rs1334265555 928 dbSNP
rs1038355990 930 dbSNP
rs1048059290 935 dbSNP
rs1278768852 936 dbSNP
rs932356949 939 dbSNP
rs941450441 945 dbSNP
rs1464902413 946 dbSNP
rs1324372061 949 dbSNP
rs1382578164 950 dbSNP
rs920992911 952 dbSNP
rs1203177895 953 dbSNP
rs113084433 968 dbSNP
rs944172175 972 dbSNP
rs116492026 977 dbSNP
rs757144513 981 dbSNP
rs939141075 983 dbSNP
rs1189775351 988 dbSNP
rs1443206012 989 dbSNP
rs757196516 991 dbSNP
rs1174822125 992 dbSNP
rs988352874 996 dbSNP
rs8341 997 dbSNP
rs1032627796 1005 dbSNP
rs1333740337 1010 dbSNP
rs1239267447 1014 dbSNP
rs1374655398 1018 dbSNP
rs539069932 1021 dbSNP
rs544838642 1021 dbSNP
rs1222911955 1022 dbSNP
rs1261376236 1025 dbSNP
rs1320154670 1026 dbSNP
rs528294023 1035 dbSNP
rs1272648213 1042 dbSNP
rs1436418221 1043 dbSNP
rs910261653 1050 dbSNP
rs969439744 1056 dbSNP
rs987242132 1061 dbSNP
rs1480413441 1062 dbSNP
rs185951018 1062 dbSNP
rs1462089120 1069 dbSNP
rs1166963240 1073 dbSNP
rs990343917 1076 dbSNP
rs1393960094 1083 dbSNP
rs1303539344 1084 dbSNP
rs1339488891 1084 dbSNP
rs1344759398 1090 dbSNP
rs1025467437 1095 dbSNP
rs542553400 1097 dbSNP
rs1331737405 1117 dbSNP
rs1013685091 1118 dbSNP
rs1269761951 1118 dbSNP
rs1337696943 1126 dbSNP
rs1211959807 1127 dbSNP
rs1383591294 1142 dbSNP
rs960122229 1145 dbSNP
rs76451424 1147 dbSNP
rs1220867429 1158 dbSNP
rs1159641665 1163 dbSNP
rs1419613159 1165 dbSNP
rs994368267 1172 dbSNP
rs76630921 1174 dbSNP
rs1473593954 1178 dbSNP
rs571618758 1178 dbSNP
rs1048321423 1180 dbSNP
rs996453040 1181 dbSNP
rs543036149 1184 dbSNP
rs148948464 1198 dbSNP
rs1299947146 1199 dbSNP
rs1385595436 1202 dbSNP
rs1382779821 1203 dbSNP
rs764023973 1205 dbSNP
rs758495715 1209 dbSNP
rs1364148321 1210 dbSNP
rs895150085 1212 dbSNP
rs943805078 1221 dbSNP
rs752789959 1222 dbSNP
rs1185611238 1224 dbSNP
rs557841769 1228 dbSNP
rs114457694 1236 dbSNP
rs765468230 1239 dbSNP
rs1262959809 1244 dbSNP
rs1052595680 1245 dbSNP
rs538807673 1248 dbSNP
rs1183813679 1249 dbSNP
rs1384285827 1254 dbSNP
rs1442486013 1255 dbSNP
rs1215716898 1256 dbSNP
rs1160240138 1267 dbSNP
rs1003643789 1268 dbSNP
rs906351677 1269 dbSNP
rs936861543 1287 dbSNP
rs1382845076 1289 dbSNP
rs1351379153 1293 dbSNP
rs1454714075 1293 dbSNP
rs376407742 1299 dbSNP
rs373575443 1301 dbSNP
rs369500962 1302 dbSNP
rs79330455 1310 dbSNP
rs1450825427 1311 dbSNP
rs34435373 1311 dbSNP
rs397741309 1311 dbSNP
rs925508815 1315 dbSNP
rs1042268033 1320 dbSNP
rs768661415 1324 dbSNP
rs915197474 1337 dbSNP
rs1053718193 1338 dbSNP
rs114937338 1340 dbSNP
rs1203769003 1342 dbSNP
rs1242071707 1347 dbSNP
rs553377905 1351 dbSNP
rs1180220349 1352 dbSNP
rs1229083328 1352 dbSNP
rs1340807046 1358 dbSNP
rs1250940449 1359 dbSNP
rs145770927 1362 dbSNP
rs954493424 1364 dbSNP
rs12265213 1365 dbSNP
rs1405572903 1367 dbSNP
rs1468453873 1386 dbSNP
rs1014997923 1387 dbSNP
rs1004001066 1393 dbSNP
rs961530209 1400 dbSNP
rs952574855 1403 dbSNP
rs1406488487 1413 dbSNP
