miRTarBase - #MIRT023321 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PEA15   
Synonyms HMAT1, HUMMAT1H, MAT1, MAT1H, PEA-15, PED, PED-PEA15, PED/PEA15
Description phosphoprotein enriched in astrocytes 15
Transcript NM_003768   
Expression
Putative miRNA Targets on PEA15
3'UTR of PEA15
(miRNA target sites are highlighted)
>PEA15|NM_003768|3'UTR
   1 GCAAGGGGGAGGAAGAGGAGGAAGGTTGGACCTTCATCAGACCACTCCCTTCCCCCATCCTCCAGGAGAGGGGGCAAGGG
  81 CAACCCACCATCTACCCACTTACTAACCTGGTCCTAACCCCCTTACTGTGCGCGTGTGTGTGCGTGTGCGCACGCTCTGG
 161 CTGTTTGTCTATATGTCTAGCTCATCTAGTTCCTCTTCTTAAGGGGATGGGGGTCAGGGGCTAGGGGAGGGGGCTGAGTT
 241 TCCCCACTTTAGGAGGAGGTGGGGGCTATTTCTATGCAAATAGAAATCAGCACATTCCTCCTACTTCCCTTTCCTCCACT
 321 CCCCCCATATCTTTAAAGTGTGGAAGCAGAAAGGACCTGCATTTTCCTACATTGAGGAGCTGACATAGGGGTAAGGTATG
 401 GGAGAGGTAGGTGGATCCAGGGAAAAGCAGTGGGGACGGAAGGCAAAGAGACCACTCAACCCCCACCTGGAAGGGGCAAA
 481 GAAAAGCCAGAGTTCCATGTTTGTACTCCTGTGCTGGACTGTTTCCTGAGTACCAGCAGGTCCCTTTTTGTCTCTCATGG
 561 GCCTAGCATAGGTATGAGCCAGGGATCCTTTCCTGGTCCCTAAGATCAAACCCCATGGAGCAGCCAGCGTTAGATGCCCC
 641 CACCCACCTGTACTCTGGAGAGACTGTGCTGGGAACATGTACCACTGAGCCTGAGATGGGGATGAGGGCAGAGAGAGGGG
 721 AGCCCCCTCTTCCACTCAGTTGTTCCTACTCAGACTGTTGCACTCTAAACCTAGGGAGGTTGAAGAATGAGACCCTTAGG
 801 TTTTAACACGAATCCTGACACCACCATCTATAGGGTCCCAACTTGGTTATTGTAGGCAACCTTCCCTCTCTCCTTGGTGA
 881 AGAACATCCCAAGCCAGAAAGAAGTTAACTACAGTGTTTTCCTTTGCACCGATCCCCACCCCAATTCAATCCCGGAAGGG
 961 ACTTACTTAGGAAACCCTTCTTTACTAGATATCCTGGCCCCCTGGGCTTGTGAACACCTCCTAGCCACATCACTACAGTA
1041 CAGTGAGTGACCCCAGCCTCCTGCCTACCCCAAGATGCCCCTCCCCACCCTGACCGTGCTAACTGTGTGTACATATATAT
1121 TCTACATATATGTATATTAAAACTGCACTGCCATGTCTGCCCTTTTTTGTGGTGTCTAGCATTAACTTATTGTCTAGGCC
1201 AGAGCGGGGGTGGGAGGGGAATGCCACAGTGAAGGGAGTGGCAGAATCAAATTGCTACATAGTCCAAACAAAAAAGAAGG
1281 CTTTTTCAAAAAACATTAAATTCACATGCAGTCTCAGAGACTATTTAGACAAAGTTCAAGTTAGGAGCTTTTAGGATGTG
1361 GGAGTAAAACTTTAATGGGAGGGGAGGGCTGGCTGCTGGAAGAAGGAAGAAGCCAGACTGGTTAGACAGTACTCTTAACT
1441 CCTAGCCCAGCCTAGCGTGCCCTGCCCCTCTGGCCACTGCTGCAGACACCTGCCTTAACACACACACCTCTAGGACTCCA
1521 CAGTTTTGCCTTAAAGGACCTTCCCAAGTCTCCCTTTCCCTGTCTGGCTTCTCCCTTAAGAAGAGAGAGATACTTGTAGA
1601 ATTGGGTGGGGGGAATGAGCATGAACTGTCCTTCCATTTGGGATATGTTACATTAGAGTGAGAGAGAGAATAAGGAGCCT
1681 TTCTTATGGAAGAAATGGGAGAAGAGAGACAGGGTTCTTTTCAGCAGAGTCTAGTAGTTTCTCTGTAAGGCAAAATAATC
1761 TAAAAAGACTAACCTGCCCACCCACTCCTTATATTGCTGTGAGATTGCCCCTATCTTGTGCTCTTCTGTCTGCAGTGTGC
