miRTarBase - #MIRT023324 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MOB3B   
Synonyms C9orf35, MOB1D, MOBKL2B
Description MOB kinase activator 3B
Transcript NM_024761   
Expression
Putative miRNA Targets on MOB3B
3'UTR of MOB3B
(miRNA target sites are highlighted)
>MOB3B|NM_024761|3'UTR
   1 TGCTCCACCTCACCCTTTGGAAGAAAGGAAAGCTGTTTCCTCCTGGTGCCCTGAGCGGGCAGGAGGTGGACCACCCTGGC
  81 TGAAATGACACACCTACTCCCAGGAACAGCAGAGGTGGAGGCAAGCAGTGACTCCTGAGAGACATTCCCCACTCACTTTG
 161 TGTGCTCTTAACCTTCTGAGTGCTGCTAGCCCAGACCTGTGGACGAGGCAGACCACAACGTGAAAGAAGGACCAGCCCCT
 241 TGACCGTTCTGGCTGGGGAATTGTCCACGAGGAAGCCTCTGCACTTCCACACATGGCACAGTTCTGCCTGTGACCTGCCG
 321 CCTAAGCTTTACTGGAATTCAGGTTTTGAGACTGAGATGCGTGTTCGTATTTTTCCACTTATCTGTCTTGTCAGCTGGCC
 401 GACTTCTCTGTGATTGGTTTTTTAAGTGCCGGGTGAATTTTGGACCTCTGGATGTGCAGCAAGTTTTTATGCAATAAGCC
 481 TTCCTTTCAGGTCTCTAAAAGCTCCTGCTCTGATCTGTGGTTTAACACTGTGCAGGGCTGTGGAGCTCTGAGACACCTGA
 561 ACCCCTACCCATCCCCTGCACCTCCCTACTCTCCCTGCCGAGGCGTCCATAGCATTTCCCTAATAAATAGTTTTATCAGG
 641 GACACTCCATGGGGTGGCTTGTCTCTGCCCCAAACAGGGTCTTCACGTTCTAACTGCAGGGAAGAGACTGGTTACTAGCG
 721 TAAAGCTGACAAGTTACCAGTTCACCTGATCAGAATGTATTTTTTATAACCACCATCATTCCTTGTCTCTTCAGTGGAAG
 801 ATATTCTTTCCTGTTTCCCAGAAGAGAGAAATAAAAGTCCTAAATAACTAAGAATGATCAGCGGGAGCGTTGGGCATGAT
 881 TACTGCAGTGTTTGTTCTTTATTAAAGACAGGGAGTCGTGGCTGTCTCTACATAATACTAACATTTCAGTGAAAAAAGTA
 961 CAATTGGTTATTTGGTACGTGTAGATTTAACACCCAGACGGCTGACTTGTAACCCTCCCCACTAGCCTTCTGAGCATTTA
1041 AACCCAGCCGTCATTCTCTCCCCACTCCACGCTCCCCACTCCTCTGCCACGTTATGTTACGGCACAAAATTAATTTCTGC
1121 CCCTGTGATTGGGCCACGGTTGCCAAGGTAACAGTGGAGCTGGAGCTAACTTCCTTCTTTCATCCTTTCCAATTTTTCTA
1201 TTCCAGAAGACAGTCAGAATAATGCATTCTGTACTACATCCTGCCTTTTGAAACCTAAATGAGTTTTCGTTGATGAAATG
1281 TTGCCTTCTCTGATTCATTCACAAAACTGTGGTGGTTCTGACCACCTGTGACGAGGGGGGTCATAATACTTCCAGTGATC
1361 CTTTTAATTTAGCAAAATATTTGTCGGTGGAGGGAAGTAGATAAGAATGTATTAGTGTATTTTAAAGTAATAATGATTAA
1441 AGAATAACTAAATGACTCTGATTTTGTTTTATCAATCATAATGTGTTAAAGCCCTCTGTGGCTGCCACAAAAGACTAGAA
1521 TCATGAAATCTTTGTCCAAGCTAAGAAAGGGCTGTCTCTGTGGGTACAGTGGCATTCTCTGTTGACCTAACCAAGCAGCC
1601 TGAACCTTGCTTTGTGTCTCGTAAAGGTCATCTCACGGAATCCAATTGCTGCTACCTCACCATGTTGCTGTGCCCTGGTC
1681 AACAATAAACATACTTTTGTCCCCCTTCCTAAGTAACTTTGAGAGGACAAGATAGGCAAAGTTTTTTCCCTACATCTCTT
1761 TTGGCCAAAAGAATATCTGACCATCACAGAGATCCAGAGAACAGAAACAAGAGCCCCTAAGTCCCAGCCTCTGCAATACA
1841 CAGTTACCAGATGGGAATGCAGCACAGTGGCACAGAGAGGTAACTACGGAGCCCATGCCCTGGAGGAACTCTGTAGCTGT
1921 GCATCATGGAACGCCACAGGATTTTTACATTAAAAAGTTGAATATGTTCCTGCATTTCAGCAGTGCATAATCGAGCAGGA
2001 GGCTGGAATCTGGAGACCTTTGTTATTCATTCTTTTTAAGGTTATTTTTTATTAACTGTGCATATGAAATTTCCACTCAA
2081 TTTAAAAATCCAAATCTTTTTAAGCTTCTTGGAAGAATTTCCTCCTGCTTATATTGTTAATTGCACTAATGAACTCTTCT
2161 AGGGTAAATTCTGGCAAACTACCCTTTTTTTTTTTTTAATCACAGAATATTCCTGTTCCCACAGAACTTTGGCACATTCT
2241 GAAGAAAATCTCTGCAGTCAATTTTTATCTCCTCTGCTTGACTGCATCTAACTGTTCATCTCTGTTATAAATGGAGCTTC
2321 AGCCCTCTGGGTCAGAGACTGACAACCCTCCTTCTTCTTCCTAACCTGTCCTACTCTCCTTCTTTTTCTGCTTTCATTTT
2401 AATTTTGGGAAATTTTAAAGTAAAAGTTTCAAAGTTGAAAGATTATAGTGAGTACCCTTATGTCCTTTAGTGCATCAGTT
2481 GTTAATGTTTTGCCTTGTTTTCTTTTCTTCCTTTTTTTTTTTTAAGAGAAGGGGTCTCTCCCTATTTTACCCAAGCTGGC
2561 CTTGAACCCCTTGCCTCAAGTGAGCTTCAACCTTAGCCTCCTGAGTAGCCAGGACTATGGCATGTACCACCGCACCTGCC
2641 TCACATTTTCTTTCTCACTGTAAATACACATTCTTATTCTTGAACCTTCTGAAAATAAGTTGCAGACATCATGAAAATGT
2721 AAAATACTTCATCATATTCTTTCTTTTAATAAGAGCATTGTCCTATAAATCTGCAATATTTTCACGCCCATGAAACTGAA
2801 CACTGATACTGCATAAATCTAATATATGATCCATATTCAAAATTCTCCAGTTGTCCCCAAAATATCCTTTATAGCTGTTT
2881 ATTTTTAAATCCAGGATCCAATCAAGAATTATACGTTATATGTAGTTGTCATTCTCTTTTGTTTCCTTTAATTGATTAGA
2961 GTTGCCCTTTTGTGTGTGTCTGAGTGGTGGGTGGTGGGGTGGTGTTTGTGTATGATGTGCAGTGTGTGTGTGTGTGGTGT
3041 GTCTTTCATGACACTGACATTATTAAAGAGTTCAGGCAAGTTTGTGGAATGTCCCACAATCTAGACTTTTTTACTGATTG
3121 TTTCCTCATTACGAGATACAGGTTACATTTTTTTTCCCAAGACTGCTACATGTGTGATGTTGTTTCCTTACTACTGCCTC
3201 ACCTCAGGAAGCACATAATGTCTACTTGTCTCTTTTCTGATATTAGGACTGATCAGGTGTTGTCTGCCTGATCCAATCAT
3281 TATCAAGTTCCATAATTCATTATTAAGCTCTGAAATTCAGGACACATACATTTATAGAGTGTGAGGCTGTGCATACGTAC
3361 ATTCATCCCTTAATGTTCTCAAGGAGGCCCAGGATCCCCAAAATATTATAAGCATTGCAGTCAGATGATATAGCACTAGC
3441 AAAGCATTCATCCCTTTCCATATAACAGGAGGGAGGGGAAGAAGGAAGTTTCCATGTGCAGGCAATACGTGAGAGCATGG
3521 GCAAGTGAGGATTTGTATGCTCCCTGTAGCCAGAGGTGAAATATTCAACGCTTTTATTTTTTCTCCCGTCTTCAATGACC
3601 TCCCATTTGGACCCATAGTTTATTTATAGAGAGCACACACTCCCTAATTGTCAGATGGTTTTTTTGGGAAAACTCTTAGA
3681 TAGTACAGTGAGTTGTGACCCTCCAAAGGATCACAAGTACATAAACAGATACAAAGTATTTATGTGGTATTAAAATTTCA
3761 TGGTGATGGTGCAAGGGAGAGATGATTAGGAAGAAAATGTCTTACACGGCTGTAATTGAGAAATACTGATCTAGAGTCAT
3841 TTCCTGCTTCTTAAATTGTTCGTTTTCTCTTCCCTGGGTATTTTCTCATTTCCAAAGACCCAGAGTCTCAGAGCCAGGTT
3921 AAGTGGAAGAAACTTTGAGAGGTTTCTTAATCAATTCCTTCTATCTCTCAAACCATGCCAGTAACTTCCTTGGTGAAAAA
4001 ATCTATACTCCTCTCACAGTTCTTCGGGCATGGAAATTCTATAGCATTCTTTGGTATAACCAACCCACTGAACCCTCCAC