rs1305417270 1414 dbSNP
rs1026827833 1415 dbSNP
rs996791532 1426 dbSNP
rs899456656 1427 dbSNP
rs747054115 1428 dbSNP
rs1040722672 1438 dbSNP
rs1413095410 1439 dbSNP
rs1017562692 1440 dbSNP
rs1251599607 1443 dbSNP
rs1480181095 1447 dbSNP
rs1175283573 1449 dbSNP
rs550962030 1455 dbSNP
rs181046355 1457 dbSNP
rs892211521 1459 dbSNP
rs1052208550 1462 dbSNP
rs1161598558 1464 dbSNP
rs149808106 1470 dbSNP
rs1200175977 1477 dbSNP
rs1428659445 1480 dbSNP
rs925455096 1483 dbSNP
rs1424661084 1484 dbSNP
rs189628922 1486 dbSNP
rs959606093 1489 dbSNP
rs1045317909 1494 dbSNP
rs528264612 1495 dbSNP
rs948334974 1501 dbSNP
rs186055832 1504 dbSNP
rs542491719 1513 dbSNP
rs777089373 1516 dbSNP
rs1033713357 1520 dbSNP
rs529124056 1524 dbSNP
rs1283248702 1526 dbSNP
rs1222127540 1527 dbSNP
rs1215877438 1529 dbSNP
rs992166209 1535 dbSNP
rs563255432 1536 dbSNP
rs906655726 1539 dbSNP
rs41304595 1542 dbSNP
rs907951235 1543 dbSNP
rs984851715 1551 dbSNP
rs952522535 1556 dbSNP
rs1200054851 1560 dbSNP
rs1026776365 1567 dbSNP
rs1221613854 1571 dbSNP
rs1266770276 1572 dbSNP
rs1477047846 1577 dbSNP
rs1318126897 1578 dbSNP
rs567454783 1586 dbSNP
rs963985770 1591 dbSNP
rs1277229170 1604 dbSNP
rs1009370235 1614 dbSNP
rs375568007 1617 dbSNP
rs1425759926 1621 dbSNP
rs748990817 1621 dbSNP
rs869062364 1621 dbSNP
rs1303066084 1624 dbSNP
rs1019987292 1625 dbSNP
rs1432211024 1635 dbSNP
rs542121086 1635 dbSNP
rs1457417498 1637 dbSNP
rs1360780962 1638 dbSNP
rs1212417725 1640 dbSNP
rs1316766010 1647 dbSNP
rs910199210 1655 dbSNP
rs1051466143 1663 dbSNP
rs564021653 1666 dbSNP
rs373978235 1667 dbSNP
rs1000636806 1669 dbSNP
rs1217980613 1671 dbSNP
rs918970770 1681 dbSNP
rs1485605260 1686 dbSNP
rs903984367 1689 dbSNP
rs1467292698 1694 dbSNP
rs1045246344 1695 dbSNP
rs1445558742 1701 dbSNP
rs1163346592 1707 dbSNP
rs971797442 1708 dbSNP
rs573339369 1713 dbSNP
rs10734041 1714 dbSNP
rs1344064625 1719 dbSNP
rs896734185 1720 dbSNP
rs1428127078 1722 dbSNP
rs536856082 1723 dbSNP
rs1477654260 1729 dbSNP
rs1244950230 1732 dbSNP
rs940672155 1734 dbSNP
rs984761946 1736 dbSNP
rs574346155 1741 dbSNP
rs1224242736 1743 dbSNP
rs959678435 1745 dbSNP
rs1316397810 1748 dbSNP
rs1457779649 1748 dbSNP
rs1245126295 1751 dbSNP
rs557693407 1752 dbSNP
rs982148354 1753 dbSNP
rs1236069035 1758 dbSNP
rs984798773 1764 dbSNP
rs1313651052 1765 dbSNP
rs112189099 1766 dbSNP
rs922053712 1767 dbSNP
rs1455122720 1775 dbSNP
rs1021015085 1776 dbSNP
rs757618459 1780 dbSNP
rs975269327 1781 dbSNP
rs964243378 1782 dbSNP
rs1449692864 1783 dbSNP
rs1337305817 1796 dbSNP
rs1377657294 1805 dbSNP
rs1330776770 1806 dbSNP
rs1032197452 1812 dbSNP
rs181077400 1817 dbSNP
rs1464250059 1819 dbSNP
rs551569454 1822 dbSNP
rs1226609088 1823 dbSNP
rs1052121040 1824 dbSNP
rs1324425601 1835 dbSNP
rs987135630 1841 dbSNP
rs145292593 1842 dbSNP
rs1030676172 1845 dbSNP
rs1205680563 1846 dbSNP
rs941808566 1847 dbSNP
rs1440239562 1851 dbSNP