1841 ACGGCCTTGTTCTAACCCGGAATAAAGGTGATTGATTGTATTGCAACTAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :| |:||  | ||||:||| 
Target 5' taGAAATCA--G-CACATTCCt 3'
281 - 299 135.00 -13.90
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:: ||||  |:::||||| 
Target 5' agAGTTCCATGTTTGTACTCCt 3'
489 - 510 132.00 -13.20
3
miRNA  3' guuUGUG-GUAACAGUGUGAGGu 5'
             || |  | |||::|||||: 
Target 5' cctACTCAGACTGTTGCACTCTa 3'
745 - 767 127.00 -14.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30477468 16 COSMIC
COSN15657133 21 COSMIC
COSN4892369 27 COSMIC
COSN31504841 50 COSMIC
COSN20073528 55 COSMIC
COSN30164516 93 COSMIC
COSN24947561 132 COSMIC
COSN31606001 135 COSMIC
COSN31520528 284 COSMIC
COSN31491306 327 COSMIC
COSN15082475 357 COSMIC
COSN26632826 522 COSMIC
COSN26548509 551 COSMIC
COSN8636532 766 COSMIC
COSN31526754 917 COSMIC
COSN31524090 1033 COSMIC
COSN31596721 1057 COSMIC
COSN8645622 1277 COSMIC
COSN31544086 1331 COSMIC
COSN31550890 1344 COSMIC
COSN26669396 1385 COSMIC
COSN22199318 1390 COSMIC
COSN30172849 1464 COSMIC
COSN30177010 1590 COSMIC
COSN31522171 1681 COSMIC
COSN16346248 1804 COSMIC
COSN7180514 1843 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1314251123 7 dbSNP
rs112058684 10 dbSNP
rs11552717 12 dbSNP
rs569561993 13 dbSNP
rs1276446970 16 dbSNP
rs748009727 19 dbSNP
rs1464078974 20 dbSNP
rs1268419253 21 dbSNP
rs371465689 27 dbSNP
rs373598990 29 dbSNP
rs769825245 32 dbSNP
rs1242858153 34 dbSNP
rs548605601 38 dbSNP
rs772589067 40 dbSNP
rs368061272 42 dbSNP
rs1184069914 44 dbSNP
rs1390954270 53 dbSNP
rs772908449 54 dbSNP
rs979267092 55 dbSNP
rs999141188 56 dbSNP
rs1159953712 57 dbSNP
rs1400680663 58 dbSNP
rs11552712 63 dbSNP
rs551941744 67 dbSNP
rs1332498743 71 dbSNP
rs1174741440 75 dbSNP
rs1234876722 85 dbSNP
rs1273792509 86 dbSNP
rs1246425512 91 dbSNP
rs1191381161 98 dbSNP
rs1465941217 101 dbSNP
rs11552714 103 dbSNP
rs1248148306 104 dbSNP
rs924022448 110 dbSNP
rs935434746 118 dbSNP
rs986919155 120 dbSNP
rs1315115321 126 dbSNP
rs1049198 132 dbSNP
rs1219667295 132 dbSNP
rs11552718 133 dbSNP
rs1040327151 134 dbSNP
rs549116407 134 dbSNP
rs898784054 135 dbSNP
rs1187186265 137 dbSNP
rs1415914897 139 dbSNP
rs916332138 139 dbSNP
rs1321362836 140 dbSNP
rs761666619 142 dbSNP
rs1047285046 144 dbSNP
rs767419918 145 dbSNP