4081 AACATCTTGAATTCCATTCAACTCGAGCTGAAGTATTCTTTTTGAGTTTCAGTATATCTTTTCTAGTGTCCCACTTTTAG
4161 AAAGGTCCAAAGATGATATATAATAAGTGAAAATACAATTAATCAGAGCTTTATTTGCATATCCATTAAATATCTGAAGG
4241 CTATTACCAGTTGTGCTTCAGCCTCCTTTCCCTTGCAATTCTCCCAGGGTGGCATCCTCTACGGAGTCTTGTTGCTCCAT
4321 TGTTGACCACTGATGTAACTCAACGTGAAACCTTCCCAAAGCTCTCCACATCACTCTCTGTTATGGCTGTGACCAGCAGT
4401 GAACATGAAAAGAACTTATTTCATGCCTTCTCCAAACTATATTGTTTCTTTGCTAAGTCCAGACCTGCTTTTTCTACATT
4481 TATAGGTTTTCTATTTTAATCGCCATGCAAAATTCTTTATCATACTCAATCATTTTGGTTTATCTTCCTGACTTCTTACC
4561 TTTAACATCCCTGTTAAAGATTACACTGTTGTTGTTTCAAAAAAAAAAAAAAAAAAACCTTAATTGGCAAAACATTAAGG
4641 GACTTGAATAGAATTACACTTATCTTTTTGTGCTGATTTATGTCAATCCATCATTCTGGTTATTGATGGAAGCAAATTGC
4721 TTCCTATGTTCTCTAAACCTTATGTCCCTTCCATACTCCATGAGTACCACACTGGGAGAAAACAAAAGCAAAAAGATTGT
4801 GGGAAAAGTATAGCCATTATCTTTGAGGAAATGTGTACCAAGGCACAATCATTAAAAGGAGTTGGAGGCATCATTTGGTT
4881 GACACTGTTGTCATTCTTGTTCTGATCATTTTGGACCTTGAAGAAATTGGTGATTCTCTCCTAGAATTAGACAAACAAAG
4961 TGTGTTTGGAAATAATGATTGTTTTCCTGCCTTAAAAAATATATTAACAGAAAGCTTTTATAACAGGCTGTTTCCCTCTG
5041 GACAGGTATTAATTCTGAGTAAGAATTTTCAGTGACTACATAAGGATTTGTGTAACTTATGAAGGAAGAGTCCATTTCTA
5121 ATCAAATAATTCGCCTGTTTTACTAGCTTATAGTGATCTGATTTCAGAATTTTCCTGTATCTTTTTTACATACATCAGAA
5201 AAAGAAATGTTTACTATATTTTTGGTTCCATTTATGATTGTATTAAGCATTTGACTATAAGGAAAACTAACAATTAAATC
5281 AATTAGAAAAGCAACATAAAATTAAATGATATTTAGGAAATCAGTTATATGTGAGCTTGGGTATTCAAATGTCACAAATA
5361 AAAAGCATATAACCATTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG----UGUGAGGu 5'
            ||:| : || ||    ||||||| 
Target 5' taAATAGTTTTATCAGGGACACTCCa 3'
624 - 649 154.00 -15.70
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :| | ||    |||||||| 
Target 5' taGAGAGCA----CACACTCCc 3'
3627 - 3644 146.00 -13.30
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              | ||| |  |||:|||| 
Target 5' ctctCCCCACT-CCACGCTCCc 3'
1056 - 1076 137.00 -13.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30185266 5 COSMIC
COSN30184694 9 COSMIC
COSN30478036 9 COSMIC
COSN30454233 20 COSMIC
COSN1377276 22 COSMIC
COSN26984854 33 COSMIC
COSN14679320 71 COSMIC
COSN30161984 72 COSMIC
COSN31610782 143 COSMIC
COSN30172929 212 COSMIC
COSN20076791 320 COSMIC
COSN31590911 479 COSMIC
COSN21427654 565 COSMIC
COSN16308675 612 COSMIC
COSN28787737 793 COSMIC
COSN30175941 863 COSMIC
COSN8520437 899 COSMIC
COSN28668745 963 COSMIC
COSN8520436 974 COSMIC
COSN7564457 1071 COSMIC
COSN27373902 1206 COSMIC
COSN30172300 1556 COSMIC
COSN24303019 1740 COSMIC
COSN31577036 1741 COSMIC
COSN23813353 2182 COSMIC
COSN27419472 2184 COSMIC
COSN32057346 2184 COSMIC
COSN20106102 2185 COSMIC
COSN9462708 2507 COSMIC
COSN14775451 2753 COSMIC
COSN9281301 2862 COSMIC
COSN16033856 2935 COSMIC
COSN21511158 3699 COSMIC
COSN32056830 4275 COSMIC
COSN2318758 4341 COSMIC
COSN20626636 4360 COSMIC
COSN27039664 4412 COSMIC
COSN14764516 4525 COSMIC
COSN20106101 4587 COSMIC
COSN20091905 4594 COSMIC
COSN20106098 4598 COSMIC
COSN2318757 4598 COSMIC
COSN27192875 4598 COSMIC
COSN20106099 4599 COSMIC
COSN20106100 4599 COSMIC
COSN28246087 5040 COSMIC
COSN18956360 5155 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1436660606 2 dbSNP
rs371091836 3 dbSNP
rs377467078 5 dbSNP
rs766593518 8 dbSNP
rs1445733072 10 dbSNP
rs1400710590 11 dbSNP
rs1200851497 13 dbSNP
rs767171147 18 dbSNP
rs757254079 19 dbSNP
rs1424377916 20 dbSNP
rs1173229251 24 dbSNP
rs751386695 25 dbSNP
rs201496531 29 dbSNP
rs775753898 33 dbSNP
rs1051288608 36 dbSNP
rs765413541 38 dbSNP
rs1208475551 39 dbSNP
rs1268356556 40 dbSNP
rs1442349344 42 dbSNP
rs759942373 45 dbSNP
rs1219285450 47 dbSNP
rs1240560566 48 dbSNP
rs1349471732 49 dbSNP
rs1317154088 51 dbSNP
rs533794383 55 dbSNP
rs1264759860 56 dbSNP
rs1321034304 58 dbSNP
rs3739530 71 dbSNP
rs186229664 74 dbSNP
rs559554236 77 dbSNP
rs1448250831 89 dbSNP
rs1190329141 92 dbSNP
rs974281886 95 dbSNP
rs1481040114 98 dbSNP
rs1202103622 109 dbSNP
rs536030982 115 dbSNP
rs1427597808 117 dbSNP
rs962954953 120 dbSNP
rs951304236 125 dbSNP
rs1387340717 127 dbSNP
rs1399029248 134 dbSNP
rs542715696 135 dbSNP
rs1339827896 137 dbSNP
rs577173619 139 dbSNP
rs1197410897 149 dbSNP
rs1232198777 151 dbSNP
rs1342627039 151 dbSNP
rs1255248492 154 dbSNP
rs1035088155 160 dbSNP
rs1282912146 167 dbSNP
rs2145928 169 dbSNP
rs1490667056 172 dbSNP
rs974073805 174 dbSNP
rs550772128 182 dbSNP
rs773051698 205 dbSNP
rs958747375 210 dbSNP
rs1480321935 216 dbSNP
rs181248911 218 dbSNP
rs1365834699 219 dbSNP
rs749224472 220 dbSNP
rs369434254 222 dbSNP
rs879726904 242 dbSNP
rs1426586768 245 dbSNP
rs1304906876 246 dbSNP
rs780059990 249 dbSNP
rs755903979 252 dbSNP
rs1307420536 253 dbSNP
rs1337208426 255 dbSNP
rs1020902376 263 dbSNP
rs1236391392 266 dbSNP