rs1202283877 1853 dbSNP
rs1429335105 1856 dbSNP
rs910028689 1857 dbSNP
rs1170432178 1860 dbSNP
rs1416327659 1862 dbSNP
rs1000586126 1863 dbSNP
rs566061355 1881 dbSNP
rs938260237 1882 dbSNP
rs1327973078 1885 dbSNP
rs769435709 1889 dbSNP
rs1406673559 1892 dbSNP
rs1283899810 1894 dbSNP
rs1346228850 1895 dbSNP
rs1223047266 1896 dbSNP
rs982367470 1901 dbSNP
rs190567229 1908 dbSNP
rs1484013407 1909 dbSNP
rs1237748534 1910 dbSNP
rs1209015428 1928 dbSNP
rs1012400172 1933 dbSNP
rs896658207 1938 dbSNP
rs1056692993 1950 dbSNP
rs1278641448 1952 dbSNP
rs373178682 1958 dbSNP
rs1196136240 1968 dbSNP
rs1374397419 1969 dbSNP
rs970687107 1985 dbSNP
rs1020983877 1986 dbSNP
rs1355116077 1998 dbSNP
rs1308620197 1999 dbSNP
rs767156133 2002 dbSNP
rs754467086 2004 dbSNP
rs1381588656 2009 dbSNP
rs1388056767 2009 dbSNP
rs1303590076 2012 dbSNP
rs1447609676 2015 dbSNP
rs8412 2026 dbSNP
rs958175744 2028 dbSNP
rs76848610 2035 dbSNP
rs1160247330 2036 dbSNP
rs1228384289 2040 dbSNP
rs528440860 2043 dbSNP
rs1340463836 2048 dbSNP
rs1032579895 2049 dbSNP
rs1293053725 2052 dbSNP
rs886405987 2054 dbSNP
rs1207504794 2055 dbSNP
rs888957123 2056 dbSNP
rs1156285493 2059 dbSNP
rs1030178572 2063 dbSNP
rs549708298 2064 dbSNP
rs139777437 2067 dbSNP
rs1384479453 2071 dbSNP
rs1456306437 2076 dbSNP
rs1160265028 2080 dbSNP
rs1387223593 2082 dbSNP
rs1382904948 2088 dbSNP
rs1180853002 2091 dbSNP
rs564140614 2096 dbSNP
rs1320071932 2098 dbSNP
rs897479262 2098 dbSNP
rs1036016882 2099 dbSNP
rs1243214361 2101 dbSNP
rs1316199601 2101 dbSNP
rs540693909 2101 dbSNP
rs572074709 2102 dbSNP
rs561778632 2105 dbSNP
rs1350754900 2109 dbSNP
rs543199884 2116 dbSNP
rs922001250 2126 dbSNP
rs1207576692 2128 dbSNP
rs975260222 2134 dbSNP
rs1265780839 2138 dbSNP
rs1462402895 2141 dbSNP
rs1183869702 2143 dbSNP
rs942520868 2148 dbSNP
rs1255830724 2152 dbSNP
rs1421900304 2153 dbSNP
rs912404812 2164 dbSNP
rs1488885569 2166 dbSNP
rs1454314755 2168 dbSNP
rs147397323 2171 dbSNP
rs956617429 2177 dbSNP
rs1471066643 2178 dbSNP
rs923890167 2183 dbSNP
rs1394715749 2188 dbSNP
rs537412474 2196 dbSNP
rs557677474 2197 dbSNP
rs7082999 2199 dbSNP
rs117744240 2204 dbSNP
rs938157856 2216 dbSNP
rs967730570 2219 dbSNP
rs1325117889 2220 dbSNP
rs184766643 2226 dbSNP
rs1012425667 2229 dbSNP
rs1482120215 2233 dbSNP
rs1353876550 2248 dbSNP
rs1299779085 2253 dbSNP
rs192578811 2254 dbSNP
rs114389025 2259 dbSNP
rs913889541 2260 dbSNP
rs1035603375 2262 dbSNP
rs777765548 2269 dbSNP
rs1481498640 2271 dbSNP
rs1177402466 2284 dbSNP
rs372591563 2287 dbSNP
rs886689252 2293 dbSNP
rs1358820961 2295 dbSNP
rs1464802864 2296 dbSNP
rs3750704 2306 dbSNP
rs1287007466 2307 dbSNP
rs1409715027 2308 dbSNP
rs1287075496 2312 dbSNP
rs1346827266 2319 dbSNP
rs188875308 2326 dbSNP
rs925359973 2328 dbSNP
rs4748809 2333 dbSNP
rs1251650546 2334 dbSNP
rs953217000 2337 dbSNP
rs1202934441 2339 dbSNP
rs900515500 2340 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*