rs1452183637 146 dbSNP
rs1286628174 150 dbSNP
rs866656268 151 dbSNP
rs1386576818 154 dbSNP
rs980704083 155 dbSNP
rs1005010158 157 dbSNP
rs1311938940 162 dbSNP
rs1034794106 164 dbSNP
rs928862539 164 dbSNP
rs938953616 166 dbSNP
rs1187458220 170 dbSNP
rs896099738 172 dbSNP
rs1238643697 174 dbSNP
rs1011920934 175 dbSNP
rs567614359 182 dbSNP
rs1277974352 185 dbSNP
rs1230312120 190 dbSNP
rs1298605342 198 dbSNP
rs1214140921 203 dbSNP
rs1234936468 208 dbSNP
rs1285986279 209 dbSNP
rs1293606622 209 dbSNP
rs1316281548 210 dbSNP
rs1449449833 213 dbSNP
rs1375346858 217 dbSNP
rs1037289131 219 dbSNP
rs1311502264 220 dbSNP
rs41265777 221 dbSNP
rs1236861034 222 dbSNP
rs1371486934 223 dbSNP
rs1169323994 224 dbSNP
rs1262415322 234 dbSNP
rs1426316310 235 dbSNP
rs1351543385 236 dbSNP
rs1415371597 236 dbSNP
rs1210223852 243 dbSNP
rs918557404 260 dbSNP
rs1255306230 263 dbSNP
rs1255697481 265 dbSNP
rs967975759 276 dbSNP
rs1273584653 277 dbSNP
rs1204125603 286 dbSNP
rs1305950530 296 dbSNP
rs979214562 300 dbSNP
rs931319329 303 dbSNP
rs750218432 305 dbSNP
rs956587114 314 dbSNP
rs1412157220 317 dbSNP
rs1297923238 321 dbSNP
rs987253044 321 dbSNP
rs1460188243 323 dbSNP
rs1251475147 324 dbSNP
rs188325001 326 dbSNP
rs1164935429 327 dbSNP
rs546848578 328 dbSNP
rs964385110 329 dbSNP
rs975451286 330 dbSNP
rs1472851906 332 dbSNP
rs920157931 334 dbSNP
rs1425311397 336 dbSNP
rs931581928 337 dbSNP
rs1047357563 339 dbSNP
rs1040892075 342 dbSNP
rs1453915891 350 dbSNP
rs1222499139 370 dbSNP
rs1172426851 372 dbSNP
rs1373239842 373 dbSNP
rs1416178045 387 dbSNP
rs571386084 389 dbSNP
rs192770877 390 dbSNP
rs1330390067 392 dbSNP
rs901097232 403 dbSNP
rs999361355 407 dbSNP
rs866075364 409 dbSNP
rs1056581539 411 dbSNP
rs896269800 412 dbSNP
rs1030887260 417 dbSNP
rs17847309 438 dbSNP
rs1160694116 439 dbSNP
rs1457746755 447 dbSNP
rs1363142143 448 dbSNP
rs1156745523 449 dbSNP
rs1011010034 453 dbSNP
rs1049201 458 dbSNP
rs41265779 465 dbSNP
rs956713937 467 dbSNP
rs1210647183 471 dbSNP
rs969576917 475 dbSNP
rs1233699425 482 dbSNP
rs1278204176 488 dbSNP
rs753287587 493 dbSNP
rs1350342442 497 dbSNP
rs980262845 503 dbSNP
rs928747982 507 dbSNP
rs41265781 512 dbSNP
rs1233158413 515 dbSNP
rs1250969123 518 dbSNP
rs1479887769 531 dbSNP
rs964185918 532 dbSNP
rs754592306 536 dbSNP
rs918853224 539 dbSNP
rs1467476918 540 dbSNP
rs931312315 553 dbSNP