rs1335768478 282 dbSNP
rs1010481825 293 dbSNP
rs893427817 296 dbSNP
rs890802771 300 dbSNP
rs1247456221 306 dbSNP
rs570931952 315 dbSNP
rs1053344855 317 dbSNP
rs1050835569 320 dbSNP
rs936348989 328 dbSNP
rs190037238 346 dbSNP
rs1402113728 352 dbSNP
rs186377252 358 dbSNP
rs943807438 360 dbSNP
rs1471147799 361 dbSNP
rs912382998 366 dbSNP
rs751845692 367 dbSNP
rs1446538425 369 dbSNP
rs1161683263 381 dbSNP
rs1383383560 382 dbSNP
rs899991780 387 dbSNP
rs983061868 390 dbSNP
rs1365548542 393 dbSNP
rs929841108 397 dbSNP
rs1185487858 400 dbSNP
rs1038542316 401 dbSNP
rs148864929 405 dbSNP
rs941606994 406 dbSNP
rs548933400 426 dbSNP
rs1247619664 430 dbSNP
rs530296717 431 dbSNP
rs919851218 432 dbSNP
rs983457051 435 dbSNP
rs1253557750 437 dbSNP
rs563044495 441 dbSNP
rs1337883822 445 dbSNP
rs958713548 446 dbSNP
rs927309912 449 dbSNP
rs1198347425 451 dbSNP
rs180734589 456 dbSNP
rs1440692012 463 dbSNP
rs1243985892 474 dbSNP
rs1462824832 476 dbSNP
rs1181873348 478 dbSNP
rs939339130 481 dbSNP
rs981537123 491 dbSNP
rs971924210 493 dbSNP
rs867305597 509 dbSNP
rs1171083768 510 dbSNP
rs544806961 511 dbSNP
rs1460279058 518 dbSNP
rs1020448087 520 dbSNP
rs980862411 521 dbSNP
rs1010823335 525 dbSNP
rs1406436366 529 dbSNP
rs576823488 531 dbSNP
rs1885380 554 dbSNP
rs1022798399 556 dbSNP
rs1033237163 562 dbSNP
rs1000461278 566 dbSNP
rs1382251376 568 dbSNP
rs1227336569 569 dbSNP
rs1298395080 573 dbSNP
rs1325133134 574 dbSNP
rs1218486627 577 dbSNP
rs989950996 581 dbSNP
rs1325970736 590 dbSNP
rs957192195 594 dbSNP
rs899487955 598 dbSNP
rs758439831 599 dbSNP
rs1007968618 600 dbSNP
rs1031566552 604 dbSNP
rs1486242233 609 dbSNP
rs775605810 614 dbSNP
rs1340452241 627 dbSNP
rs1316284068 631 dbSNP
rs1263849326 633 dbSNP
rs999189924 634 dbSNP
rs539847045 640 dbSNP
rs1386823059 644 dbSNP
rs1470811520 648 dbSNP
rs556962751 649 dbSNP
rs1401559029 658 dbSNP
rs996606899 661 dbSNP
rs1290116152 664 dbSNP
rs899626843 673 dbSNP
rs567004132 686 dbSNP
rs1387406561 687 dbSNP
rs1038092477 689 dbSNP
rs1284439275 694 dbSNP
rs772290011 699 dbSNP
rs1347801829 708 dbSNP
rs1222002903 710 dbSNP
rs890874376 717 dbSNP
rs941508768 719 dbSNP
rs1046861497 727 dbSNP
rs1259015751 728 dbSNP
rs752866100 743 dbSNP
rs189257225 745 dbSNP
rs1481304053 746 dbSNP
rs765213657 749 dbSNP
rs1340607681 750 dbSNP
rs554429505 759 dbSNP
rs937270310 766 dbSNP
rs536111906 768 dbSNP
rs927310016 771 dbSNP
rs1447263477 772 dbSNP
rs1418504673 779 dbSNP
rs555069557 785 dbSNP
rs533717181 787 dbSNP
rs777121119 792 dbSNP
rs1984008 793 dbSNP
rs760976385 801 dbSNP
rs1354990817 804 dbSNP
rs988908381 806 dbSNP
rs1293289566 824 dbSNP
rs957552914 828 dbSNP
rs1225650938 833 dbSNP
rs1248729873 840 dbSNP
rs369951588 841 dbSNP
rs779046059 848 dbSNP
rs1363622054 852 dbSNP
rs1033163592 853 dbSNP
rs989580085 865 dbSNP
rs551345542 868 dbSNP
rs1219182829 869 dbSNP
rs965365545 874 dbSNP
rs1328451011 879 dbSNP
rs538827120 889 dbSNP
rs1480811552 895 dbSNP
rs771793246 897 dbSNP
rs1017901945 906 dbSNP
rs1378034239 911 dbSNP
rs570853774 913 dbSNP
rs761349583 918 dbSNP
rs1387695631 921 dbSNP
rs1029321793 928 dbSNP
rs1404850133 930 dbSNP
rs1444753690 935 dbSNP
rs145584801 937 dbSNP
rs534168060 949 dbSNP
rs1165534051 951 dbSNP
rs533258076 958 dbSNP
rs1984007 963 dbSNP
rs993943826 978 dbSNP
rs1016610078 979 dbSNP
rs1307870054 982 dbSNP
rs1206269839 984 dbSNP
rs1236050458 987 dbSNP
rs1457030680 991 dbSNP
rs1005288110 992 dbSNP
rs749240804 993 dbSNP
rs898321375 999 dbSNP
rs780083144 1000 dbSNP
rs769734897 1001 dbSNP
rs1475590010 1015 dbSNP
rs371656903 1017 dbSNP
rs1047719295 1019 dbSNP
rs1470414868 1020 dbSNP
rs1038245702 1026 dbSNP
rs1338832640 1031 dbSNP
rs184622718 1041 dbSNP
rs905777010 1042 dbSNP
rs906746791 1044 dbSNP
rs1283528704 1046 dbSNP
rs1490047343 1049 dbSNP
rs1216168396 1051 dbSNP
rs1255892569 1059 dbSNP
rs530384572 1064 dbSNP
rs1316962799 1065 dbSNP
rs1203938437 1070 dbSNP
rs1291939816 1071 dbSNP
rs1440209687 1072 dbSNP
rs1186144660 1074 dbSNP
rs1243269413 1076 dbSNP
rs1045324894 1078 dbSNP
rs778355579 1082 dbSNP
rs1192018579 1086 dbSNP
rs371925495 1090 dbSNP
rs1224059448 1091 dbSNP
rs1480947743 1091 dbSNP
rs780819275 1100 dbSNP
rs563206369 1114 dbSNP
rs1414041767 1119 dbSNP
rs550850864 1129 dbSNP
rs796855436 1133 dbSNP
rs1401744762 1138 dbSNP
rs1341829947 1144 dbSNP
rs1339629873 1145 dbSNP
rs531768187 1148 dbSNP
rs1223825250 1150 dbSNP
rs1276261759 1155 dbSNP
rs1342418073 1174 dbSNP
rs1199450588 1177 dbSNP
rs1284307647 1179 dbSNP
rs1053856920 1190 dbSNP
rs988837059 1198 dbSNP
rs936115641 1199 dbSNP
rs10116870 1200 dbSNP
rs974920583 1205 dbSNP
rs1305076084 1215 dbSNP
rs1408057936 1216 dbSNP
rs1202027704 1227 dbSNP
rs564822045 1231 dbSNP
rs139643998 1235 dbSNP
rs1019628783 1239 dbSNP
rs1169604118 1255 dbSNP
rs986459779 1268 dbSNP
rs955196493 1269 dbSNP
rs1421312653 1274 dbSNP
rs1325272222 1282 dbSNP
rs192633370 1283 dbSNP
rs560511422 1284 dbSNP
rs1170577040 1286 dbSNP
rs1329032701 1289 dbSNP
rs1025345233 1290 dbSNP
rs779119555 1292 dbSNP
rs1279717386 1297 dbSNP
rs993912424 1302 dbSNP
rs543124335 1308 dbSNP
rs527843221 1310 dbSNP
rs1490655886 1314 dbSNP
rs1016738968 1317 dbSNP
rs1201015192 1331 dbSNP
rs1481765001 1332 dbSNP
rs1232817184 1333 dbSNP
rs1437918338 1333 dbSNP
rs963668789 1335 dbSNP
rs1205771768 1336 dbSNP
rs1379685889 1339 dbSNP
rs1016579087 1340 dbSNP
rs199768818 1341 dbSNP
rs554401573 1341 dbSNP
rs571000252 1341 dbSNP
rs754361996 1347 dbSNP
rs1004083141 1348 dbSNP
rs1329149277 1350 dbSNP
rs906723455 1352 dbSNP
rs1444028420 1355 dbSNP
rs1045693887 1357 dbSNP
rs1360855448 1361 dbSNP
rs766828298 1378 dbSNP
rs1218976486 1379 dbSNP
rs1324599327 1381 dbSNP
rs905749030 1381 dbSNP
rs1285377265 1383 dbSNP
rs1226683850 1384 dbSNP
rs1264163599 1385 dbSNP
rs893792098 1386 dbSNP
rs1196690852 1387 dbSNP
rs1046076179 1389 dbSNP
rs950019385 1401 dbSNP
rs552947259 1404 dbSNP
rs113066207 1405 dbSNP
rs1356200480 1406 dbSNP
rs1243796316 1408 dbSNP
rs936084284 1410 dbSNP
rs761136164 1414 dbSNP
rs926048125 1415 dbSNP
rs1189569213 1416 dbSNP
rs935394738 1418 dbSNP
rs1457273450 1431 dbSNP
rs1168281659 1433 dbSNP
rs923986023 1434 dbSNP
rs1463716451 1447 dbSNP
rs1330213113 1456 dbSNP
rs1051859957 1459 dbSNP
rs1429580180 1462 dbSNP
rs974853635 1469 dbSNP
rs750844241 1473 dbSNP
rs912087606 1474 dbSNP
rs188893010 1475 dbSNP
rs544865712 1479 dbSNP
rs951033356 1484 dbSNP
rs1481930674 1494 dbSNP
rs1316344467 1497 dbSNP
rs1198272376 1501 dbSNP
rs577801764 1504 dbSNP
rs1263941976 1510 dbSNP
rs1484277398 1513 dbSNP
rs975283460 1514 dbSNP
rs1025313952 1522 dbSNP
rs1423146064 1528 dbSNP
rs143228800 1530 dbSNP
rs962419082 1539 dbSNP
rs1169524310 1542 dbSNP
rs1406282083 1550 dbSNP
rs1467186063 1552 dbSNP
rs1462016512 1554 dbSNP
rs1402168298 1556 dbSNP
rs1383244941 1563 dbSNP
rs558759957 1564 dbSNP
rs1016704438 1575 dbSNP
rs1280593077 1581 dbSNP
rs1265234221 1595 dbSNP
rs1206995467 1597 dbSNP
rs1218329533 1603 dbSNP
rs1001349211 1606 dbSNP
rs951084775 1609 dbSNP
rs1208165233 1614 dbSNP
rs905671324 1615 dbSNP
rs1307876658 1616 dbSNP
rs865806550 1620 dbSNP
rs3739531 1621 dbSNP
rs1487193895 1626 dbSNP
rs566987356 1627 dbSNP
rs1434510976 1628 dbSNP
rs891752867 1633 dbSNP
rs796666491 1636 dbSNP
rs1453801299 1637 dbSNP
rs1000167056 1645 dbSNP
rs1012503670 1646 dbSNP
rs1451656743 1654 dbSNP
rs894097473 1656 dbSNP
rs1406473186 1661 dbSNP
rs1338444714 1663 dbSNP
rs1370071241 1664 dbSNP
rs1217715927 1680 dbSNP
rs554961540 1682 dbSNP
rs999895001 1685 dbSNP
rs147224411 1691 dbSNP
rs1242335175 1695 dbSNP
rs902530959 1697 dbSNP
rs3739532 1699 dbSNP
rs1159261158 1700 dbSNP
rs184494172 1701 dbSNP
rs1420305005 1711 dbSNP
rs1489311280 1712 dbSNP
rs577910084 1715 dbSNP
rs1189126010 1721 dbSNP
rs1052269334 1723 dbSNP
rs762505244 1726 dbSNP
rs571841483 1733 dbSNP
rs912041947 1735 dbSNP
rs1051980208 1739 dbSNP
rs929510326 1744 dbSNP
rs1166048559 1749 dbSNP
rs1352018170 1753 dbSNP
rs1445631558 1754 dbSNP
rs1245415682 1765 dbSNP
rs919519423 1768 dbSNP
rs1374311871 1772 dbSNP
rs144990824 1776 dbSNP
rs942543141 1788 dbSNP
rs909761802 1790 dbSNP
rs528132839 1797 dbSNP
rs1239363353 1815 dbSNP
rs1485685880 1817 dbSNP
rs1261504528 1829 dbSNP
rs1323287666 1830 dbSNP
rs1218062716 1831 dbSNP
rs1219033937 1833 dbSNP
rs1264548370 1839 dbSNP
rs1319959319 1843 dbSNP
rs1457913609 1843 dbSNP
rs1180027627 1851 dbSNP
rs560650604 1853 dbSNP
rs962386641 1855 dbSNP
rs1182956936 1860 dbSNP
rs1416517541 1867 dbSNP
rs909570944 1870 dbSNP
rs1245231240 1872 dbSNP
rs984018641 1875 dbSNP
rs929600238 1876 dbSNP
rs1467357310 1880 dbSNP
rs980244046 1880 dbSNP
rs1376292011 1887 dbSNP
rs775600105 1888 dbSNP
rs1453378473 1889 dbSNP
rs1284720993 1891 dbSNP
rs982252765 1892 dbSNP
rs375178135 1893 dbSNP
rs1226459703 1901 dbSNP
rs542210357 1919 dbSNP
rs970544401 1927 dbSNP
rs1024555333 1932 dbSNP
rs1200178536 1933 dbSNP
rs1255693154 1934 dbSNP
rs1380290859 1940 dbSNP
rs1023802421 1952 dbSNP
rs1239788676 1953 dbSNP
rs1472078683 1954 dbSNP
rs1360864849 1959 dbSNP
rs990953623 1962 dbSNP
rs1478983389 1964 dbSNP
rs1289046554 1970 dbSNP
rs1454900258 1972 dbSNP
rs192912657 1982 dbSNP
rs139465394 1983 dbSNP
rs1032572152 1985 dbSNP
rs147366109 1987 dbSNP
rs1031568800 1992 dbSNP
rs1425923293 1993 dbSNP
rs1360877800 1994 dbSNP
rs1000093339 1996 dbSNP
rs904520155 2008 dbSNP
rs1039070059 2009 dbSNP
rs1008056295 2029 dbSNP
rs1275977644 2035 dbSNP
rs1428236711 2036 dbSNP
rs1219347881 2038 dbSNP
rs377239679 2041 dbSNP
rs545313959 2050 dbSNP