rs1435548176 557 dbSNP
rs1172749582 558 dbSNP
rs529111753 568 dbSNP
rs975398744 570 dbSNP
rs1190676853 572 dbSNP
rs911303546 575 dbSNP
rs1261062807 577 dbSNP
rs942820518 579 dbSNP
rs1203923767 581 dbSNP
rs1041115179 585 dbSNP
rs900981373 588 dbSNP
rs1192478882 595 dbSNP
rs935180735 596 dbSNP
rs1392780389 597 dbSNP
rs919896949 599 dbSNP
rs1210594873 603 dbSNP
rs952707857 614 dbSNP
rs982991883 618 dbSNP
rs1436034233 623 dbSNP
rs908800160 629 dbSNP
rs554285561 630 dbSNP
rs1173921720 632 dbSNP
rs1353536090 638 dbSNP
rs1227624340 640 dbSNP
rs894648000 646 dbSNP
rs1325368871 648 dbSNP
rs1460295527 650 dbSNP
rs938839118 651 dbSNP
rs1299630110 654 dbSNP
rs17847310 660 dbSNP
rs1312114223 663 dbSNP
rs541389150 664 dbSNP
rs1803942 665 dbSNP
rs1170733550 671 dbSNP
rs41265783 678 dbSNP
rs1191078393 684 dbSNP
rs1235078685 687 dbSNP
rs1426132047 688 dbSNP
rs1258818019 690 dbSNP
rs1187769938 693 dbSNP
rs1295192672 702 dbSNP
rs757734100 705 dbSNP
rs1277150992 707 dbSNP
rs1305938712 710 dbSNP
rs1207108428 712 dbSNP
rs904859030 719 dbSNP
rs1246336929 727 dbSNP
rs1356087648 728 dbSNP
rs903493136 729 dbSNP
rs1412797573 730 dbSNP
rs1003260191 733 dbSNP
rs1034781073 734 dbSNP
rs1410785854 736 dbSNP
rs1396020183 737 dbSNP
rs1468305852 739 dbSNP
rs1000497076 740 dbSNP
rs1459511225 743 dbSNP
rs960172132 744 dbSNP
rs1418589762 746 dbSNP
rs1164278068 750 dbSNP
rs1052775140 752 dbSNP
rs752616292 756 dbSNP
rs11552711 767 dbSNP
rs17847311 780 dbSNP
rs1254198088 783 dbSNP
rs972921334 787 dbSNP
rs1255405868 792 dbSNP
rs12040700 800 dbSNP
rs1436955651 808 dbSNP
rs1248154436 809 dbSNP
rs892424001 810 dbSNP
rs1008460370 811 dbSNP
rs781686101 814 dbSNP
rs11552713 820 dbSNP
rs17847312 821 dbSNP
rs746275942 843 dbSNP
rs1279716341 844 dbSNP
rs199676496 845 dbSNP
rs953112653 851 dbSNP
rs1327256360 857 dbSNP
rs1443634993 859 dbSNP
rs1172289002 861 dbSNP
rs1395820473 876 dbSNP
rs984137499 880 dbSNP
rs1027073231 888 dbSNP
rs952656006 902 dbSNP
rs982813710 909 dbSNP
rs1159296259 911 dbSNP
rs1469813277 916 dbSNP
rs1016256868 921 dbSNP
rs911175657 928 dbSNP
rs942713653 930 dbSNP
rs865926151 931 dbSNP
rs922711221 932 dbSNP
rs867730463 935 dbSNP
rs17847313 937 dbSNP
rs1052252327 940 dbSNP
rs1222769687 941 dbSNP
rs563826860 954 dbSNP
rs879060024 955 dbSNP
rs1236902974 960 dbSNP
rs200582842 961 dbSNP
rs373169910 961 dbSNP
rs531040513 961 dbSNP
rs549427536 962 dbSNP
rs893719739 966 dbSNP
rs1325752592 969 dbSNP
rs200022400 977 dbSNP
rs796987755 977 dbSNP
rs946585801 977 dbSNP
rs1319049089 988 dbSNP
rs1400242422 994 dbSNP
rs561151171 998 dbSNP
rs1044995199 1003 dbSNP
rs1175789001 1008 dbSNP
rs1441768950 1011 dbSNP
rs1394261057 1014 dbSNP
rs904827115 1020 dbSNP
rs1451243055 1027 dbSNP
rs936339474 1030 dbSNP
rs1214425935 1031 dbSNP
rs528468529 1032 dbSNP
rs1444812604 1036 dbSNP
rs538490663 1037 dbSNP
rs1211174156 1043 dbSNP
rs1348966071 1048 dbSNP
rs892364509 1052 dbSNP
rs943941119 1055 dbSNP
rs1296552536 1067 dbSNP
rs1232629768 1077 dbSNP
rs1034749934 1078 dbSNP
rs1364670085 1084 dbSNP
rs897607151 1085 dbSNP
rs1430054542 1086 dbSNP
rs1041378517 1098 dbSNP
rs777485199 1099 dbSNP
rs552660024 1110 dbSNP
rs1375133582 1113 dbSNP
rs1171503740 1114 dbSNP
rs996689306 1118 dbSNP
rs546618294 1125 dbSNP
rs1185883145 1127 dbSNP
rs1275620662 1128 dbSNP
rs1474108344 1134 dbSNP
rs1238707378 1135 dbSNP
rs1026272752 1137 dbSNP
rs1188129451 1139 dbSNP
rs780325574 1146 dbSNP
rs984747361 1156 dbSNP
rs1485132427 1169 dbSNP
rs1469272016 1191 dbSNP
rs1018543782 1193 dbSNP
rs35869719 1198 dbSNP
rs1027063237 1203 dbSNP
rs888569986 1206 dbSNP
rs749501763 1207 dbSNP
rs1004196458 1211 dbSNP
rs1015621636 1225 dbSNP
rs1187968969 1259 dbSNP
rs976747365 1261 dbSNP
rs922678845 1266 dbSNP
rs1474787794 1274 dbSNP
rs1162471604 1275 dbSNP
rs571204504 1281 dbSNP
rs960324661 1282 dbSNP
rs1419982262 1288 dbSNP
rs956824468 1288 dbSNP
rs988244453 1292 dbSNP
rs1317536107 1294 dbSNP
rs1343575614 1296 dbSNP
rs1432935704 1297 dbSNP
rs1178596206 1299 dbSNP
rs915024514 1300 dbSNP
rs1289717164 1301 dbSNP
rs946583484 1307 dbSNP
rs1204341415 1310 dbSNP
rs768867620 1317 dbSNP
rs774301959 1323 dbSNP
rs993057792 1326 dbSNP
rs1023649353 1327 dbSNP
rs1291606930 1337 dbSNP
rs970193944 1341 dbSNP
rs978941429 1345 dbSNP
rs925016789 1358 dbSNP
rs938986429 1362 dbSNP
rs184078808 1367 dbSNP
rs1396555238 1378 dbSNP
rs1326530948 1380 dbSNP
rs1460420000 1398 dbSNP
rs1336138656 1402 dbSNP
rs988308657 1405 dbSNP
rs1419294636 1411 dbSNP
rs1406860268 1415 dbSNP
rs897577377 1417 dbSNP
rs913545585 1420 dbSNP
rs993208339 1434 dbSNP
rs1282731901 1439 dbSNP
rs746079707 1443 dbSNP
rs1255392434 1453 dbSNP
rs1214879149 1457 dbSNP
rs575186308 1458 dbSNP
rs1271346399 1463 dbSNP