rs1262730168 2058 dbSNP
rs890550062 2060 dbSNP
rs1440148070 2065 dbSNP
rs998000488 2072 dbSNP
rs1264441487 2076 dbSNP
rs900559655 2078 dbSNP
rs188109044 2094 dbSNP
rs1052332307 2096 dbSNP
rs1490719535 2101 dbSNP
rs1039096663 2102 dbSNP
rs1423259776 2102 dbSNP
rs929471497 2111 dbSNP
rs919483695 2121 dbSNP
rs1223282183 2125 dbSNP
rs116784072 2133 dbSNP
rs888291012 2134 dbSNP
rs1293794227 2144 dbSNP
rs1401684865 2145 dbSNP
rs1296084908 2154 dbSNP
rs541239218 2159 dbSNP
rs1436776526 2160 dbSNP
rs909540140 2161 dbSNP
rs918246794 2164 dbSNP
rs1295863216 2176 dbSNP
rs1383618794 2181 dbSNP
rs10967891 2184 dbSNP
rs1302031984 2185 dbSNP
rs866440182 2185 dbSNP
rs1201292994 2186 dbSNP
rs1405001912 2189 dbSNP
rs1245147075 2196 dbSNP
rs1156712450 2198 dbSNP
rs1421420866 2198 dbSNP
rs377008877 2198 dbSNP
rs751296673 2198 dbSNP
rs765124517 2198 dbSNP
rs1368022835 2199 dbSNP
rs1167213370 2201 dbSNP
rs1461798530 2202 dbSNP
rs1405671834 2207 dbSNP
rs916295043 2218 dbSNP
rs990587153 2222 dbSNP
rs1439604098 2224 dbSNP
rs536641380 2226 dbSNP
rs1172987965 2232 dbSNP
rs148137723 2238 dbSNP
rs1357517560 2239 dbSNP
rs1428838848 2240 dbSNP
rs1288074032 2245 dbSNP
rs1200258564 2247 dbSNP
rs917012448 2250 dbSNP
rs1490849802 2257 dbSNP
rs144805611 2269 dbSNP
rs1176704738 2284 dbSNP
rs1363099559 2288 dbSNP
rs1193946683 2292 dbSNP
rs1458271598 2300 dbSNP
rs1480259592 2302 dbSNP
rs1032535971 2303 dbSNP
rs1460570127 2307 dbSNP
rs1229298041 2312 dbSNP
rs978747495 2322 dbSNP
rs1443869483 2325 dbSNP
rs1282186654 2328 dbSNP
rs781102049 2329 dbSNP
rs1341589225 2331 dbSNP
rs1247496178 2339 dbSNP
rs1223624181 2348 dbSNP
rs543781687 2357 dbSNP
rs149425341 2359 dbSNP
rs1199540127 2361 dbSNP
rs571854537 2365 dbSNP
rs77050811 2371 dbSNP
rs1007568235 2376 dbSNP
rs1300322683 2379 dbSNP
rs761351940 2385 dbSNP
rs1218039962 2389 dbSNP
rs1366519034 2390 dbSNP
rs1474721654 2391 dbSNP
rs192630781 2400 dbSNP
rs1405667544 2401 dbSNP
rs1177338329 2420 dbSNP
rs866217830 2422 dbSNP
rs1017612254 2424 dbSNP
rs1403603616 2434 dbSNP
rs1398331399 2435 dbSNP
rs1332729194 2442 dbSNP
rs1409921769 2445 dbSNP
rs1006287723 2450 dbSNP
rs1280398082 2455 dbSNP
rs1418472286 2464 dbSNP
rs528705012 2465 dbSNP
rs888263574 2466 dbSNP
rs1030431951 2477 dbSNP
rs1251126785 2481 dbSNP
rs1048266100 2484 dbSNP
rs1427480684 2492 dbSNP
rs993603142 2493 dbSNP
rs1203843540 2496 dbSNP
rs1485257868 2506 dbSNP
rs748409153 2513 dbSNP
rs1425378506 2520 dbSNP
rs1476623363 2522 dbSNP
rs897037687 2522 dbSNP
rs1377730904 2524 dbSNP
rs1401060217 2524 dbSNP
rs397961791 2524 dbSNP
rs568677224 2524 dbSNP
rs60758983 2524 dbSNP
rs1277308646 2526 dbSNP
rs1237679568 2530 dbSNP
rs1300399763 2537 dbSNP
rs1338773069 2541 dbSNP
rs1046747661 2555 dbSNP
rs567012233 2558 dbSNP
rs916263781 2567 dbSNP
rs942256933 2568 dbSNP
rs1450921630 2569 dbSNP
rs905446370 2575 dbSNP
rs1217131606 2576 dbSNP
rs1405738212 2579 dbSNP
rs1054868587 2582 dbSNP
rs1337789420 2583 dbSNP
rs80004122 2584 dbSNP
rs530402980 2589 dbSNP
rs1191200808 2590 dbSNP
rs1395053460 2593 dbSNP
rs978250220 2595 dbSNP
rs1160920429 2600 dbSNP
rs916926142 2601 dbSNP
rs1359059133 2608 dbSNP
rs1453427227 2611 dbSNP
rs1454328111 2615 dbSNP
rs992524403 2619 dbSNP
rs934445383 2620 dbSNP
rs924447130 2621 dbSNP
rs1370000930 2622 dbSNP
rs1364338862 2623 dbSNP
rs978570638 2624 dbSNP
rs976751901 2631 dbSNP
rs1240829383 2632 dbSNP
rs573321310 2644 dbSNP
rs964667405 2645 dbSNP
rs1314922440 2655 dbSNP
rs1214789661 2665 dbSNP
rs1017585776 2668 dbSNP
rs1489239572 2678 dbSNP
rs968573488 2682 dbSNP
rs1284250879 2686 dbSNP
rs1251856886 2691 dbSNP
rs1462416011 2701 dbSNP
rs1006261547 2705 dbSNP
rs1281639470 2713 dbSNP
rs1406411666 2713 dbSNP
rs1165895527 2717 dbSNP
rs1351890877 2727 dbSNP
rs1460093149 2732 dbSNP
rs1325428037 2735 dbSNP
rs1401133902 2739 dbSNP
rs1449016915 2749 dbSNP
rs62546174 2753 dbSNP
rs1350686980 2755 dbSNP
rs4413874 2772 dbSNP
rs544694865 2774 dbSNP
rs533214316 2779 dbSNP
rs1323233314 2783 dbSNP
rs559690592 2785 dbSNP
rs550995258 2786 dbSNP
rs1244497309 2790 dbSNP
rs1199981522 2793 dbSNP
rs1382688418 2797 dbSNP
rs1231716986 2801 dbSNP
rs1480582039 2809 dbSNP
rs1182901915 2812 dbSNP
rs1316216563 2818 dbSNP
rs1454892394 2824 dbSNP
rs1416452705 2826 dbSNP
rs993976911 2827 dbSNP
rs755078611 2828 dbSNP
rs1424586757 2829 dbSNP
rs1317854252 2831 dbSNP
rs993571469 2833 dbSNP
rs1352739598 2835 dbSNP
rs1387155410 2836 dbSNP
rs573924168 2840 dbSNP
rs1441414002 2847 dbSNP
rs762395549 2849 dbSNP
rs1016401942 2854 dbSNP
rs1297848004 2856 dbSNP
rs1381074716 2866 dbSNP
rs1422714948 2874 dbSNP
rs1006400970 2875 dbSNP
rs533896792 2876 dbSNP
rs1219994041 2893 dbSNP
rs186903986 2895 dbSNP
rs572904567 2899 dbSNP
rs1240011914 2903 dbSNP
rs557928074 2909 dbSNP
rs895475287 2912 dbSNP
rs767927207 2914 dbSNP
rs183318430 2915 dbSNP
rs923460721 2918 dbSNP
rs1478912454 2922 dbSNP
rs1263310539 2923 dbSNP
rs557278904 2924 dbSNP
rs1418927834 2950 dbSNP
rs924374119 2959 dbSNP
rs976284233 2970 dbSNP
rs978537934 2980 dbSNP
rs1377180452 2982 dbSNP
rs1359415213 2986 dbSNP
rs751249066 2988 dbSNP
rs763801962 2990 dbSNP
rs947261202 2998 dbSNP
rs1340849027 3004 dbSNP
rs910398886 3013 dbSNP
rs986050745 3022 dbSNP
rs1338199101 3023 dbSNP
rs954819919 3027 dbSNP
rs1030327144 3031 dbSNP
rs1269841812 3032 dbSNP
rs1281429893 3034 dbSNP
rs143901988 3037 dbSNP
rs539684845 3037 dbSNP
rs758236931 3037 dbSNP
rs879408577 3037 dbSNP
rs1025251852 3039 dbSNP
rs1468231683 3041 dbSNP
rs1192963638 3049 dbSNP
rs1432810339 3051 dbSNP
rs1013501528 3061 dbSNP
rs1360940106 3062 dbSNP
rs1402174620 3069 dbSNP
rs1315859309 3071 dbSNP
rs200530768 3074 dbSNP
rs761537669 3077 dbSNP
rs1301427414 3079 dbSNP
rs1016369278 3082 dbSNP
rs1006333957 3083 dbSNP
rs969571095 3087 dbSNP
rs1024257542 3089 dbSNP
rs1033598255 3090 dbSNP
rs1013835061 3091 dbSNP
rs896736451 3097 dbSNP
rs77759170 3098 dbSNP
rs998491779 3106 dbSNP
rs1406895961 3117 dbSNP
rs902919480 3132 dbSNP
rs1042766911 3133 dbSNP
rs775190435 3135 dbSNP
rs902004704 3137 dbSNP
rs947152021 3142 dbSNP
rs550917320 3147 dbSNP
rs910375302 3155 dbSNP
rs910766265 3156 dbSNP
rs943549311 3156 dbSNP
rs62546173 3158 dbSNP
rs1050723239 3160 dbSNP
rs1383847174 3170 dbSNP
rs1425295622 3170 dbSNP
rs772248625 3172 dbSNP
rs1327448795 3186 dbSNP
rs191199804 3194 dbSNP
rs1439444856 3198 dbSNP
rs1310703313 3202 dbSNP
rs73431156 3204 dbSNP
rs1237402344 3207 dbSNP
rs919280944 3211 dbSNP
rs1357449527 3216 dbSNP
rs972156293 3220 dbSNP
rs1235373866 3226 dbSNP
rs1271447366 3227 dbSNP
rs538207874 3228 dbSNP
rs1024401132 3238 dbSNP
rs1224350203 3239 dbSNP
rs1238761558 3251 dbSNP
rs1439466297 3257 dbSNP
rs1179505735 3259 dbSNP
rs145172012 3264 dbSNP
rs1472962976 3272 dbSNP
rs373662619 3274 dbSNP
rs1415191500 3283 dbSNP
rs1460525035 3289 dbSNP
rs1033565628 3307 dbSNP
rs1397954366 3316 dbSNP
rs1390200316 3327 dbSNP
rs909242247 3329 dbSNP
rs1341461959 3333 dbSNP
rs1341764813 3340 dbSNP
rs903497581 3346 dbSNP
rs549187398 3349 dbSNP
rs1009312450 3351 dbSNP
rs969915908 3353 dbSNP
rs551714606 3354 dbSNP
rs1014181697 3356 dbSNP
rs537114936 3357 dbSNP
rs1485909028 3361 dbSNP
rs1189791489 3362 dbSNP
rs142725705 3364 dbSNP
rs1474689848 3372 dbSNP
rs1438614312 3374 dbSNP
rs999758666 3375 dbSNP
rs943518176 3382 dbSNP
rs1459974181 3387 dbSNP
rs902842424 3388 dbSNP
rs1042735899 3396 dbSNP
rs1355165626 3404 dbSNP
rs1049288909 3410 dbSNP
rs1410272586 3410 dbSNP
rs1011320698 3412 dbSNP
rs930914747 3422 dbSNP
rs1226766061 3429 dbSNP
rs1250757354 3430 dbSNP
rs888863737 3432 dbSNP
rs186086562 3434 dbSNP
rs532836213 3444 dbSNP
rs1479831757 3452 dbSNP
rs1429447576 3454 dbSNP
rs1348463352 3461 dbSNP
rs1212814055 3467 dbSNP
rs919262721 3469 dbSNP
rs1485185314 3470 dbSNP
rs182881326 3472 dbSNP
rs950083554 3475 dbSNP
rs547750100 3481 dbSNP
rs1191810037 3485 dbSNP
rs933162952 3495 dbSNP
rs138220020 3499 dbSNP
rs917313570 3501 dbSNP
rs1437145984 3502 dbSNP
rs923158848 3504 dbSNP
rs1469100285 3508 dbSNP
rs561839539 3509 dbSNP
rs940623524 3513 dbSNP
rs1381761749 3514 dbSNP
rs926464871 3518 dbSNP
rs1373239160 3521 dbSNP
rs1459319167 3524 dbSNP
rs1301086723 3537 dbSNP
rs1346956287 3542 dbSNP
rs1216236316 3547 dbSNP
rs1262170312 3550 dbSNP
rs191642278 3553 dbSNP
rs1261517690 3554 dbSNP
rs1484677838 3555 dbSNP
rs1204139398 3557 dbSNP
rs985199599 3558 dbSNP
rs1203343695 3567 dbSNP
rs968401303 3569 dbSNP
rs969467402 3570 dbSNP
rs1394991359 3571 dbSNP
rs759589638 3573 dbSNP
rs1161692774 3581 dbSNP
rs965760947 3583 dbSNP
rs1371117753 3587 dbSNP
rs916667555 3588 dbSNP
rs992317711 3595 dbSNP
rs575644486 3596 dbSNP
rs960843872 3599 dbSNP
rs567673957 3613 dbSNP
rs978303985 3617 dbSNP
rs968307714 3621 dbSNP
rs1406313259 3622 dbSNP
rs1308911530 3628 dbSNP
rs1314867400 3638 dbSNP
rs563676092 3640 dbSNP
rs1481309081 3643 dbSNP
rs1273358346 3646 dbSNP
rs898032368 3654 dbSNP
rs1036634110 3656 dbSNP
rs1407900845 3657 dbSNP
rs1011666059 3659 dbSNP
rs140515102 3663 dbSNP
rs1029176653 3665 dbSNP
rs1179412154 3669 dbSNP
rs917282393 3671 dbSNP
rs1418806500 3673 dbSNP
rs1166000612 3674 dbSNP
rs1420289491 3678 dbSNP
rs1055868456 3679 dbSNP
rs577649096 3680 dbSNP
rs2181029 3681 dbSNP
rs1461975852 3683 dbSNP
rs1299743117 3684 dbSNP
rs1370923182 3687 dbSNP
rs1293596711 3690 dbSNP
rs1336450466 3692 dbSNP
rs534957798 3695 dbSNP
rs979643486 3699 dbSNP
rs940549995 3700 dbSNP
rs1207262803 3703 dbSNP
rs967912696 3707 dbSNP
rs1213771021 3717 dbSNP
rs887702286 3718 dbSNP
rs1189058043 3720 dbSNP
rs1482198461 3722 dbSNP