rs756334466 1468 dbSNP
rs1241348375 1469 dbSNP
rs1317721168 1473 dbSNP
rs1306608162 1485 dbSNP
rs1263468368 1488 dbSNP
rs1221818168 1490 dbSNP
rs1372935517 1501 dbSNP
rs899783291 1509 dbSNP
rs550370260 1519 dbSNP
rs753501863 1519 dbSNP
rs1392278739 1522 dbSNP
rs932470007 1535 dbSNP
rs1005740270 1536 dbSNP
rs1185565461 1552 dbSNP
rs1018926635 1561 dbSNP
rs13904 1564 dbSNP
rs964294119 1576 dbSNP
rs1344201739 1580 dbSNP
rs151110634 1582 dbSNP
rs371206337 1582 dbSNP
rs1259417814 1584 dbSNP
rs1397279818 1586 dbSNP
rs998137177 1587 dbSNP
rs888517806 1591 dbSNP
rs1454210164 1595 dbSNP
rs143973747 1603 dbSNP
rs1206940317 1608 dbSNP
rs760587164 1609 dbSNP
rs956712089 1610 dbSNP
rs988602077 1611 dbSNP
rs535986418 1613 dbSNP
rs189247699 1615 dbSNP
rs1402541039 1616 dbSNP
rs980659211 1618 dbSNP
rs1368663943 1628 dbSNP
rs148610120 1633 dbSNP
rs1375103050 1637 dbSNP
rs1014707704 1649 dbSNP
rs1382252502 1652 dbSNP
rs753628791 1657 dbSNP
rs926520266 1658 dbSNP
rs1286691224 1660 dbSNP
rs1314979534 1660 dbSNP
rs751646911 1661 dbSNP
rs868385352 1661 dbSNP
rs1434531255 1662 dbSNP
rs1195980529 1679 dbSNP
rs1376386701 1679 dbSNP
rs11552715 1680 dbSNP
rs1261132010 1692 dbSNP
rs1441925479 1702 dbSNP
rs1486767102 1702 dbSNP
rs970309876 1702 dbSNP
rs1056398573 1703 dbSNP
rs1342643632 1704 dbSNP
rs1252944865 1705 dbSNP
rs1228073050 1707 dbSNP
rs1306916315 1709 dbSNP
rs1275742992 1712 dbSNP
rs879484178 1714 dbSNP
rs929002656 1723 dbSNP
rs1311925865 1726 dbSNP
rs1033112626 1727 dbSNP
rs1330158377 1728 dbSNP
rs759264455 1730 dbSNP
rs887561170 1731 dbSNP
rs550180095 1735 dbSNP
rs1373064221 1743 dbSNP
rs965064704 1745 dbSNP
rs976862513 1750 dbSNP
rs921162468 1765 dbSNP
rs932583120 1780 dbSNP
rs1187518550 1789 dbSNP
rs1048353232 1795 dbSNP
rs1282022050 1798 dbSNP
rs752168406 1809 dbSNP
rs138812017 1812 dbSNP
rs1037113633 1813 dbSNP
rs1256126788 1814 dbSNP
rs1180756363 1819 dbSNP
rs3189630 1824 dbSNP
rs142061277 1825 dbSNP
rs781585009 1843 dbSNP
rs1179363802 1848 dbSNP
rs1337228428 1850 dbSNP
rs1331271115 1855 dbSNP
rs1392381138 1859 dbSNP
rs578251439 1860 dbSNP
rs1329940531 1873 dbSNP
rs1014240119 1877 dbSNP
rs1432909067 1879 dbSNP
rs1418676130 1880 dbSNP
rs1164389086 1883 dbSNP
rs1182221904 1885 dbSNP
rs1471925642 1885 dbSNP
rs998357607 1885 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*