rs1316341617 3724 dbSNP
rs1049030583 3730 dbSNP
rs948070078 3732 dbSNP
rs749337019 3740 dbSNP
rs916611712 3743 dbSNP
rs1164434173 3745 dbSNP
rs1420317523 3748 dbSNP
rs992641376 3757 dbSNP
rs1355761962 3788 dbSNP
rs939469452 3799 dbSNP
rs1451584215 3800 dbSNP
rs574009830 3803 dbSNP
rs1555453 3805 dbSNP
rs749495396 3807 dbSNP
rs1022981899 3808 dbSNP
rs1344154505 3812 dbSNP
rs1292230159 3815 dbSNP
rs989807730 3816 dbSNP
rs1159196482 3824 dbSNP
rs1362115261 3825 dbSNP
rs953142680 3830 dbSNP
rs1271552800 3834 dbSNP
rs953167051 3835 dbSNP
rs1212168316 3837 dbSNP
rs1028686816 3838 dbSNP
rs1445571599 3839 dbSNP
rs1258534405 3840 dbSNP
rs997265041 3848 dbSNP
rs1027362269 3858 dbSNP
rs995390075 3860 dbSNP
rs901596926 3861 dbSNP
rs1184821097 3862 dbSNP
rs1417355032 3867 dbSNP
rs1448814561 3872 dbSNP
rs1242842754 3873 dbSNP
rs1174138968 3878 dbSNP
rs1377052010 3879 dbSNP
rs1014733056 3889 dbSNP
rs1432616645 3892 dbSNP
rs1333176177 3902 dbSNP
rs1345385788 3907 dbSNP
rs1037008005 3914 dbSNP
rs1061832 3918 dbSNP
rs1363784083 3941 dbSNP
rs895816606 3946 dbSNP
rs1306195183 3954 dbSNP
rs1346235478 3957 dbSNP
rs1055835366 3963 dbSNP
rs1285263263 3964 dbSNP
rs1448933424 3969 dbSNP
rs1213846396 3974 dbSNP
rs1241626556 3983 dbSNP
rs887671324 3985 dbSNP
rs1289456636 3989 dbSNP
rs186398649 3990 dbSNP
rs1171757643 3991 dbSNP
rs948027323 3993 dbSNP
rs895128135 3997 dbSNP
rs1387298767 4000 dbSNP
rs1322038547 4002 dbSNP
rs1061833 4004 dbSNP
rs1369384346 4011 dbSNP
rs946515589 4013 dbSNP
rs1280527346 4018 dbSNP
rs913764930 4025 dbSNP
rs939397448 4026 dbSNP
rs924033801 4030 dbSNP
rs944665617 4041 dbSNP
rs181368909 4042 dbSNP
rs116471423 4044 dbSNP
rs1254869406 4046 dbSNP
rs1401251193 4057 dbSNP
rs189381378 4060 dbSNP
rs1471008726 4061 dbSNP
rs78612069 4065 dbSNP
rs143115775 4069 dbSNP
rs921556820 4070 dbSNP
rs1015130743 4077 dbSNP
rs549942593 4081 dbSNP
rs1391587673 4084 dbSNP
rs1330064063 4086 dbSNP
rs1337913755 4089 dbSNP
rs1014504454 4092 dbSNP
rs1168770006 4095 dbSNP
rs1428183505 4100 dbSNP
rs965757575 4104 dbSNP
rs1014702106 4105 dbSNP
rs1195975828 4105 dbSNP
rs1489861524 4107 dbSNP
rs1266700364 4108 dbSNP
rs1004660515 4123 dbSNP
rs1209185470 4124 dbSNP
rs1273617613 4126 dbSNP
rs531444254 4134 dbSNP
rs563785665 4137 dbSNP
rs781618589 4138 dbSNP
rs1250674424 4147 dbSNP
rs1267042033 4151 dbSNP
rs904539392 4160 dbSNP
rs1415024610 4163 dbSNP
rs1202157412 4164 dbSNP
rs895063323 4165 dbSNP
rs1399222075 4167 dbSNP
rs1408621929 4177 dbSNP
rs1356459974 4180 dbSNP
rs946176678 4181 dbSNP
rs1219936996 4182 dbSNP
rs1340012528 4183 dbSNP
rs1343025717 4186 dbSNP
rs1251853824 4187 dbSNP
rs1341357902 4187 dbSNP
rs1202873169 4188 dbSNP
rs545198650 4195 dbSNP
rs1387927110 4204 dbSNP
rs1052311930 4212 dbSNP
rs1212595870 4216 dbSNP
rs1003511262 4217 dbSNP
rs902581429 4218 dbSNP
rs1193248043 4229 dbSNP
rs1042432730 4237 dbSNP
rs149089542 4240 dbSNP
rs1461754488 4242 dbSNP
rs1474731930 4247 dbSNP
rs1355343165 4248 dbSNP
rs781501009 4249 dbSNP
rs559287982 4250 dbSNP
rs986024169 4251 dbSNP
rs1311365557 4256 dbSNP
rs541036384 4257 dbSNP
rs1401725467 4259 dbSNP
rs932862100 4265 dbSNP
rs922892857 4278 dbSNP
rs975724120 4283 dbSNP
rs1200200051 4289 dbSNP
rs1324718463 4291 dbSNP
rs1433754389 4293 dbSNP
rs370994432 4296 dbSNP
rs965685720 4299 dbSNP
rs573949656 4301 dbSNP
rs973556772 4302 dbSNP
rs907571151 4303 dbSNP
rs1015093631 4305 dbSNP
rs1205316168 4307 dbSNP
rs983193572 4311 dbSNP
rs992955138 4313 dbSNP
rs555833132 4317 dbSNP
rs1188552826 4319 dbSNP
rs185220853 4324 dbSNP
rs866499105 4329 dbSNP
rs1034572550 4331 dbSNP
rs1200200667 4339 dbSNP
rs1027859604 4344 dbSNP
rs1454529295 4345 dbSNP
rs147630286 4351 dbSNP
rs1382898098 4355 dbSNP
rs1434446200 4356 dbSNP
rs1262008082 4359 dbSNP
rs1021666700 4361 dbSNP
rs959520325 4367 dbSNP
rs1236344179 4374 dbSNP
rs1034917985 4379 dbSNP
rs1239337011 4380 dbSNP
rs751241263 4380 dbSNP
rs1262113674 4384 dbSNP
rs145298714 4392 dbSNP
rs1041128328 4404 dbSNP
rs1254228706 4411 dbSNP
rs1470235319 4412 dbSNP
rs539514899 4413 dbSNP
rs902509219 4415 dbSNP
rs1419986657 4416 dbSNP
rs1305438397 4417 dbSNP
rs1042402981 4419 dbSNP
rs375808366 4426 dbSNP
rs1378189924 4433 dbSNP
rs944513448 4435 dbSNP
rs1396738611 4436 dbSNP
rs890316876 4439 dbSNP
rs1468474490 4444 dbSNP
rs1291657593 4458 dbSNP
rs1011368860 4463 dbSNP
rs1405599563 4465 dbSNP
rs1173259616 4466 dbSNP
rs1308751904 4467 dbSNP
rs893898617 4480 dbSNP
rs1050286587 4485 dbSNP
rs3409 4497 dbSNP
rs764532227 4501 dbSNP
rs1418414601 4502 dbSNP
rs553754107 4513 dbSNP
rs1220018048 4514 dbSNP
rs1265358157 4515 dbSNP
rs1238629756 4521 dbSNP
rs3410 4525 dbSNP
rs1459739679 4527 dbSNP
rs1041307413 4535 dbSNP
rs568351817 4538 dbSNP
rs549839852 4552 dbSNP
rs1188842278 4558 dbSNP
rs940351807 4563 dbSNP
rs1403667705 4566 dbSNP
rs1162681660 4571 dbSNP
rs1349202212 4572 dbSNP
rs907595878 4582 dbSNP
rs1299685738 4584 dbSNP
rs1348348128 4587 dbSNP
rs1346437007 4591 dbSNP
rs917077622 4594 dbSNP
rs1340581529 4597 dbSNP
rs1356877522 4597 dbSNP
rs573259787 4597 dbSNP
rs867733616 4598 dbSNP
rs1312685220 4599 dbSNP
rs1311988752 4610 dbSNP
rs1207193597 4611 dbSNP
rs1211940827 4618 dbSNP
rs1272941257 4618 dbSNP
rs144398402 4618 dbSNP
rs1482901458 4618 dbSNP
rs1491041191 4618 dbSNP
rs370723055 4618 dbSNP
rs757106478 4618 dbSNP
rs79468810 4618 dbSNP
rs869292507 4618 dbSNP
rs940292555 4618 dbSNP
rs867239897 4619 dbSNP
rs1382352083 4620 dbSNP
rs1445236119 4620 dbSNP
rs1301787371 4621 dbSNP
rs1335025169 4622 dbSNP
rs1296031456 4641 dbSNP
rs1341982663 4643 dbSNP
rs1235446223 4646 dbSNP
rs1397870182 4648 dbSNP
rs1382954099 4655 dbSNP
rs1282800599 4657 dbSNP
rs1158058630 4659 dbSNP
rs752397194 4662 dbSNP
rs764846913 4663 dbSNP
rs930352498 4664 dbSNP
rs920369748 4678 dbSNP
rs1209627110 4700 dbSNP
rs960185132 4705 dbSNP
rs1419062108 4712 dbSNP
rs1380816297 4717 dbSNP
rs1486854581 4718 dbSNP
rs1190494877 4723 dbSNP
rs1160258377 4726 dbSNP
rs1448686111 4738 dbSNP
rs1174006545 4739 dbSNP
rs927471040 4743 dbSNP
rs1412405985 4748 dbSNP
rs1333027227 4753 dbSNP
rs991035647 4756 dbSNP
rs959217027 4762 dbSNP
rs1436642367 4763 dbSNP
rs1034844395 4772 dbSNP
rs1365077449 4774 dbSNP
rs765209310 4775 dbSNP
rs981986301 4776 dbSNP
rs1442504348 4781 dbSNP
rs966637868 4783 dbSNP
rs1442224458 4789 dbSNP
rs1020878654 4797 dbSNP
rs1343236652 4804 dbSNP
rs1218880801 4805 dbSNP
rs181858110 4808 dbSNP
rs139450117 4810 dbSNP
rs1206870916 4815 dbSNP
rs1246170130 4818 dbSNP
rs893860297 4821 dbSNP
rs1464405604 4832 dbSNP
rs1028391022 4835 dbSNP
rs758916612 4842 dbSNP
rs1248255606 4846 dbSNP
rs1187888547 4849 dbSNP
rs1476910593 4850 dbSNP
rs879015061 4851 dbSNP
rs10967890 4854 dbSNP
rs1408221522 4859 dbSNP
rs901336567 4862 dbSNP
rs1156340832 4869 dbSNP
rs1387220563 4870 dbSNP
rs1462434803 4877 dbSNP
rs1326048590 4879 dbSNP
rs1377545196 4881 dbSNP
rs1010199395 4888 dbSNP
rs1436205272 4890 dbSNP
rs1280401680 4891 dbSNP
rs533211836 4899 dbSNP
rs568737634 4900 dbSNP
rs1224604092 4905 dbSNP
rs1267621071 4913 dbSNP
rs1335485481 4920 dbSNP
rs1019642498 4924 dbSNP
rs1291929598 4926 dbSNP
rs1449692313 4927 dbSNP
rs940214100 4928 dbSNP
rs559424812 4932 dbSNP
rs1233191437 4937 dbSNP
rs887362330 4938 dbSNP
rs1473384616 4940 dbSNP
rs12348286 4944 dbSNP
rs1047818447 4952 dbSNP
rs867179550 4957 dbSNP
rs1050253206 4960 dbSNP
rs374531950 4960 dbSNP
rs1165580746 4964 dbSNP
rs930342883 4969 dbSNP
rs541024189 4975 dbSNP
rs899041587 4976 dbSNP
rs766264196 4980 dbSNP
rs1372757519 4984 dbSNP
rs1408248030 5000 dbSNP
rs529289408 5001 dbSNP
rs1038038932 5006 dbSNP
rs920277466 5019 dbSNP
rs1247042548 5020 dbSNP
rs1359093014 5022 dbSNP
rs10967889 5027 dbSNP
rs1056886955 5029 dbSNP
rs937792768 5030 dbSNP
rs1317782517 5031 dbSNP
rs927438176 5047 dbSNP
rs1483882949 5049 dbSNP
rs1202661588 5052 dbSNP
rs1250613958 5057 dbSNP
rs927798168 5058 dbSNP
rs1400637047 5065 dbSNP
rs1475273097 5072 dbSNP
rs980233479 5079 dbSNP
rs969295611 5080 dbSNP
rs867702734 5100 dbSNP
rs981919000 5107 dbSNP
rs914800418 5108 dbSNP
rs989496004 5110 dbSNP
rs966571238 5111 dbSNP
rs1428216479 5112 dbSNP
rs147782374 5116 dbSNP
rs1376266360 5118 dbSNP
rs1397953072 5122 dbSNP
rs1412885373 5129 dbSNP
rs7049080 5133 dbSNP
rs1008255987 5142 dbSNP
rs1370939110 5145 dbSNP
rs1192343164 5152 dbSNP
rs1298232074 5153 dbSNP
rs1477826579 5157 dbSNP
rs1344138547 5165 dbSNP
rs958053004 5166 dbSNP
rs1028365854 5167 dbSNP
rs1028777934 5168 dbSNP
rs996941048 5175 dbSNP
rs749516065 5185 dbSNP
rs1201779257 5189 dbSNP
rs1220973522 5190 dbSNP
rs1441323607 5200 dbSNP
rs1194602986 5203 dbSNP
rs1250410692 5216 dbSNP
rs1448095536 5224 dbSNP
rs775630906 5225 dbSNP
rs558038324 5228 dbSNP
rs1004395928 5235 dbSNP
rs546431723 5236 dbSNP
rs1490327198 5240 dbSNP
rs1467775840 5247 dbSNP
rs1170974836 5248 dbSNP
rs1291084327 5251 dbSNP
rs1382846888 5253 dbSNP
rs899008692 5255 dbSNP
rs1367244977 5257 dbSNP
rs553580365 5262 dbSNP
rs1037612890 5268 dbSNP
rs1296639088 5273 dbSNP
rs1005233856 5274 dbSNP
rs561726593 5278 dbSNP
rs1234978908 5283 dbSNP
rs1253878333 5284 dbSNP
rs887331442 5291 dbSNP
rs1048620448 5294 dbSNP
rs938336366 5296 dbSNP
rs905573423 5309 dbSNP
rs931584382 5327 dbSNP
rs1211977026 5330 dbSNP
rs898822618 5339 dbSNP
rs113158798 5343 dbSNP
rs373210671 5351 dbSNP
rs989074209 5356 dbSNP
rs934941395 5373 dbSNP
rs912821002 5374 dbSNP
rs553946570 5376 dbSNP
rs986721327 5378 dbSNP
rs535424842 5379 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase